ID: 1024255436

View in Genome Browser
Species Human (GRCh38)
Location 7:47537114-47537136
Sequence CCCTGCCGCCCGCGGGGAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024255426_1024255436 17 Left 1024255426 7:47537074-47537096 CCGGTGGCCCAGGGGTCAGGGCG 0: 1
1: 0
2: 1
3: 27
4: 260
Right 1024255436 7:47537114-47537136 CCCTGCCGCCCGCGGGGAGCCGG No data
1024255425_1024255436 18 Left 1024255425 7:47537073-47537095 CCCGGTGGCCCAGGGGTCAGGGC 0: 1
1: 0
2: 4
3: 47
4: 455
Right 1024255436 7:47537114-47537136 CCCTGCCGCCCGCGGGGAGCCGG No data
1024255428_1024255436 9 Left 1024255428 7:47537082-47537104 CCAGGGGTCAGGGCGCGCAGCCT 0: 1
1: 0
2: 2
3: 13
4: 208
Right 1024255436 7:47537114-47537136 CCCTGCCGCCCGCGGGGAGCCGG No data
1024255422_1024255436 21 Left 1024255422 7:47537070-47537092 CCTCCCGGTGGCCCAGGGGTCAG 0: 1
1: 0
2: 0
3: 22
4: 299
Right 1024255436 7:47537114-47537136 CCCTGCCGCCCGCGGGGAGCCGG No data
1024255421_1024255436 22 Left 1024255421 7:47537069-47537091 CCCTCCCGGTGGCCCAGGGGTCA 0: 1
1: 0
2: 0
3: 16
4: 194
Right 1024255436 7:47537114-47537136 CCCTGCCGCCCGCGGGGAGCCGG No data
1024255427_1024255436 10 Left 1024255427 7:47537081-47537103 CCCAGGGGTCAGGGCGCGCAGCC 0: 1
1: 0
2: 1
3: 16
4: 163
Right 1024255436 7:47537114-47537136 CCCTGCCGCCCGCGGGGAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024255436 Original CRISPR CCCTGCCGCCCGCGGGGAGC CGG Intronic
No off target data available for this crispr