ID: 1024254292

View in Genome Browser
Species Human (GRCh38)
Location 7:47528288-47528310
Sequence CTGGGGGTCTGCAGGGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 812
Summary {0: 1, 1: 1, 2: 11, 3: 90, 4: 709}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024254277_1024254292 22 Left 1024254277 7:47528243-47528265 CCATCACAGGCACCCTACTCTAA 0: 1
1: 0
2: 1
3: 14
4: 149
Right 1024254292 7:47528288-47528310 CTGGGGGTCTGCAGGGAAGGAGG 0: 1
1: 1
2: 11
3: 90
4: 709
1024254285_1024254292 -6 Left 1024254285 7:47528271-47528293 CCATCAGGGACCATCTGCTGGGG 0: 1
1: 0
2: 2
3: 21
4: 217
Right 1024254292 7:47528288-47528310 CTGGGGGTCTGCAGGGAAGGAGG 0: 1
1: 1
2: 11
3: 90
4: 709
1024254280_1024254292 9 Left 1024254280 7:47528256-47528278 CCTACTCTAAAGTGGCCATCAGG 0: 1
1: 0
2: 0
3: 7
4: 94
Right 1024254292 7:47528288-47528310 CTGGGGGTCTGCAGGGAAGGAGG 0: 1
1: 1
2: 11
3: 90
4: 709
1024254279_1024254292 10 Left 1024254279 7:47528255-47528277 CCCTACTCTAAAGTGGCCATCAG 0: 1
1: 0
2: 0
3: 6
4: 110
Right 1024254292 7:47528288-47528310 CTGGGGGTCTGCAGGGAAGGAGG 0: 1
1: 1
2: 11
3: 90
4: 709

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024254292 Original CRISPR CTGGGGGTCTGCAGGGAAGG AGG Intronic
900034227 1:393538-393560 CGGCTGTTCTGCAGGGAAGGAGG - Intergenic
900055062 1:623428-623450 CGGCTGTTCTGCAGGGAAGGAGG - Intergenic
900130168 1:1084063-1084085 CGTGGGGTCTGCAGGAAAGGAGG - Intronic
900176833 1:1294817-1294839 CTGCAGGTCCGCAGGGAAGGGGG + Intronic
900183784 1:1323952-1323974 CTGGGGGTCTGCTGGGCTGAGGG + Intronic
900316131 1:2057312-2057334 CTGGGGGTCTGCAGGGCGTCTGG + Intronic
900326641 1:2111455-2111477 CTGGGTGTCTCCAGAGAAGCTGG + Intronic
900557146 1:3286364-3286386 CTGGGGCTCTGCCAGGCAGGGGG - Intronic
900566582 1:3335164-3335186 CTGGGGCTGTGCAGGGCAGCTGG - Intronic
900619785 1:3581429-3581451 CCAGGGGGCTGCAGGGAAGCCGG + Intronic
900977105 1:6024782-6024804 ATGGGGGGCTCCAGGGCAGGAGG + Intronic
901039863 1:6357402-6357424 CACGGGGCCTGCAGGGCAGGCGG + Intronic
901496946 1:9627741-9627763 CCCGGGGCCAGCAGGGAAGGTGG - Intergenic
901511418 1:9719849-9719871 CTGGGGGAGGGCAGGGAAGCTGG + Intronic
901540262 1:9910629-9910651 CCGGGGGTGAGCAGGGAAGGCGG + Intergenic
901551336 1:9997781-9997803 CCCGGGGCCTGCACGGAAGGCGG - Intronic
901573323 1:10179719-10179741 CTGGATGTCTGCAGGGAAAAAGG - Intronic
902606804 1:17573563-17573585 CTGGGGGCTGGGAGGGAAGGAGG + Intronic
902615138 1:17619467-17619489 GTGGGGGTCTGCAGGGGAAGGGG + Intronic
902916273 1:19641578-19641600 CTCGGGGTCTGCATGAAAGATGG + Intronic
903140473 1:21335909-21335931 CAGTGGGTCTCCAGGGAGGGAGG + Intronic
903284389 1:22267914-22267936 CCTGGGGGCTGCAGGGGAGGGGG + Intergenic
903421055 1:23217783-23217805 GTAGGGGTCTGCAGGGAGGTGGG + Intergenic
903499971 1:23795334-23795356 CTCCAGGCCTGCAGGGAAGGAGG - Exonic
903575136 1:24335178-24335200 CTGTGGGTCTTCAGGGGAGAGGG - Intronic
904320929 1:29697465-29697487 CTCGGGGTGTGCAGGGTAGATGG - Intergenic
904328947 1:29745469-29745491 CTGGGGGGCTTCGGGGATGGAGG - Intergenic
904354551 1:29930660-29930682 CTGGGGGTGGGCAGAGGAGGGGG - Intergenic
904417552 1:30372556-30372578 CTGGGGGGCTTCAGGGATGAAGG + Intergenic
904493563 1:30874581-30874603 GTTGGGGTCTGCAGAGAGGGTGG + Exonic
904597408 1:31655571-31655593 CTGGGGGCCTGGTGGGAGGGTGG - Intronic
904850412 1:33455020-33455042 CTGGGGGTCAGCAAGGCAGTGGG + Intergenic
905417975 1:37817830-37817852 CTAGGGGGCAGCAGGGAATGTGG - Intronic
905422668 1:37859313-37859335 CTGGGGGTCTCCAAGCAAGGAGG + Intronic
905674902 1:39818331-39818353 CGGGGGTTCTGCTGGGAAGAAGG + Intergenic
906130387 1:43452145-43452167 CTGTGGGTGTGCGGAGAAGGGGG - Exonic
906215169 1:44034313-44034335 CTGGGGGCCTGCTGAGAAGGTGG + Intergenic
907303275 1:53501190-53501212 CTGGTGGGCTGAAGGGATGGGGG + Intergenic
907523506 1:55040184-55040206 CTTGGGGACTGCAGGCAAGGCGG + Intronic
907949659 1:59170055-59170077 CTGGTGGTATGCAGGAGAGGTGG - Intergenic
909502756 1:76353861-76353883 CTGGGGTTCTGAAGGTAAAGGGG - Intronic
910725494 1:90333966-90333988 CTGGGGGACTGTGGGGATGGTGG + Intergenic
910936331 1:92486316-92486338 CTGTGGGTCGGCAGGGGATGGGG + Intronic
912552595 1:110493972-110493994 CTGAGTGTGTGCTGGGAAGGGGG - Intergenic
912812682 1:112805755-112805777 CTGGAGGTCTGGTGGGGAGGTGG + Intergenic
912952928 1:114133038-114133060 CTGAGGGTATGCAGGGAGGAAGG - Intronic
913013966 1:114713979-114714001 CTGGGGGTGTGGAGGGTAAGGGG + Intronic
914703815 1:150155599-150155621 CGGGGTGTCTGGAGGGAACGAGG - Intronic
914830853 1:151169872-151169894 CTGGGGATCAGCAGGCAGGGAGG - Exonic
915031930 1:152887005-152887027 CTATGGGTCTGCAGGAATGGTGG + Intergenic
915099921 1:153491744-153491766 CTTGGGGTTTGCAGGGAAAGAGG - Intergenic
915544130 1:156586339-156586361 CTGGTGGGCTCCAGAGAAGGAGG - Intronic
915558613 1:156673995-156674017 CTGGGGGCCACCGGGGAAGGAGG - Intronic
915564811 1:156707388-156707410 CTGGGCTTCTGCAAGGAAGAGGG + Intergenic
915615425 1:157034138-157034160 CTGGGGCTCTGAAGGGAAGAGGG + Intronic
915625521 1:157111862-157111884 CTGGGGGAGGGCAGGGGAGGAGG + Intergenic
916236379 1:162592871-162592893 TTGGGGGTCTGGAGGGAGGATGG + Intronic
916519844 1:165553726-165553748 CTCTGGGACTGCAGAGAAGGAGG + Intronic
916909692 1:169333318-169333340 GTGGGAGGCTGTAGGGAAGGTGG + Intronic
916914673 1:169393138-169393160 CTTGGTGTCTGCAGAGAACGGGG + Intronic
917109366 1:171529401-171529423 CTGTGGGTATGCAGGAAAGGTGG - Intronic
917512776 1:175681892-175681914 ATGGGGGTCTGAAGGGAGGAAGG + Intronic
918673931 1:187258099-187258121 GTGGGGGTTTGGAGGGGAGGTGG - Intergenic
919814063 1:201426690-201426712 CAGGGGGTGGGCAGAGAAGGCGG - Intronic
919881361 1:201903335-201903357 CTTGGGGCCTGCAGGGCAGGAGG - Intronic
920053122 1:203175326-203175348 CTGGAGCTCTGCAGAGAGGGAGG - Exonic
920773765 1:208915307-208915329 ATGAAGGTCTGCAGGGAAGAAGG + Intergenic
920837425 1:209524572-209524594 CTGGGAGAGTGGAGGGAAGGGGG + Intergenic
922256583 1:223897707-223897729 CGGCTGTTCTGCAGGGAAGGAGG - Intergenic
922341687 1:224661926-224661948 CTGGCGGGAAGCAGGGAAGGTGG + Intronic
922619063 1:226979567-226979589 CTGGGGGTCCCCATGGACGGGGG - Intronic
922807422 1:228397595-228397617 CAGGGAGCCTGCAGGGCAGGTGG - Intronic
923126913 1:231040721-231040743 CTGGGGGTGAGCCGGGAAGCTGG - Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924825201 1:247531560-247531582 CTGTGGCTCTGCAGGCAAGCTGG - Exonic
1062900602 10:1142418-1142440 CTGGGGATCTGCACAGAAGTTGG - Intergenic
1062997743 10:1882476-1882498 CTGGCGGTCAGCAGGGACAGTGG - Intergenic
1063724481 10:8621832-8621854 CTGGGGGTGTGGTGGGAGGGTGG - Intergenic
1065738068 10:28771968-28771990 CTGGGCGGCTGCAGGGCAGAGGG - Intergenic
1067052972 10:43035271-43035293 CTGGGGATCTGCACCCAAGGAGG + Intergenic
1067360891 10:45577230-45577252 ATGGGGGGCTGTGGGGAAGGTGG + Intronic
1067683058 10:48452160-48452182 GTGGGGGCCTGCAGCGGAGGTGG + Intronic
1068803059 10:61163320-61163342 TTGGAGGTCTGCAGGGCAGAAGG + Intergenic
1069722704 10:70559960-70559982 CTGGGGGTCTGCAGAGAACTTGG - Intronic
1069835240 10:71304050-71304072 CTGGGGGTCTGCATGCAGGTGGG - Intergenic
1069966637 10:72123515-72123537 CTGTGCGTGTGCAGGGATGGGGG + Intronic
1070313221 10:75288614-75288636 CTGGGGCTCTGCAGGCCAAGTGG - Intergenic
1070559459 10:77554858-77554880 CTGGGGGTCTTAGGGAAAGGGGG + Intronic
