ID: 1024260254

View in Genome Browser
Species Human (GRCh38)
Location 7:47568984-47569006
Sequence CACCCACTCCTCCTCCAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 554
Summary {0: 1, 1: 0, 2: 5, 3: 50, 4: 498}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024260250_1024260254 9 Left 1024260250 7:47568952-47568974 CCACAGTATTCACAGCGTGGCTG 0: 1
1: 0
2: 0
3: 9
4: 162
Right 1024260254 7:47568984-47569006 CACCCACTCCTCCTCCAGGCAGG 0: 1
1: 0
2: 5
3: 50
4: 498
1024260249_1024260254 10 Left 1024260249 7:47568951-47568973 CCCACAGTATTCACAGCGTGGCT 0: 1
1: 0
2: 0
3: 5
4: 98
Right 1024260254 7:47568984-47569006 CACCCACTCCTCCTCCAGGCAGG 0: 1
1: 0
2: 5
3: 50
4: 498

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024260254 Original CRISPR CACCCACTCCTCCTCCAGGC AGG Intronic
900589749 1:3454395-3454417 CGCCCACGCCCCCTCGAGGCCGG - Intergenic
902362091 1:15947446-15947468 CAGCCCATCCTCCTCCATGCAGG - Intronic
902764081 1:18603401-18603423 CACCCACCTCTCCTCCCAGCAGG + Intergenic
903175113 1:21575973-21575995 CACCCACTCCTGCTCCCAGGTGG - Intronic
903336734 1:22629386-22629408 CACCCAGTTCCCCTCCGGGCTGG + Intergenic
903576107 1:24340808-24340830 CCCCAGCTCCTCCTCCAGCCCGG - Intronic
903744451 1:25577287-25577309 CCCCCACTCCACCTCCCAGCTGG - Intergenic
903886429 1:26543533-26543555 CACCCACTCCTCCATCTGTCAGG + Intronic
903901656 1:26650659-26650681 CACCCTCTTGTCCCCCAGGCTGG - Intergenic
904025052 1:27497354-27497376 CTCCTCCTCCTCCTTCAGGCAGG + Intergenic
904042618 1:27593226-27593248 CCCCCTCCACTCCTCCAGGCAGG + Intronic
904200559 1:28816679-28816701 CACCCCCTCCTCCTGCATGTGGG + Intronic
904292417 1:29496776-29496798 CAGCCACTCCTCCTCCTGCAGGG + Intergenic
904699984 1:32352195-32352217 CTCCCCCTCCTCGCCCAGGCAGG - Intronic
904815570 1:33194500-33194522 CACACACTCGTCACCCAGGCTGG - Intergenic
905445977 1:38028750-38028772 CACCCCCTCCTCTTGCTGGCTGG + Intergenic
905769260 1:40626729-40626751 CTCCCTCTCTTCCTCCTGGCAGG - Exonic
905947510 1:41916529-41916551 CACCCTCTCCTCCTGCCTGCAGG + Intronic
905990624 1:42334770-42334792 CTCCCGCCCCTCCCCCAGGCGGG - Intronic
906405573 1:45539340-45539362 CCCCCCCTCCCCCTCCAGGAAGG - Intergenic
906524447 1:46486051-46486073 CGCCCTCTCAACCTCCAGGCGGG - Intergenic
906607242 1:47181117-47181139 AGCCCACCCCTCCTGCAGGCTGG + Intergenic
907345368 1:53773810-53773832 CACCCACAACTCCCCCAGACTGG + Intronic
907512393 1:54971433-54971455 CACCCACGCCTGCGTCAGGCAGG + Intergenic
907666232 1:56435974-56435996 CTCCCCCTCCTCCTCCAGCCTGG + Intergenic
907870700 1:58440102-58440124 CTCCCACTCCTACTGCAGACAGG - Intronic
908026197 1:59954138-59954160 CATCCACTCCTCCATCAGCCTGG + Intergenic
908501877 1:64752134-64752156 CACCCACTCCTTATCCAGGGAGG + Intronic
908650922 1:66332266-66332288 CACCGACACCTCATCCAGGCGGG + Intronic
909736288 1:78966643-78966665 CTCCCCCTCCTCTTCCAGGTGGG + Intronic
912449675 1:109761255-109761277 CACCCGCTCAACCTCCAGCCAGG + Intronic
913210609 1:116579468-116579490 CAGCCACTCCTCCACATGGCAGG + Exonic
914919323 1:151837117-151837139 CACCCCCACCTCCTTCTGGCTGG + Intergenic
915936213 1:160091704-160091726 TGCCTACTCCTCCTCCAGGTGGG + Intronic
920556449 1:206908078-206908100 CTTCCACTTCTCCTCCAGGGTGG - Intronic
920675322 1:208034246-208034268 CTCCGACTCCTCTACCAGGCTGG + Intronic
922915417 1:229253205-229253227 CGCCCTCTCGCCCTCCAGGCAGG + Intergenic
1063611198 10:7563297-7563319 CACCCTCTGCTCCTTCAGGTGGG - Exonic
1064542950 10:16423769-16423791 CACCACCACCTCCTGCAGGCAGG - Intergenic
1065101277 10:22335213-22335235 CACCCGCTCCTCTGCCCGGCCGG - Intergenic
1065445107 10:25790180-25790202 CACCCACCCCCACCCCAGGCTGG - Intergenic
1067160213 10:43819260-43819282 CACCCTATCCGCCTCCAGGACGG - Intergenic
1067288550 10:44924805-44924827 CACACTCTCCTCCTCCCGCCAGG + Intronic
1067564323 10:47325881-47325903 CTCCCTTTCCTCCTCCAGGCTGG - Exonic
1067682867 10:48451300-48451322 CACACCCTCCAACTCCAGGCAGG + Intronic
1067726110 10:48772310-48772332 CACACACACATACTCCAGGCTGG - Intronic
1067849377 10:49745101-49745123 CCCGCACTCCTGCTCAAGGCTGG + Intronic
1069604211 10:69729601-69729623 CATCCACTCCTTCACCAGGAGGG + Intergenic
1069865757 10:71501831-71501853 CCCACCCTCCTCCTCCTGGCTGG - Intronic
1069895833 10:71679518-71679540 CCCCCAGCCCTCCTCCTGGCTGG - Intronic
1069983860 10:72270791-72270813 CACCCGCTCCTCCTCCCCTCAGG - Intergenic
1070145768 10:73772428-73772450 CGCCCACTCCGCCTCCCCGCCGG - Exonic
1070314261 10:75295298-75295320 CCCGCCCTCCTCCTCCTGGCGGG + Intergenic
1072434627 10:95403920-95403942 CAATAACACCTCCTCCAGGCTGG + Intronic
1072793617 10:98337559-98337581 AACCTACTCCTCCTCCACGTCGG + Intergenic
1073062953 10:100743111-100743133 CACTCACTCTTCCGCCAGGCCGG - Intronic
1073253916 10:102139012-102139034 CACACACTCCTCCTCCCACCTGG - Intronic
1074197733 10:111204134-111204156 CTCCCACTCCCTCTCCAGCCTGG + Intergenic
1074770746 10:116731995-116732017 CACCCACCCCTCCTCTCTGCAGG - Intronic
1075023297 10:118966759-118966781 CACCCTCTCCTCCTACACTCCGG - Intergenic
