ID: 1024256927

View in Genome Browser
Species Human (GRCh38)
Location 7:47546294-47546316
Sequence CGTCCACGTCCGGCACCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 84}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024256925_1024256927 -6 Left 1024256925 7:47546277-47546299 CCACTTGTCTCACGTGGCGTCCA 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1024256927 7:47546294-47546316 CGTCCACGTCCGGCACCCCCTGG 0: 1
1: 0
2: 0
3: 10
4: 84
1024256921_1024256927 14 Left 1024256921 7:47546257-47546279 CCTTAACCATCTTACCTGAGCCA 0: 1
1: 0
2: 0
3: 8
4: 123
Right 1024256927 7:47546294-47546316 CGTCCACGTCCGGCACCCCCTGG 0: 1
1: 0
2: 0
3: 10
4: 84
1024256923_1024256927 0 Left 1024256923 7:47546271-47546293 CCTGAGCCACTTGTCTCACGTGG 0: 1
1: 0
2: 0
3: 4
4: 97
Right 1024256927 7:47546294-47546316 CGTCCACGTCCGGCACCCCCTGG 0: 1
1: 0
2: 0
3: 10
4: 84
1024256922_1024256927 8 Left 1024256922 7:47546263-47546285 CCATCTTACCTGAGCCACTTGTC 0: 1
1: 0
2: 1
3: 20
4: 144
Right 1024256927 7:47546294-47546316 CGTCCACGTCCGGCACCCCCTGG 0: 1
1: 0
2: 0
3: 10
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024256927 Original CRISPR CGTCCACGTCCGGCACCCCC TGG Intronic
902935214 1:19760044-19760066 CCTCCAAGTCCTGCTCCCCCAGG + Intronic
903034487 1:20485460-20485482 CGTCCCCGGCCGGCCGCCCCCGG - Exonic
904701601 1:32361621-32361643 CATCCACGTCCGGACCCCCGGGG - Intronic
904769076 1:32870940-32870962 CGTCCACGTCGGGCGCCCGGGGG + Intronic
905132325 1:35770147-35770169 CGTGCACCTCCAGCTCCCCCAGG - Intergenic
905632696 1:39527488-39527510 AGTTCACGTGCTGCACCCCCAGG + Intergenic
905665120 1:39758929-39758951 AGTTCACGTGCTGCACCCCCAGG - Exonic
913959551 1:143327926-143327948 CGACCCCCTCCGTCACCCCCAGG + Intergenic
914053910 1:144153499-144153521 CGACCCCCTCCGTCACCCCCAGG + Intergenic
914125236 1:144812866-144812888 CGACCCCCTCCGTCACCCCCAGG - Intergenic
1067557654 10:47283997-47284019 AGTCCACCTCTGGCATCCCCAGG + Intergenic
1077177167 11:1196216-1196238 CGTCCACGTCTGGGAGCCCGTGG + Intronic
1083158695 11:60841569-60841591 CTTCCACCTCCAGGACCCCCAGG + Intergenic
1083571560 11:63764365-63764387 CGCCCACCGCCGCCACCCCCAGG - Exonic
1083572951 11:63769543-63769565 GGGCCTCGTCAGGCACCCCCAGG - Intergenic
1091122081 11:133065113-133065135 CGTCCAGGTCCGGCTCTCTCGGG - Intronic
1096867972 12:54576484-54576506 CTTCCATGTCCTGCACTCCCAGG + Intronic
1100844449 12:98644744-98644766 CGGCCACGTCCTGCTCCCCCTGG - Exonic
1101640177 12:106581809-106581831 CTTCCACTTCCAGCACCCCCCGG + Intronic
1102122139 12:110450068-110450090 CTCCCACGACTGGCACCCCCGGG + Intronic