1071211282 10:83344518-83344540 CTTGGGGGCTGCGGGGAGGGTGG - Intergenic
1072967169 10:99983628-99983650 CTGGGGGCACGCAGGGTAGGAGG - Intronic
1073053429 10:100684023-100684045 CTGGGGGGCTGCAGGGGGGAGGG + Intergenic
1073075937 10:100825972-100825994 CAGGGAGTCTGCAGGGAGGTGGG + Intronic
1073077134 10:100831142-100831164 CTGGGATTCTGATGGGAAGGAGG - Intergenic
1073176401 10:101560074-101560096 CTGTGGGGCTGCAGGGAAGGGGG - Intergenic
1073206056 10:101770019-101770041 CTGGGGGTTTGCGGGGGTGGGGG - Intergenic
1074226272 10:111487622-111487644 GTGGGGGTTTGCAGGGAAGATGG - Intergenic
1074481012 10:113820695-113820717 CTAGGGGTCTGAAGGGACAGTGG + Intergenic
1074769334 10:116723311-116723333 CTGGCTGTCTGCAGGGAGAGAGG + Intronic
1074948467 10:118304210-118304232 CTGGAGGTCAGAAGGGAGGGAGG - Exonic
1075896717 10:126002485-126002507 CTGGGGGTCTCCAAGAAATGAGG + Intronic
1075902793 10:126056563-126056585 GTGAGGGTTTGCAAGGAAGGTGG + Intronic
1075934536 10:126328082-126328104 CTAGGGGCCAGCAGGGAAGATGG - Intronic
1075970047 10:126644294-126644316 CTGGAGTTCTGCAGTGGAGGAGG - Intronic
1076538184 10:131196355-131196377 CTGTGCATTTGCAGGGAAGGTGG + Intronic
1076657594 10:132035344-132035366 CTGAGGACCTGCAGAGAAGGCGG + Intergenic
1077101332 11:823864-823886 CTGGGGGACGGGAGGGGAGGAGG + Intronic
1077172564 11:1174481-1174503 ATGCAGTTCTGCAGGGAAGGGGG - Intronic
1077317363 11:1925476-1925498 CTGGGGGGCTGTGGGGAAGGGGG - Intronic
1077326680 11:1967013-1967035 CTGGGGGGCTGCAGGGCCGCCGG + Intronic
1077358081 11:2127786-2127808 CTGGGGGACTGCAGGGCTGGGGG + Intergenic
1077438729 11:2558410-2558432 CTGGGGGTCTCCAGGCGGGGGGG + Intronic
1077549389 11:3193361-3193383 CTGGCGTTGTGCAGGGAAGGGGG - Intergenic
1078064728 11:8070949-8070971 CAGGGGGGCTGGAGGGAAAGGGG + Intronic
1078197309 11:9146696-9146718 TTGTGGGTATGCAGGGAGGGAGG + Intronic
1080666046 11:34337257-34337279 CAGGGGCTGTGTAGGGAAGGAGG + Intronic
1081160407 11:39741940-39741962 GTAGGGGGCTGAAGGGAAGGTGG + Intergenic
1081489665 11:43557761-43557783 CTCGGGGGCGGCAGAGAAGGAGG + Intronic
1081615438 11:44587969-44587991 CTGGGTGGATGCAGGGATGGAGG - Intronic
1081795077 11:45813161-45813183 CTGGGGATCTGTCAGGAAGGAGG + Intergenic
1083106337 11:60361787-60361809 CTGGTTCTCTTCAGGGAAGGAGG - Intronic
1083175989 11:60950939-60950961 CGGCGGGTGTGGAGGGAAGGAGG - Intronic
1083445652 11:62706511-62706533 CTTGGGGCCTGCAGGGAGGCAGG - Intronic
1083697181 11:64450592-64450614 CTGGTGGTCAGGAGGGGAGGTGG - Exonic
1084069238 11:66723366-66723388 CTCGGGTTCTGGAAGGAAGGAGG + Intronic
1084264829 11:67999490-67999512 CTGGTGGGCAGCAGGGCAGGAGG - Intronic
1084413607 11:69017846-69017868 GTGGGTGGCTGCAGGGCAGGAGG + Intergenic
1084518879 11:69650840-69650862 CAGGGGGTGTGCAGGGTGGGCGG + Intronic
1084617029 11:70243281-70243303 CTGGGGGTCTGCAGCAGAGCAGG + Intergenic
1085103909 11:73825518-73825540 CTTGGGGTCGGCGGGGAGGGGGG + Intronic
1085266065 11:75238786-75238808 CTGGGGGGCAGCAGGGGAGGGGG + Intergenic
1085342935 11:75745193-75745215 CCTGGGGCCTGCAGGGGAGGTGG - Intergenic
1085350771 11:75796759-75796781 CTGGGGGTCCCCAGAAAAGGGGG - Intronic
1085451500 11:76636792-76636814 TTGGGGTTCTGCGAGGAAGGAGG + Intergenic
1085553415 11:77396806-77396828 TTGGAGGGCTGCAGGGAAGCTGG - Intronic
1087091852 11:94281703-94281725 CTGGGGGTGAGGAGGGGAGGTGG + Intergenic
1088361209 11:108991997-108992019 GGTGGGGTCTGCTGGGAAGGAGG + Intergenic
1089179049 11:116568216-116568238 CAGGGGTTCTGGAGGGAGGGAGG + Intergenic
1089383440 11:118052368-118052390 CTGGGGCCCTGCAGGGAAGCAGG + Intergenic
1089638443 11:119831615-119831637 GTGGGGGTCTTAAGGGATGGAGG - Intergenic
1089699742 11:120237464-120237486 CTGGGGTTCTGGGGGGAATGGGG - Intronic
1089919133 11:122191079-122191101 TTGGGGGTTTGCCGGGGAGGTGG - Intergenic
1089958885 11:122598429-122598451 CTGCAGGTTTGCAGGGAACGGGG + Intergenic
1202809661 11_KI270721v1_random:22193-22215 CTGGGGGGCTGCAGGGCCGCCGG + Intergenic
1091770382 12:3147494-3147516 CTGGAAGTGGGCAGGGAAGGTGG - Intronic
1092038890 12:5365987-5366009 CCGGGGGTTTGAAAGGAAGGTGG + Intergenic
1092163263 12:6327707-6327729 CTGGGAGTCCTCAGGGGAGGAGG + Exonic
1092259746 12:6946470-6946492 CTTTGGGGCTGCAGGGAAGCTGG + Intronic
1092313928 12:7389522-7389544 ATGGGGGGCTGGAGAGAAGGTGG + Intronic
1092942073 12:13419370-13419392 TTAGGGGCCTGCAGGGAAGGGGG - Intergenic
1093511625 12:19936057-19936079 CTGGGGGCCAGCAGTGGAGGAGG + Intergenic
1094137182 12:27140185-27140207 CTGGAGGTGTGCAAGGAAGGCGG + Intergenic
1094317693 12:29150090-29150112 CTGGGGGTGTGCAGGGGAGCAGG + Intronic
1095825968 12:46530972-46530994 GTGGGGGGCTGCAGGGGATGGGG - Intergenic
1096112473 12:49037760-49037782 CTGGGGGTCAGCAGGTGAGCTGG + Exonic
1096658231 12:53104961-53104983 TGGGGGGTCAGCAGGGATGGGGG - Intronic
1096807484 12:54149305-54149327 CTGGGGGTTGGCTGGGAAGGGGG + Intergenic
1097084187 12:56455108-56455130 GTGGGGTTCAGCAGGGAAGTTGG + Intronic
1097182578 12:57179732-57179754 TTGGGTGTCTGCAGGGCAGTGGG - Intronic
1097261092 12:57720691-57720713 CTGGGGGAAGGCAGGGAATGAGG - Intronic
1099040463 12:77646706-77646728 TTGGGGGTGTGCAGGATAGGAGG + Intergenic
1099254613 12:80300393-80300415 CTGGGTGGCTGCAGAGAAGCAGG + Intronic
1100027974 12:90152687-90152709 CTGGGGTACTGCAGGGAACTGGG - Intergenic
1100218455 12:92478029-92478051 CACTGGGTCTGCAGGGATGGTGG + Intergenic
1100421830 12:94442352-94442374 CTGGGGACCTGGGGGGAAGGAGG + Intronic
1100689955 12:97029058-97029080 CTGGGGGGTAGCAGTGAAGGTGG + Intergenic
1100910854 12:99360967-99360989 CTGGGGGACTGCGGGGAGGTGGG + Intronic
1102014359 12:109637925-109637947 CTTGGGGGCTGCTGGGAGGGAGG + Intergenic
1102199709 12:111048823-111048845 CTGGGGGACTGCAGGGGATGTGG + Intronic
1102254447 12:111407443-111407465 CTGTGGGTCTCCAGGGATGCAGG + Intronic
1102516085 12:113447819-113447841 CAGGGTGGCTGCAGGGAAGAGGG + Intergenic
1102541445 12:113622332-113622354 CTGGAGGCCTGCAGGGAAGCTGG + Intergenic
1102545336 12:113650414-113650436 GTGGGGCTCTGCAGGTGAGGGGG + Intergenic
1102561044 12:113762530-113762552 CTGGGGGTGGGGAGGGAGGGGGG - Intergenic
1102961422 12:117095961-117095983 CTGTGGGACTGCAGGCAAGCTGG + Intronic
1103483133 12:121264157-121264179 CTGGGGATGTGACGGGAAGGAGG - Intronic
1104076106 12:125391553-125391575 CTGCAGGTCTGCAGGGGAGTAGG - Intronic
1104289600 12:127455702-127455724 AGGGGGGACTGCAGGGAAAGGGG + Intergenic
1104602105 12:130161453-130161475 CTGCGGGGCTGCAGCCAAGGAGG + Intergenic
1104963693 12:132499704-132499726 CTGGGGGGCTGCAGGGCTGGGGG + Intronic
1105054157 12:133081563-133081585 CTGGGGTTCTGCCAGGCAGGTGG - Intronic
1105829004 13:24147750-24147772 CTAGGGGTGTGGAGGGAACGGGG - Intronic
1105847313 13:24304556-24304578 GTGGGGGGCTGCAGGGGAGAAGG - Exonic
1107058507 13:36131205-36131227 CTGCGGGGCTGCAGGGCTGGGGG + Exonic
1107624880 13:42272127-42272149 CTGGGGGTCAGCGCGGGAGGGGG + Intergenic
1108167800 13:47711006-47711028 CTGGGGGTTAGGAGGGATGGAGG - Intergenic
1111951765 13:94713474-94713496 CTGGGGGCCTGCGGAGGAGGTGG + Intergenic
1112430859 13:99349111-99349133 CTGGAGGTCTGAAGACAAGGAGG - Intronic
1112471789 13:99695860-99695882 ATGAGGGTCTTCAGGGGAGGAGG + Intronic
1113377860 13:109782002-109782024 CTTGGCGTCTGGCGGGAAGGAGG - Intronic
1113889897 13:113730307-113730329 CTGGGGGACTGTCGGGATGGAGG - Intronic