1075331771 10:121579250-121579272 CAAGCACTCCTCATCCTGGCGGG + Intronic
1075515448 10:123104551-123104573 CCCCAACTCCATCTCCAGGCTGG - Intergenic
1076364267 10:129911767-129911789 CCCTCACTCCTACTCCAAGCTGG + Intronic
1076530248 10:131140279-131140301 CCCCCACCCCTGCTCCTGGCAGG + Intronic
1076656424 10:132026835-132026857 CACTCACTCTTCGCCCAGGCTGG + Intergenic
1077020474 11:415057-415079 CACCCACCCCTTCCCTAGGCGGG + Intronic
1077049284 11:559494-559516 CTCTCACACCTCCTCCAGGCTGG - Intronic
1077052474 11:573590-573612 CATCCACTCCTCCTTCCTGCAGG + Intergenic
1077097628 11:805609-805631 CACCCACCCCTGCTACAAGCCGG + Intronic
1077113576 11:872840-872862 CACACACTCCTCCTCCTGGGGGG + Intronic
1077389687 11:2294500-2294522 CATCCACTCCACCTGGAGGCTGG + Intergenic
1077390037 11:2296624-2296646 CACCCAGTCCTCCTTCACTCAGG + Intronic
1077868438 11:6241574-6241596 CACCAGCTCCTCCAGCAGGCTGG - Exonic
1078477726 11:11646336-11646358 CACTCACCTCTTCTCCAGGCAGG + Intergenic
1080276046 11:30504456-30504478 CCCCCTCCCCACCTCCAGGCTGG - Intronic
1080628230 11:34050934-34050956 CACCCACTCCACCCCAAGGCTGG + Intergenic
1081153766 11:39664179-39664201 CACCCTCTCCCGCTGCAGGCTGG + Intergenic
1083291961 11:61695475-61695497 CTCCCACTGCTCCTCCCCGCTGG - Intronic
1083571866 11:63765431-63765453 CACCCACACCTCCCCCAGACTGG + Intronic
1083589252 11:63883276-63883298 CAGCTACTCCTCCTGCAGGATGG + Intronic
1083674543 11:64318177-64318199 CTTCCACTCCGCCTCCTGGCTGG - Exonic
1084109441 11:67004188-67004210 AGCCCCATCCTCCTCCAGGCTGG + Intergenic
1084209866 11:67615948-67615970 ACCCCACTCCCCCTCCTGGCTGG + Intergenic
1084270334 11:68026089-68026111 TACCCACTCCTCCAAAAGGCAGG - Exonic
1084322533 11:68381588-68381610 CGCCCGAGCCTCCTCCAGGCGGG - Intronic
1085200589 11:74699512-74699534 CCCCCACTCCTACTCCAGATAGG - Intronic
1086892837 11:92278117-92278139 CAGCCACTCCTCCTCCCCTCAGG - Intergenic
1087792955 11:102426492-102426514 GACCCACATCTACTCCAGGCTGG - Intronic
1088172875 11:107017972-107017994 CTCCCCCTCCTCCTCCGGGCTGG + Exonic
1088750431 11:112837985-112838007 CACCCCCTCCTCTCCCAGGCAGG + Intergenic
1089133236 11:116228788-116228810 CACCAACTCATCCAGCAGGCTGG + Intergenic
1089298243 11:117482205-117482227 CACGCGTGCCTCCTCCAGGCTGG - Intronic
1089452225 11:118606793-118606815 CTCCCACTCCTACTACAGGTTGG + Intronic
1089678380 11:120105759-120105781 CCTCCACTCCTCCTGCAGTCTGG + Intergenic
1089865473 11:121627712-121627734 CAGCCACTACAGCTCCAGGCTGG + Exonic
1090002881 11:122977495-122977517 AACCCACCTGTCCTCCAGGCCGG - Intergenic
1090839482 11:130475837-130475859 CACCCTCTCCTCCTGAAGGAGGG - Exonic
1091121122 11:133058499-133058521 CACCCACTCCTCAACCAGTTAGG + Intronic
1091407607 12:218957-218979 CACGCACTCCTTCTCCAAGCAGG - Intergenic
1091601587 12:1921214-1921236 TACCCCCTCCTCCACCAGTCAGG - Intergenic
1091656128 12:2348125-2348147 CTCCCACTCCTGCAGCAGGCAGG - Intronic
1091682562 12:2537558-2537580 CCCCCAATCCTCCTCCAACCCGG - Intronic
1091696815 12:2633329-2633351 CACCCACTCCTGCCCCTGGTGGG + Intronic
1092040347 12:5378713-5378735 AACCCACTCTTCCCCCAGGTAGG - Intergenic
1092226688 12:6752740-6752762 CACTCAGGCCTCCCCCAGGCGGG + Intronic
1092241909 12:6840730-6840752 CCCCCAACCCTCCTCCCGGCTGG + Intronic
1093429951 12:19072959-19072981 CACCCACTCCTCCAGCATGGTGG - Intergenic
1095884796 12:47177598-47177620 CCCCCACCCCACCACCAGGCTGG - Intronic
1096149331 12:49298611-49298633 CACCCACTTCTCATCGTGGCTGG - Exonic
1102028949 12:109729056-109729078 GTCCCACTCCTTCTCCAGGGTGG + Intronic
1102535413 12:113577129-113577151 CAGCCTCTCCTCCACAAGGCAGG + Intergenic
1102615983 12:114154569-114154591 CAGACACTACTCCTGCAGGCTGG - Intergenic
1103506349 12:121444154-121444176 CACTCACTCCTCCGCTTGGCAGG + Exonic
1104090730 12:125514881-125514903 CTCCTCCTCCTCCTCCTGGCTGG + Intronic
1104584684 12:130038581-130038603 CAACCACTCCTCATTCGGGCTGG - Intergenic
1104596874 12:130126071-130126093 CAGTGACTCCACCTCCAGGCAGG - Intergenic
1104642747 12:130477911-130477933 TGCCCTCTCCTCCTCCTGGCAGG - Intronic
1104812234 12:131626312-131626334 CACCCCCACCACCTCCATGCTGG + Intergenic
1105209360 13:18248833-18248855 CACACACGCCTTCTCCAGGAGGG + Intergenic
1105298988 13:19116724-19116746 CTCCTTCTCCTCCTCCAGCCTGG + Intergenic
1105717516 13:23082049-23082071 CGCCCACTCTTCCCCCAGGCAGG + Intergenic
1108282767 13:48876103-48876125 CCGCCACTCCTCCCCCAGGGTGG - Intergenic
1108860142 13:54847264-54847286 CTCACTCTCCTCATCCAGGCTGG - Intergenic
1109309609 13:60677047-60677069 CACTCTCTCTACCTCCAGGCAGG - Intergenic
1111072218 13:83184035-83184057 CTCCCACCCCTGCTCCAGGACGG - Intergenic
1112505900 13:99975422-99975444 CACCCAGTCCTTCTGCAGGGAGG - Intergenic
1113662712 13:112118079-112118101 CACCCCCTCCTCCTCGAAGGCGG - Intergenic
1113747852 13:112757602-112757624 CGCCCACTCCTTTCCCAGGCTGG + Intronic
1113852432 13:113425431-113425453 CTCCCTCTCGTCCCCCAGGCTGG + Intronic
1113909592 13:113835889-113835911 CCCCCACCCCTCCACCAAGCAGG - Intronic