1103013900 12:117479312-117479334 CATCCACCTCCTGCACTCCCAGG + Intronic
1104363302 12:128153874-128153896 CGTCCATGTCTGGCACAGCCAGG + Intergenic
1104852406 12:131883540-131883562 CATGCCCCTCCGGCACCCCCAGG - Intergenic
1113906322 13:113820932-113820954 CGTCCAGGTCCAGCAGCCTCCGG + Exonic
1122789900 14:104179763-104179785 CGTCCACCTCCTGCGGCCCCGGG - Exonic
1122938264 14:104969911-104969933 AGCCCACCTCGGGCACCCCCAGG + Intronic
1124665086 15:31585538-31585560 CGTCCCCACCCGGCATCCCCAGG + Intronic
1129203785 15:74023251-74023273 CGTGCATGTCCAGCACCTCCTGG - Exonic
1131510854 15:93048782-93048804 GGCCCACCTCCGGCACCCCCAGG - Intronic
1133978413 16:10616827-10616849 CCTCCACCTCCGCCCCCCCCAGG - Intergenic
1142410019 16:89911187-89911209 CGTCCTCGTGCGGCGCCTCCAGG - Exonic
1149560602 17:57605504-57605526 CGTCCCCGTACTCCACCCCCAGG + Intronic
1151156090 17:72123766-72123788 CGTGCGTGGCCGGCACCCCCGGG - Exonic
1153290587 18:3498582-3498604 CATCCAGGTCCCCCACCCCCAGG + Exonic
1157312132 18:46560422-46560444 GGTCCACCTCCCGCACCACCAGG + Intronic
1160537732 18:79603979-79604001 CGTCCCCGCCTGGCACCTCCAGG + Intergenic
1160867204 19:1261204-1261226 GGTCCACGTGCGGCGCCCCGGGG - Intronic
1163283313 19:16330636-16330658 CACCCACGCCCGGCAGCCCCAGG + Intergenic
1165341396 19:35214571-35214593 AGTCCACATCTGCCACCCCCAGG - Intergenic
1166107678 19:40605424-40605446 CGTCCACGTGGAGCACCCGCAGG + Exonic
1202693384 1_KI270712v1_random:106157-106179 CGACCCCCTCCGTCACCCCCAGG + Intergenic
930259055 2:49124066-49124088 CCTCCACCTCCTGCACCTCCCGG + Intronic
932492779 2:72132316-72132338 GGTCCCCGTCCTGCACCCCGTGG - Exonic
933953185 2:87348402-87348424 CGACCCCCTCCGTCACCCCCAGG - Intergenic
934237415 2:90244747-90244769 CGACCCCCTCCGTCACCCCCAGG - Intergenic
936405070 2:112195567-112195589 AGCCCAGGTCTGGCACCCCCTGG - Intergenic
948036693 2:234863677-234863699 TCTCCCCGTCTGGCACCCCCAGG - Intergenic
1172178820 20:32988324-32988346 CCTCCAACTCGGGCACCCCCAGG - Intronic
1176206294 20:63890184-63890206 TGTCCACTTCCTGCACCCCTAGG - Exonic
1180169210 21:46049180-46049202 CCTCCTCCTCCGGCACCACCTGG + Intergenic
1180220872 21:46356993-46357015 AGTCCCCGTCCTGCACACCCTGG - Exonic
1183393791 22:37560552-37560574 CGCCCTCGTCCCGCGCCCCCGGG + Exonic
1184108311 22:42381392-42381414 CAGCCACGTCTGGCACCCCCAGG - Exonic
1184737844 22:46409641-46409663 CATCCAGGTCCGGCAGCCTCTGG - Intronic
1184840447 22:47049356-47049378 CGTCCACATCAGGGTCCCCCTGG + Intronic
1185377719 22:50489772-50489794 TGTCCACGTCCGGCAGGTCCGGG - Exonic
957058991 3:75466324-75466346 CCACCACGTCCGGCAGCCCATGG - Intergenic