1114189413 14:20429485-20429507 CTGGAGGTAAGCAGGCAAGGGGG - Exonic
1114200059 14:20511647-20511669 ATGGGGGTCTGCTGGGGAGGTGG + Intergenic
1114531035 14:23396654-23396676 CTGGGTGGTTGCAGGGCAGGTGG - Intronic
1115442625 14:33453762-33453784 CTGTGGGTCTCCAGGTAAGGAGG - Intronic
1116149982 14:41128702-41128724 CTGGGGGGCTGGAGGGCTGGGGG - Intergenic
1118303664 14:64636655-64636677 CTGGTGATGCGCAGGGAAGGAGG + Intergenic
1118698417 14:68409000-68409022 CTGGAGGTGGGCAGGGAATGAGG + Intronic
1119170278 14:72529651-72529673 CTGTGGGATTGCAGGGAGGGGGG - Intronic
1119322455 14:73739902-73739924 TGGGGGGGCTGCAGGGGAGGGGG + Exonic
1119647921 14:76361814-76361836 TTGGGGAACTCCAGGGAAGGTGG + Intronic
1120964903 14:90158489-90158511 CTGGGGACCAGAAGGGAAGGGGG + Intronic
1121509349 14:94500792-94500814 CTGGGGGTCCAGAGGCAAGGTGG - Intronic
1121556317 14:94840418-94840440 CTTGGGGTGTGCAGGGAGGTGGG + Intergenic
1121727926 14:96166493-96166515 CTGAGGACCTGCAGGGAGGGTGG + Intergenic
1122136346 14:99635132-99635154 GTTGGGGTCTGCAGGGGTGGAGG + Intergenic
1122205239 14:100145069-100145091 CTGGGGGGCGGCAGGGAAGCGGG - Exonic
1122214190 14:100192684-100192706 CTGGGCTTCTGCAGGGACGTAGG - Intergenic
1122278113 14:100605535-100605557 GAAGGGGTCTGCAGGGCAGGGGG + Intergenic
1122324971 14:100876350-100876372 CTGGGGGTGGACAGAGAAGGTGG + Intergenic
1122375963 14:101257578-101257600 CTGAGGGTCAGCAAGGAATGAGG + Intergenic
1122787130 14:104168939-104168961 CTGGGGGTCTGCGGGGAACAAGG + Intronic
1122903174 14:104790343-104790365 CTGGGGGTGGGGAGGGAGGGAGG - Intronic
1122967449 14:105137965-105137987 CTGGGGGTCTGATGGGGAAGGGG + Intergenic
1123106900 14:105845993-105846015 GTTGGGGGCAGCAGGGAAGGTGG - Intergenic
1123810034 15:23915572-23915594 CTGGGTGTCAACAGGGAAGTTGG - Intergenic
1124382247 15:29176735-29176757 CTGGCGACCTGGAGGGAAGGAGG - Intronic
1124631847 15:31342393-31342415 CTGGGTCTCAGGAGGGAAGGCGG - Intronic
1125345166 15:38711934-38711956 AGGGGGGTGGGCAGGGAAGGAGG + Intergenic
1125389191 15:39173151-39173173 ATGTGTGCCTGCAGGGAAGGAGG + Intergenic
1126418889 15:48450247-48450269 CTGGAGGTATGCAGGGGACGAGG + Intronic
1126430314 15:48576549-48576571 CTGGAGGAATGAAGGGAAGGTGG + Intronic
1127703179 15:61521900-61521922 CTAGTCATCTGCAGGGAAGGAGG + Intergenic
1128278013 15:66370467-66370489 GTGGGGGGCTGGAGGGGAGGAGG + Intronic
1128449329 15:67794065-67794087 ATGAGGCTCTGCAGTGAAGGTGG + Intronic
1130006997 15:80109171-80109193 GTGGTGGTGTGCAGGTAAGGTGG + Intronic
1130897818 15:88184292-88184314 CTATGTGTCTGCAGGGGAGGAGG + Exonic
1130990081 15:88870983-88871005 CTGGGGGGCTCCAGGGAGAGAGG - Intronic
1130995194 15:88899571-88899593 CTGGGGCTCTGAGGGGAGGGGGG - Intronic
1131294896 15:91139183-91139205 ATGGTGGTGTGAAGGGAAGGAGG + Intronic
1131446462 15:92502041-92502063 CTGAGGTTCTGCAGGGAGGAGGG - Intergenic
1132255685 15:100373879-100373901 GTGGGGGCGAGCAGGGAAGGAGG + Intergenic
1132320433 15:100920852-100920874 CTGGGGGTGTGAGGAGAAGGAGG - Intronic
1132534634 16:471998-472020 CTTGGGGGCCGCCGGGAAGGTGG + Intronic
1132595253 16:746208-746230 CTGCGGGTCTGCAGGGCTGCAGG + Intronic
1132595298 16:746383-746405 CTGCGGGTCTGCAGGGCTGCAGG + Intronic
1132655890 16:1041527-1041549 CTGGGGGTCTGGGGAGGAGGTGG - Intergenic
1132698858 16:1213765-1213787 CTGGGCCTCTGCGGGGAGGGCGG - Exonic
1132771772 16:1567543-1567565 CTGTGGATGAGCAGGGAAGGAGG - Intronic
1132836087 16:1954149-1954171 CTGGGGGGCAGGAAGGAAGGAGG + Intronic
1132845391 16:1998853-1998875 CTGGGGGTCAGAAGGTAAAGAGG + Intronic
1132894205 16:2220199-2220221 CTGGGGAGCTGCTGGGGAGGAGG - Intergenic
1132940167 16:2502415-2502437 CTGGAGGCCAGCAGGGACGGGGG - Exonic
1132943374 16:2519433-2519455 CTGGAGGACTGCAGGGAGGGGGG + Intronic
1132978424 16:2721586-2721608 CTGGGGGTCTGGAGGGAAGGAGG + Intergenic
1133025786 16:2988426-2988448 CTGGGGTTCTGGAGACAAGGAGG + Intergenic
1133055591 16:3144121-3144143 CTGGGGCTCAGCAGGGAGGCAGG - Intergenic
1133099475 16:3470454-3470476 CAGGGCGTCAGCAGGAAAGGAGG + Intronic
1133149024 16:3812632-3812654 CTGGGGGTCATCAGGGAACTTGG - Intronic
1133223780 16:4330527-4330549 CTAGGCCTCTGCAGGGAGGGCGG + Intronic
1133332312 16:4982234-4982256 CTGGGAGCCAGGAGGGAAGGGGG + Intronic
1133727961 16:8554936-8554958 CTGGGGGTCTGCAGAGCATAGGG - Intergenic
1133972680 16:10578926-10578948 CTGCTGGTTTGCAGGGAATGAGG - Intronic
1134076773 16:11297583-11297605 GGGGGAGTCTGCAGGGAAGGGGG - Intronic
1134112643 16:11524745-11524767 CTGGGTGGCTGGAGGGAGGGAGG - Intergenic
1134300013 16:12982540-12982562 CTGGGGGACTTCAGGGAATTGGG - Intronic
1134433673 16:14235438-14235460 TTGAGGATCGGCAGGGAAGGAGG - Intronic
1134568909 16:15274769-15274791 CTGGAGCCCTGCTGGGAAGGAGG + Intergenic
1134645157 16:15859243-15859265 CTGGGAGCCTGCAGGGGAAGAGG - Intergenic
1134694608 16:16214330-16214352 CTGGGGGTCTTCAGGGAAGAAGG + Exonic
1134733525 16:16481593-16481615 CTGGAGCCCTGCTGGGAAGGAGG - Intergenic
1134933975 16:18230689-18230711 CTGGAGCCCTGCTGGGAAGGAGG + Intergenic
1134977228 16:18580307-18580329 CTGGGGGTCTTCAGGGAAGAAGG - Intergenic
1135590364 16:23700828-23700850 CTGGGGAGCTGCTGGGAGGGAGG + Intronic
1135970863 16:27070949-27070971 CTGGGGGTCAGCAGTGGAGGTGG - Intergenic
1136657055 16:31715840-31715862 CTGGGTGTCTCCAGGAAGGGAGG + Intronic
1137549118 16:49424705-49424727 CTGGGGTTCTGGAAGGAAAGGGG + Intergenic
1137561527 16:49505530-49505552 CTGGGGGTCTGTCAGCAAGGGGG - Intronic
1138106166 16:54288082-54288104 CTGGGTGTCTGCCGTGGAGGTGG - Intergenic
1138782683 16:59808137-59808159 ATGGGTGTCTGCAGGGATGTTGG - Intergenic
1139522806 16:67494663-67494685 CTGGGGCTCTGCAAGTATGGAGG - Intergenic
1139653465 16:68374070-68374092 CTTGCGGTCTGCTGGGCAGGTGG - Intronic
1140116950 16:72050394-72050416 CTGTGGGTCCTCAGGGAAGTGGG - Intronic
1140442652 16:74999338-74999360 CGGGGGAGCCGCAGGGAAGGAGG - Exonic
1140448945 16:75054491-75054513 CATAGGGTCTGCAGGGAAGTGGG + Intronic
1140657438 16:77155304-77155326 CTGGGGCTCTTCAGGGAAGCTGG + Intergenic
1141459768 16:84171263-84171285 CTTGGGGGTTGCGGGGAAGGGGG - Intronic
1141540168 16:84713946-84713968 CTGGGGGTTGGCTGGGAAGGTGG + Intronic
1141642383 16:85348866-85348888 CTCGGGGGCTGGAGGGAGGGAGG - Intergenic
1141815669 16:86407976-86407998 CAGGGAAACTGCAGGGAAGGTGG + Intergenic
1141844887 16:86601547-86601569 CTGGGGCTGAGCAGGGCAGGAGG + Intergenic
1141852029 16:86652990-86653012 CAGAGGGTCTGGAGGGAAGAAGG - Intergenic
1141861353 16:86718584-86718606 CCCGGGGTCTGCAGGGAAGCAGG - Intergenic
1142125572 16:88408742-88408764 GCTGGGGTCTGCAGGGACGGGGG - Intergenic
1142238782 16:88935692-88935714 TCGGGGGCCTGCAGAGAAGGGGG + Intronic
1142290411 16:89191640-89191662 CTGGGAGGCTGCAGGCGAGGAGG - Exonic
1142292986 16:89201234-89201256 CTGCGGGGCAGCAGGGACGGGGG + Intronic
1142763329 17:2053507-2053529 CTGCCGGTCTCTAGGGAAGGCGG - Intergenic
1142966471 17:3585085-3585107 CTGGGGGTCCCCAGGGATGTGGG - Intronic
1143020924 17:3916842-3916864 CTGGGGGTCTGCAGCGAGCAAGG + Intergenic
1143383166 17:6508844-6508866 CTGGCGGTTTCCAGGGAAGATGG - Intronic
1144249435 17:13400717-13400739 ATGGGGGTGAGCAGGAAAGGAGG + Intergenic
1144330037 17:14214710-14214732 CTGAGGGTCTGCAGAGGAGCTGG - Intergenic
1145272555 17:21412606-21412628 CTGAGGCTGTGCTGGGAAGGGGG - Intronic