1113978509 13:114251216-114251238 CTCCCACTACCTCTCCAGGCAGG - Intronic
1114269610 14:21092682-21092704 CAGCAGCTCCTCCTCCTGGCTGG + Exonic
1114502496 14:23181425-23181447 CACCAACTCCTCCTACACCCTGG - Intronic
1114516393 14:23302460-23302482 CTCCGGCTCCTCCTCGAGGCTGG + Exonic
1114531431 14:23398999-23399021 CATGCACTCCTCCTCCAGGATGG + Exonic
1114536765 14:23427856-23427878 CATGCACTCCTCTTCCAGGATGG + Exonic
1115505861 14:34093430-34093452 CTCTCATTCCTCCTCCTGGCTGG + Intronic
1117135295 14:52729952-52729974 CAGCCCCGCCTCCTCCACGCCGG + Intergenic
1117271031 14:54143549-54143571 CACCCACTCCCACCCCAGTCAGG - Intergenic
1118615894 14:67574285-67574307 GATCCACTCCTCCAGCAGGCTGG - Exonic
1118988098 14:70774250-70774272 CACTGACTCTTCCTCCTGGCTGG - Intronic
1119525178 14:75317233-75317255 CTCCAACTACTCTTCCAGGCAGG - Intergenic
1120190723 14:81436787-81436809 CACCCGCTCCGCCTGCGGGCTGG + Intergenic
1120619897 14:86750709-86750731 CACCCACCCCTTCCCCAGCCAGG + Intergenic
1121527330 14:94628263-94628285 AACTAACTCCTCATCCAGGCTGG + Intergenic
1121785488 14:96657011-96657033 CACCCACTCAACCTCCAGGATGG + Intergenic
1121887856 14:97561251-97561273 CACCCACCCTTTCTGCAGGCAGG - Intergenic
1122716419 14:103699278-103699300 CACCCGCCCCACCTCCAGACCGG + Intronic
1123056933 14:105575154-105575176 CGCCCACCCCTCCCCCAGGCAGG + Intergenic
1123081277 14:105696631-105696653 CGCCCACCCCTCCCCCAGGCAGG - Intergenic
1123098403 14:105777141-105777163 CACTCCGTCCTCCCCCAGGCTGG - Intergenic
1123107541 14:105849717-105849739 CACTCCATCCTCCCCCAGGCTGG + Intergenic
1123795167 15:23763661-23763683 CTCCCACCACTGCTCCAGGCTGG - Intergenic
1124610010 15:31201700-31201722 CAGCCACTCCTCCTACACGGTGG + Intergenic
1125478366 15:40062989-40063011 CGCCAGCTCCTCCTCCAGCCAGG + Intergenic
1126163637 15:45635459-45635481 CACCCACTCCCGCTCCAGGACGG - Intronic
1126398233 15:48242216-48242238 CAGCCACACCTCCTCCTGGTTGG + Intronic
1128088015 15:64899019-64899041 AACCCACTCCTTCCCCAGGCAGG - Intronic
1128361042 15:66962004-66962026 TGCCCACTCCTCCTCCTGCCCGG + Intergenic
1128526471 15:68415562-68415584 CACCCACTGCTGCTTCCGGCAGG + Intronic
1128545673 15:68566087-68566109 CCCCTTCTCCTCATCCAGGCAGG - Intergenic
1128582263 15:68818508-68818530 GCCCCACCCCGCCTCCAGGCAGG + Intronic
1128622351 15:69161022-69161044 CACCCACCCCTACCCCAAGCCGG - Intronic
1128729911 15:70014124-70014146 CATCCCGTCCTCCTCCAGGAAGG + Intergenic
1130985571 15:88842538-88842560 TGCCCACAGCTCCTCCAGGCTGG + Intronic
1131047286 15:89324137-89324159 CAGGAACTCCTCCGCCAGGCCGG + Exonic
1131871940 15:96772645-96772667 CACAAACCCCACCTCCAGGCAGG - Intergenic
1132200955 15:99954431-99954453 CAGGGTCTCCTCCTCCAGGCTGG - Intergenic
1132285985 15:100662884-100662906 ATCCCATTCCTCCTCCAGGACGG - Intergenic
1132544156 16:525486-525508 CATCCTCTTCTCCTCCAGGGGGG + Intergenic
1132761094 16:1509016-1509038 GAACCTCTCCTCCTCCAGGCAGG - Intronic
1132767775 16:1543193-1543215 CTCCTTCTCCTCCTCGAGGCCGG + Intronic
1132927438 16:2438316-2438338 CCCCCACTCCCCTGCCAGGCGGG - Intronic
1132980857 16:2738095-2738117 CACACCCTCCACCCCCAGGCTGG + Intergenic
1133231892 16:4370863-4370885 CACCCACACCCCCTCCAGCCCGG - Intronic
1133971941 16:10574500-10574522 CACCCACTGCTCCTCCAGCAGGG + Intronic
1136076274 16:27819548-27819570 CACCGTCTCCTCCGCCAAGCTGG - Intronic
1136287769 16:29254368-29254390 CACCCGTGCCTCCTCCACGCCGG + Intergenic
1136287780 16:29254405-29254427 CACCCGTGCCTCCTCCACGCCGG + Intergenic
1136344455 16:29665788-29665810 CACCCAGCCATGCTCCAGGCTGG - Exonic
1136519145 16:30785237-30785259 CACCCAGTCCTCCCACAGCCTGG + Intronic
1136531462 16:30872479-30872501 CACACCCTCATTCTCCAGGCAGG + Intronic
1136569697 16:31089221-31089243 CCCCCACTTCTCTTCCAGCCAGG + Intronic
1136590363 16:31214710-31214732 AACCTACTCCTCCTCCACCCAGG + Exonic
1137397009 16:48123371-48123393 CCCCACCTCCACCTCCAGGCAGG + Intronic
1137502172 16:49019902-49019924 CACGTTCTCCTCCTCCAGGGAGG + Intergenic
1137553042 16:49453488-49453510 CTCCTCCTCCTCCTCCAAGCAGG + Intergenic
1138124597 16:54428483-54428505 CTCACTCTCCTCCTCCAGGAAGG - Intergenic
1138315596 16:56067106-56067128 CCCCCACCCCACCTCCATGCAGG + Intergenic
1138408566 16:56819571-56819593 CACCTCATCCTCCTCCAGCCTGG + Intronic
1138803165 16:60059710-60059732 CTCACACTCCTCCTCCTGCCTGG + Intergenic
1139366602 16:66437530-66437552 CACCCACAGCCCCTGCAGGCTGG - Intronic
1140374507 16:74434059-74434081 CATGCTTTCCTCCTCCAGGCAGG + Intergenic
1140479150 16:75253227-75253249 CACCCACTCCTCAGCCTGGCTGG + Intronic
1141300867 16:82814391-82814413 CATCCACCCCACCTCCAGGGAGG + Intronic
1141389773 16:83654887-83654909 CAGGTACTACTCCTCCAGGCGGG + Intronic
1141562714 16:84880089-84880111 CACCCTTTCCTCCTCCACACAGG + Intronic
1141719878 16:85750380-85750402 CACGCGCTCCTTCTCCTGGCTGG - Intronic
1142093430 16:88227107-88227129 CACCCGTCCCTCCTCCACGCCGG + Intergenic
1142133772 16:88442515-88442537 CACCAGCCCCTCCTGCAGGCAGG - Intergenic
