ID: 1024251904

View in Genome Browser
Species Human (GRCh38)
Location 7:47511966-47511988
Sequence AACAAGGCGTCTAAAGTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 68}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024251904_1024251908 -5 Left 1024251904 7:47511966-47511988 CCATGTACTTTAGACGCCTTGTT 0: 1
1: 0
2: 0
3: 6
4: 68
Right 1024251908 7:47511984-47512006 TTGTTCCACCTGTTCCCATGGGG No data
1024251904_1024251910 1 Left 1024251904 7:47511966-47511988 CCATGTACTTTAGACGCCTTGTT 0: 1
1: 0
2: 0
3: 6
4: 68
Right 1024251910 7:47511990-47512012 CACCTGTTCCCATGGGGACCAGG 0: 1
1: 0
2: 1
3: 22
4: 185
1024251904_1024251907 -6 Left 1024251904 7:47511966-47511988 CCATGTACTTTAGACGCCTTGTT 0: 1
1: 0
2: 0
3: 6
4: 68
Right 1024251907 7:47511983-47512005 CTTGTTCCACCTGTTCCCATGGG No data
1024251904_1024251906 -7 Left 1024251904 7:47511966-47511988 CCATGTACTTTAGACGCCTTGTT 0: 1
1: 0
2: 0
3: 6
4: 68
Right 1024251906 7:47511982-47512004 CCTTGTTCCACCTGTTCCCATGG No data
1024251904_1024251911 2 Left 1024251904 7:47511966-47511988 CCATGTACTTTAGACGCCTTGTT 0: 1
1: 0
2: 0
3: 6
4: 68
Right 1024251911 7:47511991-47512013 ACCTGTTCCCATGGGGACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024251904 Original CRISPR AACAAGGCGTCTAAAGTACA TGG (reversed) Intronic