1145304965 17:21668960-21668982 CTGGGGGTCTGCAGGGAGGTCGG + Intergenic
1145894627 17:28447222-28447244 CTGGGGGTCTGCAATAAGGGCGG + Intergenic
1146399755 17:32493603-32493625 CTGGGGCTCAGTGGGGAAGGTGG + Exonic
1146552790 17:33796155-33796177 TTGGTGGTCTACAAGGAAGGTGG - Intronic
1146832399 17:36081508-36081530 CCTGGGGTCTGCAGGGAACCAGG - Intergenic
1147133921 17:38424530-38424552 TTGGGGGTAGGCAGAGAAGGAGG - Intergenic
1147646654 17:42038325-42038347 CTGGGGATCTGGAGGGAGGGAGG - Intronic
1147658681 17:42105484-42105506 ATGGGGGTCCGTAGGGAAAGAGG - Intronic
1147760451 17:42794760-42794782 CTGGAGCTCTTCTGGGAAGGAGG - Exonic
1147961659 17:44171167-44171189 TCTGTGGTCTGCAGGGAAGGAGG - Intronic
1148063321 17:44851362-44851384 CTGAGGCCCTGCAGGGAATGGGG + Exonic
1148177973 17:45584455-45584477 CTGGGGGTCGGCGGGGTTGGGGG + Intergenic
1148205774 17:45778982-45779004 CTGGGGGGCTGCAGGGGAGGGGG - Intergenic
1148645548 17:49217970-49217992 CTGGGGTTCTGGAGGGAAAGGGG - Intronic
1148721014 17:49753241-49753263 CTGGAGGTGTGCTGGGCAGGTGG + Intronic
1148742028 17:49898363-49898385 CTGGGGTCCTACAGGGAGGGAGG + Intergenic
1148784293 17:50137923-50137945 ATGGGGGTATGCAGGAGAGGAGG - Intronic
1148786263 17:50147709-50147731 GTGGGGTTCTGAAGGGAATGGGG - Intronic
1149298678 17:55284602-55284624 CTGGGCGACTGCAGGGGAGGGGG + Intronic
1149595323 17:57861808-57861830 CTGGGGCCCTGGAGGGAGGGGGG - Exonic
1149637953 17:58185404-58185426 CTGAGGGTGTGCAGGGAGGAGGG - Intergenic
1150135471 17:62692803-62692825 CTCGGGCTCTGCAAAGAAGGGGG - Exonic
1150473840 17:65459610-65459632 CTGGGGGTCGGCGGGGTGGGGGG + Intergenic
1150502770 17:65667048-65667070 CTGGAAGTATGCAGGGAGGGTGG + Intronic
1150834854 17:68554995-68555017 CTGGGACACAGCAGGGAAGGAGG - Intronic
1150963551 17:69940876-69940898 CTGAGGCTGTGCAGGGAAGCAGG - Intergenic
1151128879 17:71875235-71875257 GTGGGGGTGTGATGGGAAGGTGG + Intergenic
1151360045 17:73583391-73583413 CTGGGGGTCTGCTACGAGGGTGG + Intronic
1151374684 17:73679112-73679134 AAGGGGGTTTGCAGGGCAGGAGG - Intergenic
1151458755 17:74242239-74242261 CTGGAGGTCTGCAGGGCTGTAGG + Intronic
1151683092 17:75631894-75631916 ATGGGGGTCTCCCGGGAAGCAGG + Intronic
1151785149 17:76271777-76271799 CTGCAGGGCTGCGGGGAAGGGGG - Intergenic
1152031599 17:77846554-77846576 CAGGGGCTCTGTGGGGAAGGAGG - Intergenic
1152039224 17:77892316-77892338 CTGGGGGTCTGCTTGGCTGGAGG + Intergenic
1152540271 17:80971253-80971275 CTGGGGGGCTGCATGGACGATGG - Intergenic
1152573424 17:81130240-81130262 CTGGGGGTGGGCAGTGATGGGGG + Intronic
1152595282 17:81234782-81234804 CTGGGCTCCTGCAGGGAAGATGG - Intronic
1152793350 17:82293488-82293510 CTGCGGGGCTGCGGGGAGGGAGG + Intergenic
1152901935 17:82947316-82947338 GTGGGTGTGTGGAGGGAAGGTGG - Intronic
1154349008 18:13567451-13567473 CTGGGGGGCTGCAGCGGCGGGGG - Intronic
1154411616 18:14144988-14145010 CTGGGGTGCTGCAGGCAAAGGGG + Intergenic
1155160231 18:23189617-23189639 CCCGGGGACTGCAGGGCAGGCGG + Intronic
1156198467 18:34803131-34803153 CTGGGGGTATGCAGGGATTTAGG - Intronic
1156479717 18:37428410-37428432 CTGGGTCTCTGTAAGGAAGGAGG + Intronic
1156527012 18:37777274-37777296 CTGGGTGTCTGCAAGGACAGAGG - Intergenic
1157190322 18:45576237-45576259 CTGGGTGTTTGGAGAGAAGGTGG + Intronic
1157517643 18:48322058-48322080 TTGGGGCTATGCAGGGATGGAGG - Intronic
1159005074 18:63004115-63004137 CTGGGGGTCAGCAAGGAAGCTGG + Intergenic
1159007329 18:63024534-63024556 CTTGGGGTGTGCTGGGGAGGCGG - Intergenic
1160153969 18:76418898-76418920 CAGAGGGTCTGCAGGGCAGATGG + Intronic
1160323686 18:77920086-77920108 CCGGGGCTCAGCAGGGAAGGTGG + Intergenic
1160491330 18:79338454-79338476 CTTGGGGAGTTCAGGGAAGGTGG - Intronic
1160504252 18:79418124-79418146 CTGTGGGTCTGCAGGGCTCGGGG + Intronic
1160613515 18:80107532-80107554 CGGGAGGTCTGTAGGAAAGGGGG + Intergenic
1160764044 19:799165-799187 CTGGGGTCCTGCTGGGAGGGAGG + Intronic
1160790386 19:920267-920289 CTGGGGGGGTGCCGTGAAGGTGG - Intronic
1160812615 19:1019490-1019512 CTGGGGGGCTGCAGGGAGGAAGG + Intronic
1160895447 19:1400061-1400083 CTGGGGGTCTGCCTGGAGGGGGG + Intronic
1160895524 19:1400293-1400315 CTGGGGGTCTGCTTGGAGGAGGG + Intronic
1160967483 19:1753071-1753093 CTGGGGGTCTGTAGGGAACGGGG + Exonic
1161112730 19:2479098-2479120 CTTGGGGGCTGCAGGGCAGAGGG - Intergenic
1161268927 19:3378737-3378759 GGGTGGGTCTGCAGGGAACGGGG + Intronic
1161395763 19:4044137-4044159 GTGGGCGGCTGCAGGGAAGGTGG - Intergenic
1161403188 19:4077988-4078010 CAGGTGGGCTGCAGGGAGGGAGG - Intergenic
1161738336 19:6005448-6005470 CTGGGGGTCGTCAAGGAAGCTGG - Intronic
1161818741 19:6516327-6516349 CTGGGAGTCTGCTGGGGAAGCGG + Intergenic
1161845062 19:6707530-6707552 CTGAAGTTCTGCAGGGCAGGCGG + Exonic
1161979728 19:7624179-7624201 CTGGGGGCCAGCAGGGAAGGAGG - Intronic
1161992207 19:7690378-7690400 CTGGGGCTCTGCAGAGGTGGTGG - Intronic
1162021935 19:7872084-7872106 GGGAGGGTCTGCAGAGAAGGTGG + Exonic
1162023292 19:7878815-7878837 CTCCAGGCCTGCAGGGAAGGAGG + Intergenic
1162058730 19:8081529-8081551 CTGGGGGTGTTCAGGGACTGAGG + Intronic
1162128152 19:8510618-8510640 GGAGGGGGCTGCAGGGAAGGGGG - Exonic
1162430518 19:10625618-10625640 CTGGTCGCCTGCAGGGATGGGGG + Exonic
1162589835 19:11584221-11584243 CTTGGGGGCTGCAGGGAAGGGGG + Intronic
1162744532 19:12791243-12791265 CTCGGGGTACGCATGGAAGGAGG - Intronic
1162755783 19:12858750-12858772 CTGCGGGGCTGCAGGGAAGATGG + Intronic
1162854582 19:13458696-13458718 CAGAGGATCTGCAGGGCAGGTGG + Intronic
1162931829 19:13961347-13961369 CTGGGGGCGGGCAGGGCAGGGGG - Exonic
1162955065 19:14092852-14092874 CTGGGGGGCTGTGGGGAAAGAGG + Exonic
1163038145 19:14583460-14583482 CTGGGGGAATACAGGGAATGGGG + Intronic
1163038834 19:14587717-14587739 CTGGGGGAATACAGGGAACGGGG + Intronic
1163437047 19:17302187-17302209 CAGGGTGTCCACAGGGAAGGTGG + Intronic
1163481732 19:17560506-17560528 CTGGGTATCCCCAGGGAAGGCGG + Intronic
1163748011 19:19059427-19059449 CTGGGAGTCTCCAGGGAGGAGGG - Intronic
1164161418 19:22627779-22627801 TTGGGGGACTTCAGGGAATGAGG - Intergenic
1165112577 19:33510961-33510983 CTGGGGGTGGGTAGGGGAGGTGG - Intronic
1165272793 19:34724892-34724914 CTGGGGTTTTTCAGAGAAGGGGG - Intergenic
1165895577 19:39139118-39139140 CTGGGGTGCTGCAGGAAAGTGGG - Intronic
1166043434 19:40216265-40216287 ATTGGTGTCTGCAGGGGAGGTGG + Exonic
1166198909 19:41223603-41223625 CTGGGGGTCTCCAGGGTGGAGGG + Intronic
1166566949 19:43771162-43771184 CTGGGTCTATGGAGGGAAGGAGG + Intronic
1166931332 19:46303449-46303471 CTGGGAAACTGCAGGGCAGGGGG + Intronic
1167031967 19:46968363-46968385 CTGTGGGTCAGCAGAGCAGGAGG + Intronic
1167853733 19:52221275-52221297 TTGGGGAACTGCAGGCAAGGGGG + Intronic
1168276122 19:55279695-55279717 TTGAGGGTCTGCTGAGAAGGCGG + Exonic
1168317401 19:55490198-55490220 CTGAGGGTCTGAAGTGATGGAGG - Intronic
925142611 2:1560258-1560280 CTGGGGCTCAGCAGTGAAGGGGG + Intergenic
925167590 2:1727682-1727704 CAGGGGGTCTGGTGGGCAGGGGG - Intronic
925718670 2:6807859-6807881 CTGGGGGTGTGGAGGTAAAGGGG - Intergenic
925740105 2:6997780-6997802 CCCGGGGTCTGCAGGGAATGGGG + Intronic
925945168 2:8855308-8855330 CTTGGGGTCTACAGGACAGGTGG + Exonic
926111712 2:10188101-10188123 CTCGGGGTCCTCAGGGAAGCAGG - Intronic
926202789 2:10813350-10813372 CTGGGGTTCTCCAGAGAAGGAGG - Intronic
926304654 2:11629162-11629184 TCCAGGGTCTGCAGGGAAGGAGG - Intronic