1142215945 16:88829888-88829910 CACCCCCTGCTCACCCAGGCTGG - Intronic
1142284241 16:89165289-89165311 CACCCTGGCCTCCTCCAGTCTGG + Intergenic
1142398312 16:89845587-89845609 CACCACTGCCTCCTCCAGGCCGG - Intronic
1142758566 17:2029914-2029936 CTCCCACTCCTCTCCCCGGCCGG - Intergenic
1142762844 17:2051605-2051627 CACCCTCTCGTCCTGCAGGGTGG + Intergenic
1143096837 17:4482826-4482848 ACCCCAATCCCCCTCCAGGCAGG + Intronic
1143324539 17:6090299-6090321 CACCCAGGCCTCCTCCCTGCAGG + Exonic
1143579924 17:7819433-7819455 CAGCCACTCGGCCTCCGGGCTGG - Intronic
1143774131 17:9186573-9186595 CAGCCACTCCCACCCCAGGCTGG - Intronic
1143922790 17:10344071-10344093 CATGCACTCCTCTTCCAGGATGG + Exonic
1143929735 17:10409550-10409572 CATGCACTCCTCTTCCAGGATGG + Exonic
1143938147 17:10508634-10508656 CATGCACTCCTCTTCCAGGATGG + Exonic
1143940645 17:10537504-10537526 CATGCACTCCTCTTCCAGGATGG + Exonic
1143952257 17:10642685-10642707 CATGCACTCCTCTTCCAGGATGG + Exonic
1146054358 17:29573805-29573827 CACACATTCCCCCTCCACGCAGG + Exonic
1146386778 17:32383869-32383891 GTCCCACTCCTTGTCCAGGCTGG - Intergenic
1146728633 17:35175403-35175425 CACCCACCTCCCCTCCAGTCTGG - Intronic
1146747528 17:35345671-35345693 CACCCACCCCTTTTCCGGGCAGG + Intergenic
1146802967 17:35842015-35842037 CACCATCTCCTTCCCCAGGCTGG + Intronic
1147335804 17:39726479-39726501 CTCCCACTCCCCCTCCAGTCTGG - Intronic
1148178417 17:45586355-45586377 CAGCCGCGCCTCCTGCAGGCCGG - Intergenic
1148270742 17:46260100-46260122 CAGCCGCGCCTCCTGCAGGCCGG + Intergenic
1148339865 17:46866979-46867001 CCCCCAGGCCTCCTACAGGCAGG + Intronic
1148471508 17:47896451-47896473 GCCCCGCTCCTCCTCCGGGCGGG - Intronic
1148563457 17:48619493-48619515 CACCCATTCCCCCGCCAGGCCGG + Intronic
1149122475 17:53186183-53186205 CTCCCAATGCTCCCCCAGGCTGG + Intergenic
1149845366 17:60006428-60006450 CCCCCACACCTCCCCCAGCCTGG + Intergenic
1149997463 17:61412468-61412490 CTCCCACTCGTGCTCCCGGCGGG - Exonic
1150227581 17:63532210-63532232 CTCCCACTCCCCACCCAGGCAGG + Intronic
1150579891 17:66463052-66463074 CACCCAGCACTGCTCCAGGCCGG - Intronic
1151537470 17:74747051-74747073 CCCCCTCTCCCCCTCCAGGCCGG - Exonic
1151802682 17:76387067-76387089 AACCCACTCTTCCTACAGGGAGG - Exonic
1151821282 17:76498243-76498265 CCGCCACTCCTCCCCCAGCCTGG + Intronic
1151826638 17:76527603-76527625 CACCCCACCCTCCTCCTGGCCGG - Exonic
1151868798 17:76822582-76822604 CACACACTCCTCCTCCTCACTGG - Intergenic
1152020643 17:77778641-77778663 CACCCACTCCTCCCCACAGCAGG - Intergenic
1152185611 17:78854886-78854908 CACCGATTCCTCCTGCAAGCTGG + Exonic
1152332217 17:79679844-79679866 CAGCCACTGCTCCTTCAGCCTGG - Intergenic
1152403221 17:80082123-80082145 CGCCCTCTCCGCCTCCAGGACGG - Intronic
1152509186 17:80773706-80773728 CACCAGGCCCTCCTCCAGGCAGG + Intronic
1152561326 17:81080213-81080235 CACACACTCATGCTCCCGGCTGG + Intronic
1152638305 17:81439166-81439188 CACCCATCCCACCTCCAGCCAGG - Intronic
1153802449 18:8683173-8683195 CACCCTCTCCTCCACCAGTTGGG + Intergenic
1154065344 18:11102439-11102461 CACCCTGTCCCCCACCAGGCTGG + Intronic
1154379238 18:13834954-13834976 CACCCACTCTTTCTCCTGCCCGG - Intergenic
1154503037 18:15005864-15005886 CAGCCCCTCCACCTCCAGGTAGG - Intergenic
1155042516 18:22076488-22076510 CATCCTTTCCTCCTCCATGCTGG + Intergenic
1156498375 18:37540924-37540946 CCCCCACTCCACCTCCAGGCAGG - Intronic
1157280546 18:46344187-46344209 CCCCCTCTCCACCTGCAGGCTGG - Intronic
1157329635 18:46694128-46694150 CACCCACTCCTTCTTAAGGAAGG + Intronic
1157493359 18:48138918-48138940 CACCCACCCCACCTCCACCCAGG - Intronic
1157619335 18:49007066-49007088 CACCCACTCCTCTCTCAGCCTGG + Intergenic
1158557221 18:58485464-58485486 CTGCCCCTCCTCCTCCTGGCTGG + Intronic
1158697902 18:59718977-59718999 CTCCCACTCCGCCTTCTGGCAGG - Intergenic
1160189941 18:76707634-76707656 CTCCTCCTCCTCCTCCAGCCTGG - Intergenic
1160422172 18:78754735-78754757 CAACCACTGCGCCTCCACGCTGG + Intergenic
1160508593 18:79440991-79441013 CACACCTCCCTCCTCCAGGCAGG + Intronic
1161253857 19:3295544-3295566 CACCCCCACCACCTCCTGGCTGG + Intronic
1161326706 19:3667679-3667701 TCCCCTCCCCTCCTCCAGGCAGG - Intronic
1161379805 19:3958965-3958987 CTCCCACTCCGCCTCCAGCCTGG + Exonic
1161428655 19:4217961-4217983 CACCACCTCCTGCTCCAGACTGG - Exonic
1161822000 19:6535216-6535238 CACCCACTCCTTCCCCAAGTTGG + Exonic
1162164766 19:8744791-8744813 CACCCACACATCCCACAGGCAGG + Intergenic
1162165837 19:8752259-8752281 CACCCACACATCCCACAGGCAGG + Intergenic
1162166903 19:8759715-8759737 CACCCACACATCCCACAGGCAGG + Intergenic
1162167969 19:8767175-8767197 CACCCACACATCCCACAGGCAGG + Intergenic
1162168908 19:8773469-8773491 CACCCACACATCCCACAGGCAGG + Intergenic
1162170654 19:8786237-8786259 CACCCACACATCCCACAGGCAGG + Intergenic
1162775748 19:12978061-12978083 CCCAGACTCCTCCTCCAGTCGGG - Intergenic
1162971504 19:14183693-14183715 CTCCCTGTCCTCCCCCAGGCTGG - Exonic
1163435600 19:17293391-17293413 GACAAAATCCTCCTCCAGGCCGG - Intronic