961743082 3:129046192-129046214 CGTCCACGTCCAGCGCGCCCTGG - Intergenic
980913838 4:139016258-139016280 ACTCCACGACCGGCAGCCCCGGG - Intronic
981172063 4:141636651-141636673 CTTCGAAGTCCGGCGCCCCCCGG + Exonic
985678909 5:1245966-1245988 CCTCCACGTCCGCCTCCGCCGGG - Exonic
985995783 5:3596177-3596199 CGGCCGCGGCCAGCACCCCCGGG - Exonic
997272941 5:132557052-132557074 CGTCCCCGGCGGGCAGCCCCAGG + Exonic
1001285016 5:170416386-170416408 CCTCCACTTCCGGCTCCTCCCGG + Intronic
1001392276 5:171388476-171388498 AGTCTACGTCCGGCAGCTCCAGG - Intronic
1002595429 5:180318755-180318777 AGTCCACGTGCGGCAGCCTCGGG - Intronic
1004690397 6:17987862-17987884 CGGCCACGCGCGGCGCCCCCTGG + Intergenic
1017492819 6:154959043-154959065 CTTCCATTTCCTGCACCCCCGGG + Intronic
1017914209 6:158819171-158819193 GGTTCTCGCCCGGCACCCCCGGG - Intronic
1019143308 6:169961861-169961883 CTTCCCCGCCAGGCACCCCCGGG + Intergenic
1019346513 7:533411-533433 CACCCACGTCTGGCACCCCGCGG - Intergenic
1019386157 7:757346-757368 CGTCCATGGCCGGGACCCTCTGG + Intronic
1020178051 7:5898636-5898658 CGTCCTCTTCAGGCACCCCCGGG - Intergenic
1020304876 7:6826339-6826361 CGTCCTCTTCAGGCACCCCCGGG + Exonic
1020914485 7:14175429-14175451 CCTCCACCTCCTGCACCCCCAGG + Intronic
1024256927 7:47546294-47546316 CGTCCACGTCCGGCACCCCCTGG + Intronic
1025992466 7:66506229-66506251 CGGCCACGGCCGCCACCCACCGG + Intergenic
1026843697 7:73685060-73685082 CGTCCACCTCCGCCTCCCACAGG - Intronic
1029080804 7:97972396-97972418 CGTCCTCTTCTGGCACCCCAGGG + Intergenic
1034962784 7:155372910-155372932 CGCCCACATCCGCCTCCCCCAGG + Intergenic
1035097421 7:156366601-156366623 CCTCCAAGTGCGGCAGCCCCAGG - Intergenic
1035265690 7:157689365-157689387 GGACCACGTCCGGGACCCCGGGG + Intronic
1035356818 7:158280625-158280647 CGCACCCGTCCGGCTCCCCCAGG - Intronic
1037320194 8:17634159-17634181 CCTCCACATCGGGCTCCCCCAGG - Exonic
1043479292 8:80637050-80637072 CGTCCCCCTCCCCCACCCCCAGG + Exonic
1053188281 9:36037204-36037226 TGCCCACGTCCGGCGACCCCGGG + Intronic
1055900013 9:81223375-81223397 CCTCCACCTCCCGCCCCCCCCGG - Intergenic
1056296271 9:85196257-85196279 TGTCGACTTCCGGCACGCCCTGG - Intergenic
1056711088 9:88992015-88992037 CTCCCACGTCCAGCATCCCCAGG - Exonic
1059397907 9:114050032-114050054 CGCCCACGGCCGGAACCGCCAGG - Exonic
1060599577 9:124869117-124869139 CGCCCACTTCCGGCACCCGCCGG - Exonic
1062462147 9:136666453-136666475 CCTCCCCGCCCGGCACCCCTGGG + Intronic
1062582692 9:137235512-137235534 CCTCCAAGTCCGGCAGCCCCTGG + Intronic
1185457951 X:319866-319888 CGGCGACGTCCAGGACCCCCAGG - Intergenic
1197766196 X:130060693-130060715 CCTCCACGTCCGGCGCGCCGGGG + Intergenic