ID: 1024251910

View in Genome Browser
Species Human (GRCh38)
Location 7:47511990-47512012
Sequence CACCTGTTCCCATGGGGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 185}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024251904_1024251910 1 Left 1024251904 7:47511966-47511988 CCATGTACTTTAGACGCCTTGTT 0: 1
1: 0
2: 0
3: 6
4: 68
Right 1024251910 7:47511990-47512012 CACCTGTTCCCATGGGGACCAGG 0: 1
1: 0
2: 1
3: 22
4: 185
1024251901_1024251910 23 Left 1024251901 7:47511944-47511966 CCACGGTGCCTTCCACGAAGCTC 0: 1
1: 0
2: 1
3: 7
4: 94
Right 1024251910 7:47511990-47512012 CACCTGTTCCCATGGGGACCAGG 0: 1
1: 0
2: 1
3: 22
4: 185
1024251902_1024251910 15 Left 1024251902 7:47511952-47511974 CCTTCCACGAAGCTCCATGTACT 0: 1
1: 0
2: 2
3: 25
4: 181
Right 1024251910 7:47511990-47512012 CACCTGTTCCCATGGGGACCAGG 0: 1
1: 0
2: 1
3: 22
4: 185
1024251903_1024251910 11 Left 1024251903 7:47511956-47511978 CCACGAAGCTCCATGTACTTTAG 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1024251910 7:47511990-47512012 CACCTGTTCCCATGGGGACCAGG 0: 1
1: 0
2: 1
3: 22
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024251910 Original CRISPR CACCTGTTCCCATGGGGACC AGG Intronic