1163509147 19:17725104-17725126 CTCCCCCGTCTCCTCCAGGCAGG - Exonic
1163777413 19:19226588-19226610 CACCTCTTCCTCCTCCAGGGTGG - Exonic
1163779866 19:19240467-19240489 CACCCAGCCCACCTCCAGGCTGG + Intronic
1163819525 19:19487992-19488014 CAAGAAATCCTCCTCCAGGCTGG - Intronic
1164835270 19:31351556-31351578 GAACCGCTACTCCTCCAGGCCGG + Intergenic
1165490919 19:36122148-36122170 CACCCGCTACTCCTTCTGGCGGG - Intronic
1165893406 19:39127861-39127883 CACACACTGCTCCTCCTGCCTGG - Intronic
1166042612 19:40212940-40212962 CACCCGCTCCTTCTGCAGGGTGG - Exonic
1166061145 19:40326455-40326477 CAGGCTCTCCTCCTCCCGGCGGG + Exonic
1166093596 19:40525962-40525984 CTCCCACTCCTCCCACAGGGTGG - Intronic
1166544732 19:43627227-43627249 GCCCCCCTCGTCCTCCAGGCGGG + Exonic
1167058058 19:47125348-47125370 CAATCACTCCTCTTCCAGCCTGG - Intronic
1167171246 19:47833684-47833706 CACCCACCTCTCCTCCAACCTGG + Intronic
1167440437 19:49505546-49505568 CCCCCACTCCGCAGCCAGGCTGG - Intergenic
1167456576 19:49599476-49599498 CACCCACCACTCTACCAGGCGGG + Exonic
1167593918 19:50417771-50417793 CCCCCACCCCTCTCCCAGGCTGG + Intronic
1168344877 19:55645305-55645327 CACGGATTCCTCCTTCAGGCAGG - Exonic
1168522148 19:57060907-57060929 CACCCTCCCCTGCTCCAGTCTGG + Intergenic
925754698 2:7122322-7122344 CAACCACTGCCCCTCCATGCAGG + Intergenic
927139246 2:20118432-20118454 CACCCACTTCCTCTCCAGCCCGG - Intergenic
927430624 2:23023567-23023589 CTCCTACCCCTTCTCCAGGCTGG + Intergenic
928162181 2:28938863-28938885 CTCCCAAGCCTCCTACAGGCTGG - Intronic
928436298 2:31256801-31256823 TAGCCACGCCTCCACCAGGCTGG - Intronic
929109069 2:38391227-38391249 CAGACACTGCTCCCCCAGGCTGG - Intergenic
929453919 2:42053440-42053462 CTCCCACTCCTCCTCCACCCAGG + Intronic
930032417 2:47066530-47066552 CACCCCCTCCGCCTGCTGGCTGG + Intronic
930037327 2:47094914-47094936 CACACACTCCTCCCCAGGGCTGG + Intronic
931442389 2:62299442-62299464 CTCCTCCTCCTCCTCCTGGCAGG - Intergenic
932329896 2:70892236-70892258 CTCCCTCTCCTCCTCCTGCCAGG - Intergenic
932563559 2:72892067-72892089 CTACCACCCCTCCCCCAGGCTGG + Exonic
933632331 2:84672180-84672202 AAGTCTCTCCTCCTCCAGGCAGG + Intronic
934164430 2:89281387-89281409 CACCCTGGCCTCCTCCATGCTGG + Intergenic
934202844 2:89901137-89901159 CACCCTGGCCTCCTCCATGCTGG - Intergenic
934559468 2:95305174-95305196 CTCCCACTCCTGCTCGATGCCGG - Intronic
934657316 2:96123040-96123062 CAGCCTGGCCTCCTCCAGGCAGG - Intergenic
934721189 2:96578032-96578054 CACCCCCTCCTCCCCCAAGTAGG - Intergenic
934880231 2:97970634-97970656 CACCTGCTCTTCCACCAGGCTGG - Intronic
935187602 2:100748138-100748160 CACCCTCTCCTCCCCCTGCCTGG - Intergenic
935585221 2:104794741-104794763 CACCCTCTGTTCTTCCAGGCTGG + Intergenic
935625362 2:105168234-105168256 CACCCAGCCCTCCTCCAGGACGG + Intergenic
935652616 2:105395381-105395403 CACCCACTCTTCTTCATGGCAGG + Intronic
936140094 2:109932102-109932124 TACTCCCTTCTCCTCCAGGCAGG + Intergenic
936176783 2:110230047-110230069 TACTCCCTTCTCCTCCAGGCAGG + Intergenic
936204602 2:110439384-110439406 TACTCCCTTCTCCTCCAGGCAGG - Intronic
936492335 2:112983095-112983117 CACCCAGTCCTCCTCAAGCAGGG + Intronic
936746227 2:115579971-115579993 CCCCCACTCCACCCCCTGGCAGG + Intronic
937192858 2:120121348-120121370 CCCCCACTCCCCCTCCCGACAGG + Intronic
939146592 2:138423225-138423247 CACACAATCCTCCTGCAGGGAGG - Intergenic
941628646 2:167859516-167859538 CAACCACTCCTCTTTCAGGTCGG + Intergenic
946461000 2:219868917-219868939 CACCCACTACTCCTGCGGTCTGG + Intergenic
947610162 2:231520016-231520038 ATCCCCCTCCTCCTCCTGGCAGG - Intergenic
947637537 2:231687717-231687739 CACCCATGCCTGTTCCAGGCAGG + Intergenic
947712749 2:232325496-232325518 CACCCCCTCCTGCCCCAGGGAGG + Intronic
947804813 2:232958876-232958898 CACCCACTCCTCCCCAGGCCTGG + Intronic
948145242 2:235703587-235703609 CCCCCGCCCATCCTCCAGGCTGG + Intronic
948204678 2:236156948-236156970 CCCCCACACCACCTACAGGCAGG - Intergenic
948258904 2:236588789-236588811 CCCCCTCTCCCCTTCCAGGCTGG - Intergenic
948687383 2:239677644-239677666 TCCCCACACCTCCTCCAGGGGGG + Intergenic
948689409 2:239692356-239692378 CAGCCCCACCTCCTCCTGGCAGG - Intergenic
948825990 2:240573662-240573684 CACCCACACCTCACCCAGCCTGG - Intronic
948915797 2:241034550-241034572 CCCCCACCCCACCCCCAGGCTGG + Exonic
1169501259 20:6162972-6162994 CACTTACTTCTCCTCAAGGCAGG + Intergenic
1169723437 20:8703486-8703508 CATCCACTTCACCTCCAGGAAGG + Intronic
1170967159 20:21083838-21083860 CACCCACTTGTACTCCAGCCTGG + Intergenic
1171147527 20:22798583-22798605 CACCCACTTCTGCCTCAGGCAGG - Intergenic
1171191028 20:23159580-23159602 CACCCACCCCACCCCCAGGCTGG - Intergenic
1171249525 20:23637716-23637738 CACACCCTCCTCCTCCACGCTGG + Exonic
1171432988 20:25097575-25097597 CAGCCACACGTCCTCCAAGCTGG - Intergenic
1171798391 20:29584141-29584163 CACCCCCACACCCTCCAGGCAGG + Intergenic
1171845703 20:30273032-30273054 CACCCCCACACCCTCCAGGCAGG - Intergenic
1171849945 20:30301009-30301031 GACCCACTCCACCTGCTGGCTGG + Intergenic