926901155 2:17753543-17753565 CTGGGGGTCGCCAGCCAAGGGGG + Intronic
927865119 2:26583189-26583211 CAGGGGCTCTGCACTGAAGGGGG + Intronic
927927443 2:27023807-27023829 CTGGGGGTCTGCAGCCACCGAGG - Intronic
928098876 2:28423308-28423330 CTGCAGGTGTGCAGGAAAGGTGG + Intergenic
928105681 2:28469223-28469245 CTGGAAGGCTGCTGGGAAGGAGG + Intronic
928983238 2:37156997-37157019 CCGGGCGGCTGCAGGGAAGGCGG - Exonic
929170397 2:38926685-38926707 CTGGGGTTCTGCAGGGAGGAAGG + Intronic
929764204 2:44830857-44830879 CTGGTGGTCTTTCGGGAAGGTGG - Intergenic
930612270 2:53555640-53555662 CCGGGTGTCTGCAGGGCAGAGGG + Intronic
932048636 2:68376901-68376923 GTGGGGGACTGCAGGGAGGTGGG - Intronic
932418584 2:71588217-71588239 CTGGGGGTCTGAATGGGAGAAGG + Intronic
932485168 2:72080411-72080433 GTGGTGGGCTGCAGGGATGGGGG - Intergenic
933374979 2:81467459-81467481 CGGGGCGTCTGCAGGGCAGAGGG + Intergenic
933699462 2:85244176-85244198 CTGGGGGGCAGCACTGAAGGAGG + Intronic
933725575 2:85425141-85425163 ATGGGTGTCTCCTGGGAAGGTGG - Intronic
934555332 2:95284134-95284156 CTTGGGGTGTCCAGGGCAGGGGG + Intronic
935026794 2:99284813-99284835 CCAGGGTCCTGCAGGGAAGGAGG + Exonic
935065588 2:99644644-99644666 CTGCGCGTCTGCAGAGAAGCTGG - Intronic
936091133 2:109502028-109502050 CAGGAGGTCTGCAGGCGAGGTGG + Intronic
936513142 2:113164663-113164685 CCAGGGGCCTGCAGGGGAGGAGG + Intronic
937129222 2:119494677-119494699 CTCCTGGTCTGCAGGAAAGGTGG + Intronic
937248514 2:120509483-120509505 GAGGGAGGCTGCAGGGAAGGAGG + Intergenic
937339164 2:121079968-121079990 CTGAGGGTCTGGAGGGTAGGAGG + Intergenic
937893920 2:126963225-126963247 CTGGTGGTCTGCAGAGACTGCGG + Intergenic
938087786 2:128412586-128412608 CTGAGATTCTGCAGGGCAGGTGG + Intergenic
938540647 2:132281228-132281250 CCGTGGGGCTGCAGGGGAGGGGG + Intergenic
939475820 2:142685529-142685551 TTGGAGGACTGCAGAGAAGGAGG + Intergenic
939685551 2:145194728-145194750 CTGGGGGTAAGCAGCTAAGGTGG + Intergenic
940864408 2:158803729-158803751 TTTGGGGTCTGGATGGAAGGTGG + Intronic
942457953 2:176150885-176150907 CTGGGGGTGGGCTGGGATGGTGG - Intergenic
943794959 2:191980693-191980715 CTGGAGGTCTGGAGAGAAGAGGG - Intronic
944333939 2:198506417-198506439 GTGGGGGACTGGAGGGGAGGTGG + Intronic
945067839 2:205962072-205962094 CTGGGGGTCGGTGGAGAAGGAGG - Intergenic
946048768 2:216843289-216843311 CAGGGGGCCTGGAAGGAAGGGGG + Intergenic
946154986 2:217801377-217801399 CTGGGTGTCTGGAGGGAAGAGGG - Exonic
946174836 2:217916285-217916307 TGGGGGGTCTGGAGGGGAGGAGG - Intronic
946596349 2:221309879-221309901 CGGGGGGATTGCAAGGAAGGTGG - Intergenic
947129090 2:226903506-226903528 TTGGGGGTCTGCAGATAATGGGG + Intronic
947546217 2:231012086-231012108 TTGGGAGTCTGGAGGAAAGGAGG + Intronic
948131888 2:235607189-235607211 CTGGGTCTGGGCAGGGAAGGGGG - Intronic
948280172 2:236740832-236740854 CTGGGGGCTTGCTGGGGAGGTGG + Intergenic
948294508 2:236850592-236850614 GTGAGGGTCAACAGGGAAGGAGG - Intergenic
948301168 2:236908613-236908635 CTGTGTGGCTGGAGGGAAGGCGG - Intergenic
948728242 2:239947597-239947619 CTGGGGCTCGGCGGGGAGGGCGG - Intronic
948746876 2:240103052-240103074 GCTAGGGTCTGCAGGGAAGGAGG + Intergenic
948809512 2:240467517-240467539 CTGGGGCACAGGAGGGAAGGAGG - Exonic
948868925 2:240788674-240788696 CTGGGGGTCATCCTGGAAGGAGG + Intronic
1168923226 20:1558342-1558364 GAGGAGGCCTGCAGGGAAGGCGG + Exonic
1168951590 20:1805526-1805548 CTGGGGATGAGAAGGGAAGGTGG + Intergenic
1169306440 20:4494965-4494987 GTTGGAGTCTGCAGGGGAGGTGG - Intergenic
1169810339 20:9603407-9603429 CTTGGAGTCTTCAGGGAATGAGG - Intronic
1171145315 20:22776283-22776305 CTGGGAGTCTGGAGGCATGGTGG - Intergenic
1171522482 20:25786431-25786453 CTGGGGGCCTGCAGGGAGGTCGG + Intronic
1171530230 20:25848393-25848415 CTGGGGGCCTGCAGAGAGGTCGG + Intronic
1171554345 20:26069452-26069474 CTGGGGGCCTGCAGGGAGGTCGG - Intergenic
1171869562 20:30514231-30514253 CTGTGGGGCTGCAGGGGAGGGGG + Intergenic
1171978025 20:31607656-31607678 CTGCGGGTCTGGAGTGAAGGTGG + Intergenic
1172010382 20:31842933-31842955 CTGGGGTTCAGCAGGCATGGTGG + Intergenic
1172188153 20:33044327-33044349 CTTGGGATCTGGAGGGAAGCTGG + Intergenic
1172227870 20:33317229-33317251 GTGGGGGTGGTCAGGGAAGGAGG - Intergenic
1172392998 20:34578977-34578999 CTGAGGCTCTGAAGGGAAAGTGG - Intronic
1172786958 20:37474728-37474750 CTGGGGCTCGGCAGGGATGGAGG - Intergenic
1172946447 20:38693177-38693199 CTGGGGGCCTGCTGGGAGGAGGG - Intergenic
1172946818 20:38695955-38695977 CTGAGGGTCTGCTTTGAAGGTGG + Intergenic
1173820111 20:46014109-46014131 CTGGCGCCCTGCAGGGGAGGAGG - Exonic
1173827271 20:46055952-46055974 CTGGGGTTCTGGAGAGGAGGTGG + Intronic
1173851262 20:46219908-46219930 CAGGGGCTGTACAGGGAAGGTGG + Intronic
1174041780 20:47705316-47705338 CTGGCGTTCTGCAGAGGAGGAGG + Intronic
1174135685 20:48377415-48377437 GTGGGGGTCTTGTGGGAAGGTGG - Intergenic
1174339384 20:49886579-49886601 CTGGGAGCCTGCAGGGAGGCAGG - Intronic
1174503371 20:51001546-51001568 CTGGGGTTGTGCAGGGAAGCCGG - Intergenic
1174599174 20:51710477-51710499 CTGGGAGATTGCAGGGAAGAGGG - Intronic
1174658303 20:52190542-52190564 CTGGGGGACTGGCGGGGAGGGGG - Intronic
1175293334 20:57892821-57892843 CGGAGGGTGTGCAGGGATGGAGG - Intergenic
1175385380 20:58591655-58591677 CTGGGGGTCTGGAGGGCTGCAGG - Intergenic
1175727032 20:61325552-61325574 GTGGGGGTCTGTGGGGCAGGGGG + Intronic
1175930595 20:62492072-62492094 CTGGAGGCCTGCAGGGAGAGTGG + Intergenic
1175947513 20:62565714-62565736 AAGGGGGTCTGCAGGCCAGGTGG + Intronic
1176310148 21:5145118-5145140 GTTGGGGTCTGCTGGGTAGGTGG - Intronic
1176449629 21:6851123-6851145 CTGGGAAGCTGCAGTGAAGGTGG + Intergenic
1176656285 21:9591409-9591431 CTGGGGATCTGCAGGGAGGTCGG + Intergenic
1176827801 21:13716147-13716169 CTGGGAAGCTGCAGTGAAGGTGG + Intergenic
1176861439 21:14013437-14013459 CTGGGGTGCTGCAGGCAAAGGGG - Intergenic
1177713283 21:24807543-24807565 CTGTGGGTCAGCAGAGAAGTAGG + Intergenic
1178482405 21:32990895-32990917 CTTGGAGCCTGCAGGGAAAGAGG + Intergenic
1178491946 21:33057991-33058013 CTGGGGGAGGCCAGGGAAGGAGG + Intergenic
1179050917 21:37888009-37888031 CTGGAGCTGTGTAGGGAAGGTGG + Intronic
1179101591 21:38359430-38359452 TTGCGGGTCTGCAGGGCAGTCGG + Intergenic
1179826498 21:43968971-43968993 CAGGGGGTCTGCTGTGAAGCAGG - Intronic
1179830814 21:43994779-43994801 CTGGGGGTCTCCAGGGTACCTGG + Intergenic
1179846908 21:44116918-44116940 GTTGGGGTCTGCTGGGTAGGTGG + Intronic
1179874928 21:44262593-44262615 ATGGGGGCCTTCAGGGGAGGTGG + Intergenic
1179875026 21:44262871-44262893 ATGGGGGTGTTCAGGGGAGGTGG + Intergenic
1179926759 21:44539123-44539145 CTGGGGAGCTGCAAGGATGGAGG + Exonic
1179967709 21:44816958-44816980 CTGGGGGTGTGATGGAAAGGGGG + Intronic
1180073872 21:45451929-45451951 CTTGGGGTCTGCAGGAAGGCAGG - Intronic
1180109703 21:45642389-45642411 GTGGGGGGCGGCAGGGCAGGAGG - Intergenic
1180234685 21:46450813-46450835 TTGGGGGTCTGCAAGCAAGGTGG - Intergenic
1180856204 22:19047295-19047317 CTGGGGGGCTGCTGGGTGGGAGG - Intronic
1180898183 22:19352482-19352504 ATCGTGGTCTGCAGGGAGGGAGG + Intronic
1181018591 22:20086072-20086094 CTGGACGTTTGCAGGGGAGGTGG - Exonic
1181043229 22:20202769-20202791 CTGTGGGACTGCAGGGGAGACGG + Intergenic
1181151688 22:20888458-20888480 ATGGGGGGCTGGAGGGAAGCGGG - Exonic
