ID: 1024251903

View in Genome Browser
Species Human (GRCh38)
Location 7:47511956-47511978
Sequence CTAAAGTACATGGAGCTTCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 71}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024251903_1024251911 12 Left 1024251903 7:47511956-47511978 CCACGAAGCTCCATGTACTTTAG 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1024251911 7:47511991-47512013 ACCTGTTCCCATGGGGACCAGGG No data
1024251903_1024251910 11 Left 1024251903 7:47511956-47511978 CCACGAAGCTCCATGTACTTTAG 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1024251910 7:47511990-47512012 CACCTGTTCCCATGGGGACCAGG 0: 1
1: 0
2: 1
3: 22
4: 185
1024251903_1024251906 3 Left 1024251903 7:47511956-47511978 CCACGAAGCTCCATGTACTTTAG 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1024251906 7:47511982-47512004 CCTTGTTCCACCTGTTCCCATGG No data
1024251903_1024251908 5 Left 1024251903 7:47511956-47511978 CCACGAAGCTCCATGTACTTTAG 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1024251908 7:47511984-47512006 TTGTTCCACCTGTTCCCATGGGG No data
1024251903_1024251907 4 Left 1024251903 7:47511956-47511978 CCACGAAGCTCCATGTACTTTAG 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1024251907 7:47511983-47512005 CTTGTTCCACCTGTTCCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024251903 Original CRISPR CTAAAGTACATGGAGCTTCG TGG (reversed) Intronic