1172146841 20:32763041-32763063 CACCTCCTCCTCCTCGAGTCTGG - Intronic
1172445198 20:34989756-34989778 CATGCATTCCTCCTCCAGGATGG - Exonic
1172606455 20:36217417-36217439 GAACCACTCCTCCTGGAGGCAGG + Intronic
1172833014 20:37852671-37852693 CACCCTCCCCTCCTGCAGTCAGG + Intronic
1172838991 20:37890769-37890791 CACCCACTTCTGCTCCTGGACGG + Intergenic
1173658926 20:44719811-44719833 CAGCCACTTCTCTGCCAGGCTGG - Intronic
1173856080 20:46251478-46251500 CGCCCCCTCCCCCTCCAGCCGGG - Exonic
1174328007 20:49794968-49794990 CACCCTCTCTTCCTCCTGGGAGG + Intergenic
1174801411 20:53565993-53566015 CACCAACTCATCCTCAAAGCTGG + Intergenic
1174898588 20:54475645-54475667 CCGCCGCTCCTCCTCCTGGCAGG + Exonic
1175115551 20:56679391-56679413 CATCCTCCCCTCCTCCAGGCAGG - Intergenic
1175155302 20:56967353-56967375 CAGCCTCTCCTCCCCTAGGCAGG + Intergenic
1175340727 20:58227711-58227733 CCCCAAGTCCTCCTCCATGCTGG - Intronic
1175368630 20:58471861-58471883 GACCCACTCCAGCCCCAGGCTGG - Intronic
1175482596 20:59321984-59322006 CACCTACGCCTGCTCCAGGAAGG - Intronic
1175515443 20:59567134-59567156 CACCAGCTCCTCGTCCAGGCAGG - Intergenic
1175886073 20:62291709-62291731 CAGCCGCTCCTTCTCCTGGCTGG - Exonic
1175904993 20:62375305-62375327 CTCCCCCTCCCCCTCCTGGCAGG - Intergenic
1176118163 20:63442219-63442241 CACCCACTCCCCCGCCAGCTTGG + Intronic
1178497812 21:33101848-33101870 CTCCCATTCATCCCCCAGGCCGG + Intergenic
1179519369 21:41932067-41932089 CCACCACTCCACCTCCAGGGAGG + Intronic
1179783942 21:43719290-43719312 CCGGCACTCCTCCTCCATGCCGG - Exonic
1179971294 21:44837732-44837754 CACCTGCTCCTGCTCCAAGCCGG - Intergenic
1180064856 21:45407078-45407100 CACACACCCCTCCCCCAGCCCGG + Intronic
1180594626 22:16965121-16965143 CACTCACTCCTCCACCGGCCCGG + Intronic
1180766906 22:18350560-18350582 CACACACGCCTTCTCCAGGAGGG - Intergenic
1180779407 22:18511818-18511840 CACACACGCCTTCTCCAGGAGGG + Intergenic
1180783940 22:18536610-18536632 CACCCCCTCCGCCTCCACCCTGG + Intergenic
1180812123 22:18769139-18769161 CACACACGCCTTCTCCAGGAGGG + Intergenic
1181127507 22:20710659-20710681 CACCCCCTCCGCCTCCACCCTGG + Intronic
1181198282 22:21203386-21203408 CACACACGCCTTCTCCAGGAGGG + Intergenic
1181240839 22:21475962-21475984 CACCCCCTCCGCCTCCACCCTGG + Intergenic
1181308835 22:21932771-21932793 CTCCCCTTCCTCCTCTAGGCAGG - Intronic
1181401461 22:22652407-22652429 CACACACGCCTTCTCCAGGAGGG - Intergenic
1181521307 22:23450138-23450160 GAGGGACTCCTCCTCCAGGCTGG - Intergenic
1181648066 22:24244485-24244507 CACACACGCCTTCTCCAGGAGGG + Intronic
1181703429 22:24633489-24633511 CACACACGCCTTCTCCAGGAGGG - Intergenic
1181804093 22:25364792-25364814 CGCCCGAGCCTCCTCCAGGCGGG + Intronic
1182018733 22:27063122-27063144 CAGCCTCTCCTCCTACAGGGTGG - Intergenic
1183129938 22:35824537-35824559 CTCCCATTTCTTCTCCAGGCTGG - Intronic
1183247983 22:36708707-36708729 CACCCACTCCTCTCCCAGGCTGG - Intergenic
1183323909 22:37181069-37181091 TACCCACTGCTCCCCAAGGCTGG - Exonic
1183735770 22:39644029-39644051 TCCCCATCCCTCCTCCAGGCTGG - Intronic
1183903515 22:41022770-41022792 GACCCCCGCCTGCTCCAGGCCGG - Intergenic
1184091614 22:42295879-42295901 CATCCCCTCCTCCTCCAGGCAGG + Intronic
1184236938 22:43187488-43187510 CCCCCAGTCCGCCTCCAGCCCGG + Intergenic
1184688643 22:46107629-46107651 CTCCCAGCCCTCATCCAGGCTGG + Intronic
1184764384 22:46564024-46564046 ACCACACTCCTCCTCCGGGCTGG + Intergenic
1185281731 22:49972581-49972603 CGCCCCCACCTCCTCCAGTCTGG + Intergenic
1185295246 22:50049854-50049876 CACCCAGGCCTCCTCCTGCCCGG - Intronic
1203228525 22_KI270731v1_random:91451-91473 CACACACGCCTTCTCCAGGAGGG - Intergenic
950098284 3:10342715-10342737 CACCCACGCCTCTCCCAGGCGGG - Intronic
950189254 3:10965320-10965342 CACCCACTCCTCCTGCTCTCCGG - Intergenic
950547329 3:13646267-13646289 CACACACCCCTCCTCAGGGCCGG - Intergenic
950570925 3:13799482-13799504 CACCCTCCCTTCCTCCAGGCAGG - Intergenic
950643066 3:14360751-14360773 CACACACGCCTTCTCCAGGGAGG - Intergenic
952180347 3:30910313-30910335 CACCCTCTTCTCCTTCAGGCAGG + Intergenic
953399506 3:42600670-42600692 CGCCGTCTCCTCCCCCAGGCCGG - Exonic
954065146 3:48099908-48099930 CACCTACCCCTCCCTCAGGCAGG + Intergenic
955985823 3:64573045-64573067 CACTCACTCCGTCGCCAGGCTGG - Intronic
956146362 3:66194967-66194989 CACCCACTCCTCCCCTTGGTGGG + Intronic
956927137 3:74001861-74001883 AACCTACTCCACCTCCAGGCTGG + Intergenic
958802901 3:98777134-98777156 CGCCCTTTCCTCCTCCTGGCTGG - Intronic
960559093 3:119062838-119062860 CACCCTCTGCTTCTCAAGGCAGG + Intronic
961002574 3:123383989-123384011 CACCCACCCTTCCTCAAGGGTGG + Intronic
961172720 3:124809583-124809605 CTCTCTCTCCTCCTCCTGGCTGG + Intronic
962277984 3:134030123-134030145 CTCCCTCTCCGCCTCCCGGCAGG - Intronic
966797710 3:183731267-183731289 CTCTCACTCTGCCTCCAGGCTGG - Intronic
966871425 3:184292476-184292498 CACCCAGACCTCTTCCAGGCAGG - Exonic
968009429 3:195264037-195264059 CACTAACTCCTCCTTAAGGCAGG + Intronic