1181547872 22:23613546-23613568 CTGGGGTCCTGCTGGGAAAGAGG - Intronic
1181572096 22:23773150-23773172 CTGGGGGTGTGAAGGGGAGCCGG + Intronic
1181745536 22:24952957-24952979 CTCCGGGTCTGCAGGGAGGGAGG + Intronic
1182320331 22:29474858-29474880 CTGGTTGTCTTGAGGGAAGGAGG - Intergenic
1182321339 22:29480101-29480123 CCGGGGGGCCGCAGGGGAGGAGG + Intergenic
1182440545 22:30361398-30361420 ATGAGGGTCTTCAGGGGAGGAGG + Intronic
1182757339 22:32690669-32690691 GTGGAGGGATGCAGGGAAGGTGG - Intronic
1183258301 22:36777267-36777289 CTAGGTGTCTGGAGGGAATGTGG - Intergenic
1183343029 22:37292527-37292549 CTGGGTTTCCGGAGGGAAGGGGG + Intronic
1183427336 22:37746740-37746762 CTAGGGGGCTGGAGGGGAGGTGG - Intronic
1183498637 22:38164918-38164940 CTGGGGTTCTCCAGGGCCGGGGG - Intronic
1184095212 22:42312696-42312718 CTGAGGCTCAGCAGGGATGGGGG - Intronic
1184311368 22:43646223-43646245 CTGGGATTCTGCAGGGGAAGTGG - Intronic
1184341768 22:43890074-43890096 CTGTGGGTGTGCAGGGAAGGAGG + Intronic
1184390558 22:44200980-44201002 CTGGGAGTCGGCAGGAAGGGAGG - Intronic
1184452300 22:44590478-44590500 CTGAGGGGCTGCGGGCAAGGCGG + Intergenic
1184786557 22:46674771-46674793 CTGTGTGGCTGCAGGGGAGGGGG + Intronic
1184835651 22:47019553-47019575 GTGTGGGTGTGCAGGGAGGGAGG + Intronic
1184946963 22:47810699-47810721 TTGGGGTTCTGAAGGGACGGGGG + Intergenic
1185025765 22:48410934-48410956 TGGGGTTTCTGCAGGGAAGGAGG + Intergenic
1185070643 22:48654004-48654026 CGGCGGCTCTGGAGGGAAGGGGG + Intronic
1185244343 22:49765292-49765314 CTGGGGGGCTGCAGGGCTGGGGG + Intergenic
1185366585 22:50439639-50439661 CTGGGGTGCTGCAGGCAAAGGGG - Intronic
1185415084 22:50705353-50705375 CTGGGGGAACGCCGGGAAGGAGG - Intergenic
1203259850 22_KI270733v1_random:167556-167578 CCGGGGGGCGGCGGGGAAGGCGG + Intergenic
949365156 3:3272599-3272621 CTGGGGGAGTGCAGAGGAGGGGG + Intergenic
950111714 3:10422981-10423003 CTGGGGATCTGAGTGGAAGGTGG + Intronic
950439956 3:13004730-13004752 GTGAGGGGCTGCAGGGATGGAGG + Intronic
952980121 3:38727536-38727558 CTGTGGCTCTGCAGGGATGGTGG + Intronic
952996106 3:38883893-38883915 CTGGAGGACTCCAGGGAATGAGG + Intronic
953241715 3:41155422-41155444 CTCGGGGTGTGCAGGGAAAAGGG + Intergenic
953972699 3:47359518-47359540 CTGAGGGTGTGCAGGGCAGCAGG - Intergenic
954257600 3:49417438-49417460 CTGGGGGTGGGCAGTTAAGGTGG - Exonic
954277895 3:49554430-49554452 GGGGGCGTGTGCAGGGAAGGGGG + Intergenic
954422783 3:50427338-50427360 CTGGGGGTCCCCAGGGATGGGGG - Intronic
954423230 3:50429848-50429870 CGGGGGGTCAGCAGGGGTGGAGG - Intronic
954450209 3:50567583-50567605 CTCGGGGCTTGCAGGGAGGGCGG - Exonic
954627178 3:52028915-52028937 GTGGGGGTGTGCAGGGGATGGGG + Intergenic
955319646 3:57965063-57965085 CTGTGGGTCTACAGGTAAGTGGG + Intergenic
955389790 3:58513118-58513140 CTGGGGGTCAGTAGGGAGGAGGG - Intronic
955407845 3:58636533-58636555 CTGGGGGTGTCCAGAGAACGTGG + Intronic
955751550 3:62189421-62189443 CTGGTGGGCTGCAGGGCATGTGG + Intronic
956090158 3:65657777-65657799 CTGGGGGTCATCATGCAAGGTGG - Intronic
957914613 3:86672219-86672241 CTGGGGGACTGGGGGAAAGGAGG - Intergenic
959063367 3:101635155-101635177 CTGGGGCTCTTCAGAGAAGGGGG - Intergenic
959696537 3:109254550-109254572 CTGGTGTTCTGCAGGTAAGGAGG - Intergenic
960165870 3:114400692-114400714 CTGGGGGACCCTAGGGAAGGAGG + Intronic
960381341 3:116966326-116966348 ATGGGGGTCAGCAGAGAAAGTGG - Intronic
960969609 3:123130268-123130290 CTGGGGCTTTGCGGGGAAGGTGG + Intronic
961457972 3:127033574-127033596 CTGGGGCTCACCAGGGAAAGGGG + Intronic
961547141 3:127642526-127642548 ATGGGAGCCTGCAGGGAAAGTGG + Intronic
961603239 3:128076418-128076440 CTGCGGGCCTGCCGGGAGGGTGG + Intronic
961811910 3:129526914-129526936 CAGGTGGGCTGCAGGGAAGGGGG + Intergenic
962416931 3:135191839-135191861 CTGGGCCTCTGCAGGAAAGCCGG - Intronic
963233138 3:142929350-142929372 CTGAGGATCTGCAAGGAAGCAGG + Intergenic
963364159 3:144313344-144313366 CTGGGTGTCTACAGGAAAGAAGG - Intergenic
963580259 3:147117207-147117229 TTGGGGGTCTGCATGGCTGGAGG + Intergenic
964853263 3:161117975-161117997 GTGGGGGTCTGGGGGGTAGGTGG + Intronic
965715316 3:171596390-171596412 CTGGCTGTCTGCAGGTCAGGGGG - Intergenic
965929324 3:174023339-174023361 CTGGGGGTCTGCCTGGAGGCAGG + Intronic
966775854 3:183542058-183542080 CTGAGGGCCTGCAGGGCAGCCGG - Intronic
966910944 3:184559656-184559678 ATGGGGGACTGCAGGGCAAGGGG + Intronic
967438390 3:189477849-189477871 CTGGGCTTCTGGAGGGGAGGGGG - Intergenic
967536200 3:190606076-190606098 CTTGGGGGTTGCAGGTAAGGGGG + Intronic
967887993 3:194346223-194346245 CCCGGGCTCTGCAGGGAAGATGG + Intronic
967889053 3:194351962-194351984 CTGGGGGTGTGCATGTAAGTGGG + Intergenic
967955890 3:194876918-194876940 CTTGGGGGATGCAGGGAAGCTGG + Intergenic
968353206 3:198080253-198080275 CTGCGGGGCTGCGGGGAAGCCGG + Intergenic
968516191 4:1016632-1016654 CTGGGGGCCTGCAGCACAGGTGG - Intronic
968534043 4:1112873-1112895 GTGGGGGGCTGCAGGGAGGAAGG - Intronic
968545506 4:1195711-1195733 CTGGGGGTCTCCGGGGTGGGGGG - Intronic
968794148 4:2690995-2691017 CTCGGGGTCTGCAGGAAGGCTGG + Intronic
969299944 4:6291849-6291871 CTGGTGGGCTGCAGGGCACGAGG + Intronic
969350109 4:6593480-6593502 CCAGGGGTCTGCAGGGAAGGAGG - Intronic
969713849 4:8859150-8859172 CTAAGGGTCTGCTGGGGAGGCGG + Intronic
969797197 4:9535502-9535524 GTGGGGGGGTGCAGGGTAGGGGG + Intergenic
969891740 4:10266314-10266336 CGGGAGGTCTGCAAGGAGGGAGG + Intergenic
970869366 4:20797752-20797774 CTGTGGGTCGGCAGGGAATTAGG + Intronic
971891903 4:32535075-32535097 GTGGAGGACTGGAGGGAAGGTGG + Intergenic
971910670 4:32792985-32793007 GTGGGGAACTTCAGGGAAGGTGG - Intergenic
972397809 4:38672583-38672605 CTGGGGGTGGGCAGGGCAGCCGG + Intronic
972461090 4:39303346-39303368 ATTGGGGTCTGCAGGGGAAGGGG - Intronic
972741689 4:41893220-41893242 CTTGGTGTCTGGAGGGAGGGAGG - Intergenic
973180033 4:47255854-47255876 CTGGGGGACTACAGGGACTGTGG + Intronic
973576193 4:52291675-52291697 CTTGAGCTCAGCAGGGAAGGAGG - Intergenic
973919150 4:55667126-55667148 CTGGGGGGCAGGAGGGAATGGGG - Intergenic
975359515 4:73451554-73451576 CTGGGAGGCTGCAGGGATGCAGG + Intronic
975810890 4:78168434-78168456 CAGGGGTGCTGCAGGGAAGTGGG - Intronic
978206898 4:106090321-106090343 CTGAGGCTGTGCAGGGAAGTGGG + Intronic
978532571 4:109729935-109729957 CTGAGGGCCAGCCGGGAAGGAGG - Exonic
979041995 4:115810133-115810155 GTGAGGGTCTGCGGGGAGGGTGG + Intergenic
979239350 4:118434750-118434772 CAGCTGTTCTGCAGGGAAGGAGG + Intergenic
980916220 4:139035527-139035549 CTGGGGGGCAGCAGTGAAAGTGG - Intronic
983060076 4:163149871-163149893 TTGGGGGACTGCAGAGAAGAGGG + Intronic
984699074 4:182807091-182807113 CTGGGGAGCTGCGGGGAAGCGGG - Intergenic
985236694 4:187883158-187883180 AAGGGGGTCTGCAGGAAATGCGG + Intergenic
985484482 5:140796-140818 GTGGGGGTTTGTAGGGAAGGGGG - Intronic
985484507 5:140863-140885 GTGGGGGTGTGCAGGGGAGAGGG - Intronic
985484554 5:140990-141012 GTGGGGGTGTGCAGGGGAGAGGG - Intronic
985586729 5:743456-743478 CTGGGGTTCAGCAGGGATTGTGG + Intronic
985588203 5:751543-751565 GTGGGGGCATGCAGGGCAGGTGG + Intronic
985601312 5:835643-835665 CTGGGGTTCAGCAGGGATTGTGG + Intronic
985657961 5:1141991-1142013 CTGCAGGGCTGCAGGGAAGAGGG - Intergenic
985790816 5:1926154-1926176 CTGGGGGTTAGCAGGGCTGGAGG - Intergenic
985836335 5:2274828-2274850 CCGGGGGTCAGCAGGGAGGAGGG + Intergenic
