ID: 1024251908

View in Genome Browser
Species Human (GRCh38)
Location 7:47511984-47512006
Sequence TTGTTCCACCTGTTCCCATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024251903_1024251908 5 Left 1024251903 7:47511956-47511978 CCACGAAGCTCCATGTACTTTAG 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1024251908 7:47511984-47512006 TTGTTCCACCTGTTCCCATGGGG No data
1024251901_1024251908 17 Left 1024251901 7:47511944-47511966 CCACGGTGCCTTCCACGAAGCTC 0: 1
1: 0
2: 1
3: 7
4: 94
Right 1024251908 7:47511984-47512006 TTGTTCCACCTGTTCCCATGGGG No data
1024251902_1024251908 9 Left 1024251902 7:47511952-47511974 CCTTCCACGAAGCTCCATGTACT 0: 1
1: 0
2: 2
3: 25
4: 181
Right 1024251908 7:47511984-47512006 TTGTTCCACCTGTTCCCATGGGG No data
1024251904_1024251908 -5 Left 1024251904 7:47511966-47511988 CCATGTACTTTAGACGCCTTGTT 0: 1
1: 0
2: 0
3: 6
4: 68
Right 1024251908 7:47511984-47512006 TTGTTCCACCTGTTCCCATGGGG No data
1024251900_1024251908 30 Left 1024251900 7:47511931-47511953 CCGTTATTGGCTGCCACGGTGCC No data
Right 1024251908 7:47511984-47512006 TTGTTCCACCTGTTCCCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024251908 Original CRISPR TTGTTCCACCTGTTCCCATG GGG Intronic