968360512 3:198143735-198143757 CACCCACACCTCCCCTGGGCCGG + Intergenic
968481358 4:834540-834562 CATCCACGCCGCATCCAGGCAGG - Intergenic
968644492 4:1732772-1732794 CACCCACACCTGCTCCAGCATGG - Intronic
969604666 4:8196504-8196526 CACCCACCTCTCCTCCATGTGGG - Intronic
969605201 4:8199038-8199060 CACCCAGTCCCCCGCCAGGCTGG - Intronic
969719474 4:8885343-8885365 CACCCACTCCTTCTCAGGCCTGG - Intergenic
969876815 4:10141528-10141550 CCCCCACCCCTCCCCCAGGGAGG - Intergenic
972246711 4:37252689-37252711 CACCCAGTTCTCCTCCATGAGGG + Intronic
972680198 4:41298943-41298965 CCCCCACTCCTCATCCAAGCTGG + Intergenic
973820384 4:54657745-54657767 CGCGCCCTCCTCCTCCCGGCGGG + Intergenic
980520507 4:133926906-133926928 AACCCACTCATCCTACAGTCTGG + Intergenic
981041993 4:140231713-140231735 CACTCGGTCCTCCTCCAGCCTGG + Intergenic
981796469 4:148600795-148600817 CACCCACTGGAGCTCCAGGCTGG + Intergenic
982287334 4:153748768-153748790 CATCCTCTCCTGCTGCAGGCTGG + Exonic
984792290 4:183625857-183625879 CCCCTATTCCTGCTCCAGGCAGG - Intergenic
985491455 5:182107-182129 CAGCCAGTCCTCCTCCATCCTGG + Exonic
985966138 5:3340034-3340056 CAGCCGCCTCTCCTCCAGGCCGG + Intergenic
986464597 5:8008518-8008540 GACCCACCCCTCTGCCAGGCTGG - Intergenic
986613128 5:9589795-9589817 CCCCTACTCCACCTCCAGCCAGG - Intergenic
986867023 5:12001271-12001293 CTCCACCTCCTCCTGCAGGCTGG - Intergenic
987103552 5:14614746-14614768 CACACAGCCCTCCTCCATGCTGG - Intronic
990120393 5:52444164-52444186 CACCCCTTCCCCCTCCAGCCCGG + Intergenic
990990039 5:61675454-61675476 CACCCACTGGTCCTACAGGATGG + Intronic
993794502 5:92249719-92249741 CAACCCCTACTCCACCAGGCAGG + Intergenic
995039019 5:107567559-107567581 CACCCACCCCTGCCCCAGGTTGG + Intronic
995357363 5:111254409-111254431 AACCCTCTCCACCTCCAGGAAGG - Intronic
995436765 5:112144891-112144913 CTCCCTCTTCTCCTGCAGGCTGG - Intronic
995636405 5:114197641-114197663 CAGCCACTCTTATTCCAGGCAGG - Intergenic
997397980 5:133579958-133579980 CACCCAGTCCTGCTCCCAGCCGG - Intronic
997428844 5:133823617-133823639 TCCCCACTCCTCCACCAAGCTGG + Intergenic
997966929 5:138365302-138365324 CACCCCATCGTACTCCAGGCTGG - Intronic
998113049 5:139516872-139516894 CACTCACTCGTCGCCCAGGCTGG + Intergenic
998148281 5:139742865-139742887 GACCCCCTCCCACTCCAGGCTGG - Intergenic
998366944 5:141637838-141637860 CGCCCGCACCTCCTCCACGCCGG - Exonic
999258376 5:150222473-150222495 CACCCTCTCCCCTGCCAGGCTGG - Intronic
999314334 5:150574405-150574427 CACTCTCTGCTCCCCCAGGCAGG + Intergenic
1000333107 5:160221343-160221365 CACCCCCGCCTCCTCCAATCAGG - Intronic
1000477762 5:161732590-161732612 CACCCACTCCTTTTGCAGGGCGG + Intergenic
1000853297 5:166367491-166367513 TACCCACACCACCTGCAGGCTGG + Intergenic
1001127037 5:169029050-169029072 CACCCATTCCTCCTCCTATCTGG - Intronic
1001492400 5:172165024-172165046 TATCCCCACCTCCTCCAGGCTGG - Intronic
1001588367 5:172848914-172848936 CACCCACCCCTCCTTCAGGCAGG - Intronic
1001717149 5:173825507-173825529 CAACCAGTCCTCCCCCAGGCTGG - Intergenic
1002105952 5:176879535-176879557 CACCCACCCCGCCGCCGGGCAGG - Intronic
1002690265 5:181045562-181045584 CACCTCCTCCTCCTTCAGCCTGG + Exonic
1003819171 6:9876894-9876916 GCGCCACTCCTCCCCCAGGCTGG + Intronic
1006052653 6:31356219-31356241 CACGCACTCGCCCTCCAGGTAGG + Exonic
1006166857 6:32070359-32070381 CACCCACAGCTCCCCAAGGCGGG + Intronic
1006460049 6:34152909-34152931 CACCTACTCCACCCCCAGCCTGG - Intronic
1007302226 6:40876034-40876056 CCCCCAGCCCTCCCCCAGGCAGG - Intergenic
1007310252 6:40939678-40939700 CTGCCTCTCCTCCTCCATGCTGG - Intergenic
1007740717 6:44008059-44008081 GCCCCACTCCCGCTCCAGGCTGG - Intergenic
1008063869 6:47026862-47026884 GACCCACTTCTCGTCCACGCAGG + Intronic
1016026818 6:139296033-139296055 GACCCCCCCCTCCTCCAGCCTGG + Intergenic
1016309343 6:142716300-142716322 CACTCACCCCGCCTCCAGGAAGG - Intergenic
1016433176 6:144008527-144008549 CACCCACACGTCCTGCGGGCCGG + Intronic
1017071649 6:150580346-150580368 CACCCACCCCTCCTCTTGCCTGG + Intergenic
1017279646 6:152609407-152609429 CGAACACTCCTCCTCCAGCCAGG - Intronic
1017642480 6:156507771-156507793 CACCCACTGCTCGTCGAGACTGG - Intergenic
1017669018 6:156752410-156752432 CAACCATTCTTCCACCAGGCAGG - Intergenic
1018734604 6:166678229-166678251 CACCCATTCTTACTCCAGGTGGG + Intronic
1018887414 6:167951646-167951668 CTCCCGCTCCTCCTCCAGGCGGG - Exonic
1019142782 6:169958793-169958815 CACCCCCTGATCCTCCAGGCTGG - Intergenic
1019259492 7:72899-72921 CACCCACACCTCCCCTGGGCCGG - Intergenic
1019559927 7:1650927-1650949 TGCCCACCCCTCCCCCAGGCTGG + Intergenic
1019580108 7:1757756-1757778 CACCCCCGCCTCCTCCCGTCTGG + Intergenic
1019602756 7:1893520-1893542 CACCCACTCCACCTGGGGGCTGG - Intronic
1019707061 7:2501954-2501976 CACCCACTGCACCCCAAGGCTGG - Intergenic
1020338973 7:7089113-7089135 CACCCCTTCCTCCACCAAGCTGG + Intergenic
1021761912 7:23910599-23910621 GAACCACTGCTACTCCAGGCTGG + Intergenic
1023865203 7:44235107-44235129 CACCCACCCCTACCCCAGGAAGG - Intronic
1024260254 7:47568984-47569006 CACCCACTCCTCCTCCAGGCAGG + Intronic