988034451 5:25807812-25807834 GGTGGGGTCTGCAGGCAAGGAGG + Intergenic
988589526 5:32536796-32536818 ATCGGGGGCAGCAGGGAAGGGGG - Intronic
989049015 5:37300403-37300425 CAGGAGGTTTGTAGGGAAGGTGG - Intronic
989084713 5:37663744-37663766 CTTGGCGACTGCAGGGAAGGAGG - Intronic
990487251 5:56271311-56271333 CTGGGGTGCTGCAGGGAGAGGGG - Intergenic
990700453 5:58469597-58469619 CAGGGGGTCGGGGGGGAAGGTGG - Intergenic
991486759 5:67145257-67145279 ATGGGGGTCTCCAGGGCAGGAGG - Exonic
993176154 5:84488556-84488578 CCAGGGGTTTGAAGGGAAGGAGG + Intergenic
993275399 5:85850501-85850523 CTGTGGTTATGCAGGGCAGGGGG + Intergenic
998533588 5:142908439-142908461 CTGGGAGTATGCAGAGAAAGAGG - Intronic
999089261 5:148921052-148921074 CTGGGGATGTGAAGGTAAGGAGG + Intergenic
1001315258 5:170637255-170637277 CTCGGGGTCTGAGGAGAAGGGGG - Intronic
1001483092 5:172101952-172101974 ATGGGGGTCAGCAGGGTGGGGGG + Intronic
1001948226 5:175797488-175797510 GTGGGGGTCTGGAGGGAAGACGG - Intronic
1002081623 5:176740861-176740883 CTGGGGGGCCCCGGGGAAGGCGG + Intergenic
1002130675 5:177079728-177079750 TTGGTGGTCTCCAGGGAAGCGGG - Intronic
1002282759 5:178142568-178142590 CTGGAGGGCTGCAGAGAAAGTGG - Exonic
1002365485 5:178706417-178706439 CTGCGGCTCTGCTGGGATGGTGG + Intergenic
1002563904 5:180099624-180099646 CTCTGGGGCAGCAGGGAAGGAGG - Intergenic
1002739593 5:181425330-181425352 CGGCTGTTCTGCAGGGAAGGAGG + Intergenic
1002813498 6:657037-657059 CTGGGGGGCCGGAGGGAGGGCGG - Intronic
1002887503 6:1310382-1310404 CTGGGGTTGGGCAGGGCAGGAGG - Intergenic
1003086801 6:3066895-3066917 CCAGGGATTTGCAGGGAAGGAGG - Intronic
1005397552 6:25398830-25398852 ATGGGGTGCTGCAGGGAATGTGG + Intronic
1005868914 6:29958577-29958599 TAGGGGGCCTGAAGGGAAGGAGG + Intergenic
1005907559 6:30277748-30277770 GTGGGGGGCTGAAGGGAAGGTGG - Intergenic
1006058861 6:31404683-31404705 TTGGGGGTCTGGAGGGGAGTGGG - Intronic
1006071346 6:31499568-31499590 TTGGGGGTCTGGAGGGGAGTGGG - Intronic
1006104933 6:31710749-31710771 GTGGGGGACTGAAGGAAAGGAGG + Intronic
1006308300 6:33238697-33238719 CTGGGGATCTGCAAGGGAGCTGG + Intergenic
1006327393 6:33364920-33364942 CTCCAGGCCTGCAGGGAAGGAGG + Intergenic
1006639979 6:35484858-35484880 ATGAGGGGCTGCAGGGTAGGAGG + Intronic
1007043633 6:38749370-38749392 CAGGGGGTCAGCGGGGAAAGGGG + Intronic
1007288993 6:40770107-40770129 CTGGGGGTCTGCTCTGGAGGGGG - Intergenic
1007519922 6:42444081-42444103 CATGGGGTCTGCATGGGAGGTGG - Intronic
1007683225 6:43648800-43648822 CTGGGGCTCTGGAAGGCAGGTGG + Intronic
1007842842 6:44730799-44730821 CAGGGGGGCTGGAGGGAAGTAGG - Intergenic
1012794555 6:103742955-103742977 CAGGTGGTCTGCAGGGCATGAGG + Intergenic
1013878216 6:114860617-114860639 GTGGGGGTGTGGAGGGTAGGGGG + Intergenic
1015413392 6:132920386-132920408 CTGGGGGTCAGGAGGAAACGAGG - Intergenic
1016251220 6:142045260-142045282 TGGGGCCTCTGCAGGGAAGGGGG - Intergenic
1016371019 6:143374228-143374250 CTGGTGGCCTGCAGGACAGGTGG + Intergenic
1016631093 6:146232659-146232681 TTGGGGGGCTGGAGGGCAGGTGG - Intronic
1016683132 6:146853373-146853395 CTGGGGGTCTGGAGGAAATGAGG - Intergenic
1018040025 6:159913577-159913599 CTGGGGCTCAGCTGGAAAGGTGG + Exonic
1018429622 6:163713099-163713121 CTGGGGGCCTGCAGGGAGCCAGG + Intergenic
1018795220 6:167180071-167180093 CTGGGGGCCTGAAGAGGAGGGGG - Intronic
1018810174 6:167293329-167293351 CTGGGGCCCTGCAGAGAGGGAGG - Intronic
1018811564 6:167301836-167301858 CAGGGGGTCGGCTTGGAAGGGGG + Intronic
1018813800 6:167316524-167316546 GTGGGGGGGGGCAGGGAAGGCGG - Intergenic
1018821100 6:167374991-167375013 CTGGGGGCCTGAAGAGGAGGGGG + Intronic
1018910191 6:168097314-168097336 ATGGTGTTGTGCAGGGAAGGTGG - Intergenic
1019215206 6:170438875-170438897 CTGGGGGTCAGCAGGCTGGGGGG + Intergenic
1019215229 6:170438940-170438962 CTAGGGGTCAGCAGGCTAGGGGG + Intergenic
1019244709 6:170700917-170700939 CGGCTGTTCTGCAGGGAAGGAGG + Intergenic
1019360984 7:604104-604126 ATGGGGGGCTGCAGGGAATGGGG - Intronic
1019374381 7:681577-681599 CTGGAGGTCTGCTGGGAGGAGGG + Intronic
1019462234 7:1166573-1166595 CTTGTGGTCAGCAGGGAAGAAGG + Intergenic
1019512737 7:1426116-1426138 CCGGGGCTCTGCAGGGACGTGGG - Intergenic
1019542612 7:1558360-1558382 CTGGGGCTCTGCAGGCCGGGTGG - Intronic
1019575839 7:1737244-1737266 CGTGGGGCCTGCAGGGAAAGAGG - Intronic
1019785876 7:2977117-2977139 CTGGGGGGAGGCAGGGATGGAGG + Intronic
1020088328 7:5323441-5323463 CATGGGGGCAGCAGGGAAGGAGG - Intronic
1020309875 7:6859515-6859537 CTGGGGGGGGGCAGGGCAGGTGG - Intergenic
1021222116 7:17986282-17986304 GTGGGGGCTTTCAGGGAAGGAGG - Intergenic
1021766676 7:23956720-23956742 TTTGTGGTCAGCAGGGAAGGAGG - Intergenic
1022359281 7:29643298-29643320 CTGGGGCTTTTCAGAGAAGGGGG + Intergenic
1022466510 7:30656083-30656105 CCAGGGGTCTGCGGGGAAGGGGG - Intronic
1022510287 7:30930971-30930993 CTGGGGGTCTGGTGGGAGGCTGG + Intergenic
1023089363 7:36603313-36603335 CTGGAGGTCTGCGGGGATAGGGG - Intronic
1023255880 7:38311632-38311654 GTGGGGGTCTGCTGGGCAGCAGG - Intergenic
1024001055 7:45189628-45189650 GTAGGGGCTTGCAGGGAAGGGGG - Intergenic
1024010969 7:45266449-45266471 CTGGGTGTCTTCAGCGATGGAGG + Intergenic
1024229903 7:47355847-47355869 CTGAGGCTCTGCTGGGAAGTGGG + Intronic
1024254292 7:47528288-47528310 CTGGGGGTCTGCAGGGAAGGAGG + Intronic
1024292110 7:47812260-47812282 CTGGGCTGCTGCAGGGAAGAGGG - Intronic
1024670274 7:51587877-51587899 GTTGGGGTCTCCAGGGAATGGGG + Intergenic
1025205984 7:56993674-56993696 CGTGGGGGCAGCAGGGAAGGAGG + Intergenic
1025665956 7:63583265-63583287 CGTGGGGGCAGCAGGGAAGGAGG - Intergenic
1026219237 7:68378090-68378112 CTGAGTGGCTGCAGAGAAGGTGG - Intergenic
1026528252 7:71174386-71174408 CTGGGGACCTGTGGGGAAGGTGG + Intronic
1026827897 7:73595592-73595614 CTGGGGGGCTGCAGGGGCTGTGG - Intronic
1026877963 7:73890553-73890575 GAGGGGGTCTGCAAGGAAGTGGG - Intergenic
1027724840 7:81791036-81791058 CTGGGAATCTTCAGGGAAGAGGG - Intergenic
1028365713 7:90028293-90028315 GTGGGGGGCTGCAGGGGAGGTGG + Intergenic
1029334106 7:99885860-99885882 CTGGGGGTTGGGAGGGCAGGTGG + Intronic
1029438608 7:100575547-100575569 CAGGGGGCATGCAGGGCAGGGGG + Intronic
1029599043 7:101553234-101553256 CTGGGGGCCTGCAGGGAGTCAGG - Intronic
1029706850 7:102280683-102280705 CTGGGGGTCTGCAAGAACAGCGG + Intronic
1030358529 7:108569929-108569951 CTGGGCGCCGGCGGGGAAGGAGG + Exonic
1031009395 7:116509770-116509792 CTTGGGTTCTGCAGGGATGACGG + Intergenic
1031468569 7:122143663-122143685 CTGGGCGTGGGGAGGGAAGGGGG + Intronic
1032068821 7:128791605-128791627 CTGGGGGTCTGGAAGGAGGAGGG - Intronic
1032123270 7:129172037-129172059 CTGGGGGTGTGTAGGGGTGGGGG + Intergenic
1032411944 7:131701094-131701116 CTGGTGGGCTGCTGGGAATGTGG + Intergenic
1032512620 7:132483976-132483998 CCAGGGATGTGCAGGGAAGGTGG + Intronic
1033033696 7:137850729-137850751 GTGAGGGACTGCAGGGATGGAGG - Intergenic
1033174783 7:139113964-139113986 CTGAGGCTCTGCAGGGAGGAAGG + Intergenic
1033253725 7:139781111-139781133 ATGGTGGTCTGAAGAGAAGGTGG - Intronic
1033480581 7:141736341-141736363 GTGGGGGGCTGGAGGGAAGGTGG - Intergenic
1034203081 7:149294525-149294547 CGGGGGGCCTGGAGGGAGGGAGG - Intronic
1034496934 7:151428645-151428667 CGGGGGGCCAGCAGGGCAGGGGG + Intergenic
1034584422 7:152076552-152076574 CTGGGGGTTTGGAGGGAGGCTGG + Intronic
1035076265 7:156179503-156179525 CTGGGGATCTGCAGGGTCGCTGG + Intergenic