1024533560 7:50411771-50411793 CACCCGCAGCTCCTCCAGGGTGG - Intergenic
1025990612 7:66494033-66494055 CCCCAACTCCTCCCCCAGCCAGG + Intergenic
1026038137 7:66844556-66844578 CCCCAACACCTCCTCCAGCCAGG - Intergenic
1026888402 7:73967940-73967962 CACCCACCCAGCCTCCAGGTGGG + Intergenic
1027177498 7:75914274-75914296 CCCCCACTCCTCTTCCATCCAGG + Intronic
1027213270 7:76167026-76167048 CCCCAACTCCTCCCCCAGCCAGG + Intergenic
1028129986 7:87160302-87160324 CTCACTCTCGTCCTCCAGGCTGG + Intronic
1028397505 7:90387304-90387326 CTCCCTCTTGTCCTCCAGGCTGG - Exonic
1028576729 7:92360226-92360248 CATCCTCTCCTCCCCCAAGCTGG + Intronic
1029490667 7:100868327-100868349 CAGCCACGCTTCCTCCATGCTGG - Intronic
1029612853 7:101636601-101636623 CTCTCTCTCCTCCTCCACGCAGG - Intergenic
1031986347 7:128166935-128166957 CCCCCGCACCTCCTCCAGGGAGG - Intergenic
1032353196 7:131185048-131185070 CACCCTCTCCTCCTCTCGGGTGG - Intronic
1032594786 7:133228560-133228582 CACCCACTCACCCTACAGGGAGG + Intergenic
1033195257 7:139321893-139321915 CCCTCTCTCCTCCTCCAGCCTGG - Intergenic
1034819367 7:154202665-154202687 CATCCCCTCCTACTACAGGCCGG + Intronic
1035264898 7:157685183-157685205 CTCCCACCCCTCATCCCGGCCGG + Intronic
1035381517 7:158444109-158444131 CACTCACCCCTCCAACAGGCAGG + Intronic
1035609066 8:948386-948408 CGCCCACTCCTCCTGCACCCGGG - Intergenic
1038050591 8:23806668-23806690 CACCCACTCCTCCTCTAAATTGG + Intergenic
1038350865 8:26775021-26775043 CACCCACCCCTGAACCAGGCTGG - Intronic
1039466061 8:37786304-37786326 CCCCCTCTCCACATCCAGGCTGG - Intronic
1040482096 8:47835576-47835598 CACTCACTCCAGCTCCAGCCTGG + Intronic
1041292671 8:56321465-56321487 CTGCCTCTCCTCCTGCAGGCTGG - Intergenic
1041370092 8:57150063-57150085 CAGCCACTTCTCTTCCAGGCAGG - Intergenic
1043482436 8:80667051-80667073 CTCCCTCACTTCCTCCAGGCAGG - Intronic
1047835194 8:128681687-128681709 CACAAACTCCTCCGCCTGGCTGG + Intergenic
1048254841 8:132897972-132897994 CACCCACTTGTCTTTCAGGCTGG - Intronic
1048308151 8:133297563-133297585 CACAAACGCCTCCTCCGGGCAGG - Exonic
1048632312 8:136257428-136257450 CACTCAATCCTCTTTCAGGCTGG + Intergenic
1048872280 8:138809472-138809494 CACCCTCTCCTCCTTTAGGCAGG - Intronic
1049277956 8:141729337-141729359 CACTCTCTCCTTCTCCAGGAAGG - Intergenic
1049302803 8:141880485-141880507 CAGCCACTCCCCCTCCTTGCTGG + Intergenic
1051170442 9:14314990-14315012 CACCCAGGCCGCCCCCAGGCCGG + Intronic
1052438376 9:28460788-28460810 CACACACTTGCCCTCCAGGCTGG - Intronic
1052779605 9:32767132-32767154 CATCTTCTCCTCCTCCAGGCAGG + Intergenic
1052840840 9:33289799-33289821 CACCCACACCTCTTTCACGCAGG + Intergenic
1053562311 9:39209541-39209563 CACCCCACCCTTCTCCAGGCTGG - Intronic
1053787721 9:41664302-41664324 GACCCACTCCACCTGCTGGCTGG + Intergenic
1053828116 9:42047529-42047551 CACCCCACCCTTCTCCAGGCTGG - Intronic
1054134805 9:61409417-61409439 CACCCCACCCTTCTCCAGGCTGG + Intergenic
1054157405 9:61650465-61650487 GACCCACTCCACCTGCTGGCTGG - Intergenic
1054175997 9:61875644-61875666 GACCCACTCCACCTGCTGGCTGG + Intergenic
1054477179 9:65581470-65581492 GACCCACTCCACCTGCTGGCTGG - Intergenic
1054602441 9:67139917-67139939 CACCCCACCCTTCTCCAGGCTGG + Intergenic
1054661542 9:67705164-67705186 GACCCACTCCACCTGCTGGCTGG - Intergenic
1055437906 9:76310805-76310827 CACCCTCTCTTCCTCCATGAAGG + Exonic
1056451811 9:86723670-86723692 CATCCACTCCTCAGCCAGGATGG - Intergenic
1056530052 9:87478931-87478953 CCCCCACTCCAGCACCAGGCTGG - Intergenic
1057160286 9:92884223-92884245 AACCCCCTCCGCATCCAGGCAGG - Intergenic
1057329631 9:94101399-94101421 CAGCCTCTCCACTTCCAGGCTGG - Intronic
1057379103 9:94553298-94553320 CTCCTCCTCCTCCTCCAGCCTGG + Intergenic
1057488726 9:95506411-95506433 CACCCACAGCTCCTCCACGTTGG + Exonic
1057875522 9:98751279-98751301 CACCCTCTTCCCCTCAAGGCAGG + Intronic
1058012008 9:99988971-99988993 CAGGCACCCCTCCTCCAGCCAGG - Intronic
1060597350 9:124856407-124856429 CACCCACTCTGCATCTAGGCGGG - Intronic
1061099946 9:128484916-128484938 CACCCAGCCCTCCTCAGGGCAGG - Intronic
1062020454 9:134316918-134316940 CAGCCACCCCTCCCCCAGGCAGG - Intergenic
1062033350 9:134371955-134371977 CACCCAGTCCTGCACCAGGCTGG - Intronic
1062059480 9:134487306-134487328 CACCCTCCCCTGCTCCATGCAGG + Intergenic
1062497239 9:136837645-136837667 CAGCCCCTCCACCTCCAGGTAGG + Exonic
1062745210 9:138207564-138207586 CACCCACACCTCCCCTGGGCCGG + Intergenic
1186508053 X:10109939-10109961 CTCCCGCTCCTCCTCCAGCCGGG - Exonic
1187505536 X:19875542-19875564 CACCCACTCCTCCACAGGGCAGG + Intronic
1189275095 X:39779647-39779669 AGCCCGCTCCTCCTCCAGCCAGG + Intergenic
1189463356 X:41259956-41259978 CCCCCACTCCTTCTCAATGCAGG - Intergenic
1191098966 X:56704772-56704794 GCCCCTCCCCTCCTCCAGGCTGG + Intergenic
1192208458 X:69111269-69111291 CTCCCACCCCTCTTCCTGGCAGG - Intergenic
1196519900 X:116661114-116661136 CACCCTCTCCTTTTCCAGCCCGG + Intergenic
1201380900 Y:13377680-13377702 CACCCTCTTCTCACCCAGGCTGG - Intronic