1035121313 7:156570244-156570266 GTGGGTGGCTGCAGGGAAGGTGG - Intergenic
1035245790 7:157561302-157561324 CCTGGAGTCTGCAGGGAAGTGGG - Intronic
1035309254 7:157954696-157954718 CTGGGGCTCGGCAGGGAGGCGGG - Intronic
1035389522 7:158496196-158496218 GGGGGAGGCTGCAGGGAAGGGGG - Intronic
1035389648 7:158496504-158496526 AGGGGAGGCTGCAGGGAAGGTGG - Intronic
1035389730 7:158496705-158496727 AGGGGAGGCTGCAGGGAAGGGGG - Intronic
1035389772 7:158496800-158496822 AGGGGAGGCTGCAGGGAAGGGGG - Intronic
1035503417 8:107271-107293 CGGCTGTTCTGCAGGGAAGGAGG - Intergenic
1035543815 8:463437-463459 CTGGGGGCCAGCAGGGAATCTGG - Intronic
1036576420 8:10031763-10031785 CTGGAGGTTTGCTGGGCAGGGGG + Intergenic
1036670062 8:10777564-10777586 CTTGGGGACTGCAGGGAGTGAGG + Intronic
1037600093 8:20386630-20386652 CTGGGTGCCAGCTGGGAAGGGGG + Intergenic
1037914093 8:22761392-22761414 CTGGGGGGAGGCGGGGAAGGCGG + Intronic
1041379186 8:57235060-57235082 CTGGGAGTCAGAAGGGTAGGAGG + Intergenic
1043355003 8:79401737-79401759 CAGGGAGACTGCAGGGAAAGAGG - Intergenic
1044722814 8:95167445-95167467 ATGCGGCTCTGCAGGGAAGGGGG - Intergenic
1044930257 8:97245291-97245313 CTGGGGGAATGAAGGGAAGGGGG - Intergenic
1045498570 8:102728445-102728467 CTGGGGGTCAGCAGTTAAAGTGG + Intergenic
1045535927 8:103027839-103027861 CTGTGTGTGTGCAGGGAGGGTGG - Intronic
1046481268 8:114821617-114821639 CTGGGGCTCTACAGGGCAGTGGG + Intergenic
1048270686 8:133025818-133025840 CTAGGATTCTGCAGGGAATGTGG + Intronic
1048319771 8:133389318-133389340 GTGGGAGGCAGCAGGGAAGGAGG - Intergenic
1048570043 8:135644718-135644740 CTGGGAGTCTGCGGAGAGGGAGG - Intronic
1048783564 8:138026867-138026889 TTGGAGGGGTGCAGGGAAGGGGG - Intergenic
1048812059 8:138297660-138297682 CTGGGAGTATGAAGAGAAGGAGG + Intronic
1048879321 8:138859739-138859761 CTGAGGATCTGCAGGCAAAGGGG + Intronic
1049188579 8:141272790-141272812 CTGGTGTTGTGGAGGGAAGGGGG - Intronic
1049198522 8:141328525-141328547 CTGGGGGTGGACAGGGGAGGTGG + Intergenic
1049218927 8:141420091-141420113 CTGGTGGGCAGCTGGGAAGGGGG + Intronic
1049380817 8:142314960-142314982 GTGGGGGTCTGCAGGCCAGGTGG - Intronic
1049427061 8:142542411-142542433 CTGGGGGGCTGGCGGGAGGGCGG - Exonic
1049514097 8:143044427-143044449 TTGTGGGTCTGCAGGGACAGGGG - Intronic
1049545264 8:143227856-143227878 ATGGGAGTTTGCTGGGAAGGTGG - Intergenic
1049551874 8:143263818-143263840 ACAGGGGTCTGCAGGGAGGGAGG - Intronic
1049589315 8:143449059-143449081 CTGGGGCTGTGCAGGGCAGTGGG + Intronic
1049595948 8:143483426-143483448 CTGGGGCAATGCAGGGGAGGTGG + Intronic
1049708603 8:144053856-144053878 CTGAGCAGCTGCAGGGAAGGGGG - Intronic
1049798964 8:144509051-144509073 CTGCGCGGCCGCAGGGAAGGGGG - Intergenic
1049850078 8:144826328-144826350 CTGGGGGTCTGGAGGGCGGCTGG + Intergenic
1050058825 9:1684031-1684053 CTGGGGCTGGGCAAGGAAGGAGG - Intergenic
1052009204 9:23385952-23385974 CTGGGGGACTACAGGGAAGGTGG + Intergenic
1052943844 9:34151499-34151521 CTGGATGTCTGCAGATAAGGAGG - Intergenic
1052971697 9:34380794-34380816 CTGGGGGCCTGCACGGAAGCTGG + Intronic
1053199557 9:36143256-36143278 CTGGGGCTCTGAAGAGGAGGGGG - Intronic
1053454980 9:38226948-38226970 GGGGGGGTCGGCAGGGAGGGAGG + Intergenic
1053472951 9:38359832-38359854 CTGGGGGTCCCCAGGGCTGGTGG + Intergenic
1053503194 9:38620015-38620037 CTGCCGGGCTGCAGGGAAGCCGG + Intergenic
1055924467 9:81495575-81495597 CTGAGAATCTACAGGGAAGGGGG + Intergenic
1056021248 9:82440640-82440662 CTGAGGCTGTGCAGGGAAGCTGG - Intergenic
1057077240 9:92144393-92144415 TTGGGGATCGGGAGGGAAGGTGG + Intergenic
1057171702 9:92966753-92966775 CTGGGGGTGTCCAGGGGAGGCGG - Intronic
1057220955 9:93257460-93257482 CTGGGGTCCTTCAGGGAGGGCGG + Intronic
1057307435 9:93920459-93920481 CTGGGGGTCAGGAGTGAAGAAGG + Intergenic
1060206755 9:121686819-121686841 CTGGGGCTCTGGAGGAAATGTGG - Intronic
1060721792 9:125984486-125984508 CTGGGACTCTGGAGGGAAGGAGG - Intergenic
1060888033 9:127169293-127169315 CTGGGGCTCTACGGGGAAGGAGG - Intronic
1060987975 9:127830790-127830812 CTCAGGGACTGCAGGAAAGGTGG - Intronic
1061244587 9:129394901-129394923 TTGGGGGTCTGCTGGGCAGAGGG - Intergenic
1061366238 9:130173518-130173540 CGGAGAGGCTGCAGGGAAGGGGG - Intronic
1061487651 9:130928516-130928538 CTGGGTGACTGATGGGAAGGTGG - Intronic
1061520981 9:131117692-131117714 CTGGGGCTTAGCAGGGAAGCTGG - Intronic
1061532898 9:131228774-131228796 CTGGGGGGCTGCAGGGGAGCAGG - Intronic
1061636332 9:131911946-131911968 CTGTGGGGCAGCAGGGAAGTTGG - Intronic
1061645516 9:131997741-131997763 CTGGGGGCCTCCAGACAAGGTGG + Intronic
1062013029 9:134276974-134276996 CTGGGGGCCTGTAGGGGATGGGG + Intergenic
1062086891 9:134653702-134653724 ATGGTGGTCTGCAGGGCTGGGGG + Intronic
1062086921 9:134653800-134653822 CTGGGGATCTGTAGGGCTGGGGG + Intronic
1062087002 9:134654132-134654154 CTGGGGGTGTGTAGGGCTGGGGG + Intronic
1062087006 9:134654148-134654170 CTGGGGGTATGTAGGGCTGGAGG + Intronic
1062087119 9:134654623-134654645 CTGGGGGTGTGTAGGGCTGGAGG + Intronic
1062087173 9:134654874-134654896 CTGGGGGTGTGTAGGGCTGGGGG + Intronic
1062087188 9:134654921-134654943 CTGGGGGTGTGTAGGGCTGGGGG + Intronic
1062343296 9:136103385-136103407 CTGGGGGTCTCGAGGGACGGAGG - Intergenic
1062421275 9:136483774-136483796 CTGGGAGGCTGGAGGGCAGGCGG + Exonic
1062448649 9:136606394-136606416 CTGGGCGTCTGCAGGGCGGAGGG - Intergenic
1062475812 9:136726622-136726644 CTAGGGGTCTGAAGGGATAGTGG - Intergenic
1203792595 EBV:159793-159815 CTGGGGGTGCGCCGTGAAGGCGG + Intergenic
1203519556 Un_GL000213v1:33394-33416 CTGGGAAGCTGCAGTGAAGGTGG - Intergenic
1203604899 Un_KI270748v1:50137-50159 CGGCTGTTCTGCAGGGAAGGAGG + Intergenic
1203634001 Un_KI270750v1:94891-94913 CTGGGGATCTGCAGGGAGGTCGG + Intergenic
1185506193 X:633548-633570 CAGGGTGTCTACAGGGAACGGGG - Intronic
1186081043 X:5932136-5932158 CTGGGGGTGTGGAGGGGAAGGGG - Intronic
1186894296 X:13990569-13990591 CTGGGGGTCAGGAGTGAAGGAGG - Intergenic
1187884710 X:23878758-23878780 GTGGGGGTCTGGGGGAAAGGTGG - Intronic
1189260884 X:39678130-39678152 CTGGGGCTGTGCAGGGGATGGGG + Intergenic
1190936251 X:55001245-55001267 CTGGGGGTCTGAACGATAGGAGG - Intronic
1192156943 X:68753692-68753714 CTGGGGGCCTGCAAGGAGGAGGG + Intergenic
1193312466 X:80024493-80024515 CTGGTGGTCAGAAGGGAAGCGGG + Intronic
1195255970 X:103091561-103091583 CTGTGGGTGGGCAGGGTAGGGGG + Intronic
1195289999 X:103423465-103423487 CTGTGGGTCTGCAGTGGTGGTGG - Intergenic
1195924539 X:110012609-110012631 CTGGGGGTCAGCATGTAGGGTGG - Intronic
1197275432 X:124473732-124473754 ATGGGGGCCTGGAGGGAATGGGG - Intronic
1197772019 X:130095151-130095173 AGGGTGGTGTGCAGGGAAGGTGG + Intronic
1199620583 X:149697142-149697164 CTTGGGGTCTGCAGAGGATGTGG - Intronic
1199864111 X:151827636-151827658 CTGTGGGCCTGGAAGGAAGGAGG - Intergenic
1199869303 X:151882868-151882890 CTGGGGCTTTTCAGGGAATGGGG + Intergenic
1199996372 X:153029101-153029123 CTGGGGCTATGCAGGGAAACTGG - Intergenic
1200034812 X:153320348-153320370 CTGGGGCTGTGCAGGGAAACTGG + Intergenic
1200138588 X:153886392-153886414 CTCCCGGTCTGCGGGGAAGGGGG - Intronic
1200284268 X:154805438-154805460 CTGCGGGGCTGCGGAGAAGGCGG + Exonic
1200795268 Y:7335256-7335278 CTGGGGAGGTGCAGGGAAGGGGG + Intergenic
1201742373 Y:17337613-17337635 CTGGGGGTCAGCAGGGCTGAAGG + Intergenic