ID: 1024260934

View in Genome Browser
Species Human (GRCh38)
Location 7:47573363-47573385
Sequence CGGGCTGGTGGGAGGCAGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 719
Summary {0: 1, 1: 0, 2: 2, 3: 80, 4: 636}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024260934_1024260941 -9 Left 1024260934 7:47573363-47573385 CCACGCTGCCTCCCACCAGCCCG 0: 1
1: 0
2: 2
3: 80
4: 636
Right 1024260941 7:47573377-47573399 ACCAGCCCGCTAGGTCGCTGGGG 0: 1
1: 0
2: 0
3: 1
4: 41
1024260934_1024260940 -10 Left 1024260934 7:47573363-47573385 CCACGCTGCCTCCCACCAGCCCG 0: 1
1: 0
2: 2
3: 80
4: 636
Right 1024260940 7:47573376-47573398 CACCAGCCCGCTAGGTCGCTGGG No data
1024260934_1024260946 20 Left 1024260934 7:47573363-47573385 CCACGCTGCCTCCCACCAGCCCG 0: 1
1: 0
2: 2
3: 80
4: 636
Right 1024260946 7:47573406-47573428 TCTCAAATCTACAAGCGCCATGG 0: 1
1: 0
2: 0
3: 4
4: 52
1024260934_1024260945 -3 Left 1024260934 7:47573363-47573385 CCACGCTGCCTCCCACCAGCCCG 0: 1
1: 0
2: 2
3: 80
4: 636
Right 1024260945 7:47573383-47573405 CCGCTAGGTCGCTGGGGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024260934 Original CRISPR CGGGCTGGTGGGAGGCAGCG TGG (reversed) Intronic
900013843 1:136143-136165 CGGGCTGCTGGGAGGTAGGCAGG - Intergenic
900014163 1:137360-137382 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
900043913 1:492126-492148 CGGGCTGCTGGGAGGTAGGCAGG - Intergenic
900044026 1:492562-492584 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
900065350 1:727129-727151 CGGGCTGCTGGGAGGTAGGCAGG - Intergenic
900065436 1:727468-727490 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
900164981 1:1240954-1240976 CGGGCTGGGGGCAGGCACCCAGG - Intergenic
900186180 1:1334320-1334342 TGGGCAGGTGGAAGGCAGCCAGG - Exonic
900386508 1:2413228-2413250 CTGGCGGGTGGGGGGCAGCCGGG + Intronic
900478438 1:2886992-2887014 CGGGGTGCTGGGAGGCCGAGAGG - Intergenic
900550621 1:3252613-3252635 GGGGCTGGTGGGCAGCAGGGTGG + Intronic
900589129 1:3452033-3452055 CGGGCTGGTGGGAAGAAGGTTGG - Intergenic
900938892 1:5784939-5784961 GGGGGGGGTGGGCGGCAGCGTGG + Intergenic
900987149 1:6079703-6079725 GGGGCTGGAGGCAGGGAGCGGGG + Intronic
901020710 1:6253951-6253973 GCTGCTGGTGGGCGGCAGCGTGG - Exonic
901128950 1:6950159-6950181 CTGGCTGGGCGGAGGCAGCAAGG + Intronic
901158231 1:7154915-7154937 CGGGCTTGTGGGTGCCAGCATGG + Intronic
901174132 1:7286155-7286177 CCTGCTGGTGGGGGGCAGAGAGG + Intronic
901512562 1:9724722-9724744 GGGGCTGGTTGGATGCAGAGCGG + Intronic
901525950 1:9823658-9823680 CGGGCTGCTGTGCGGCGGCGGGG - Exonic
901772803 1:11539135-11539157 CAGGCTGGTGGGAGGAGGCCCGG + Intergenic
901799861 1:11701729-11701751 CGGGCTGCGGGGAGGCGGAGGGG + Intronic
902333621 1:15742807-15742829 GGGGCGGGAGGGAGGCAGCGAGG - Intronic
903279969 1:22244828-22244850 GGTGCTGGGGGGAGGCAGCCGGG + Intergenic
903325667 1:22567334-22567356 CTGGCTGGTGGGAGGGGGAGGGG - Intronic
903355065 1:22741384-22741406 CAGGCTGGAGGAAGGCAGCCAGG - Intronic
903453489 1:23470787-23470809 TGGGGTGGTGGGAAGCAGGGAGG + Intronic
903691678 1:25178516-25178538 GGGCCTGGTGGGAGGTAGCTGGG - Intergenic
903996477 1:27308053-27308075 AGGGAGGGTGGGAGGCAGGGAGG - Exonic
904586109 1:31581535-31581557 CAGGCTTGTGGGAGGCAGACGGG + Intronic
904788205 1:32998347-32998369 AGGGCAGGTGGGAGGCAGCAGGG - Intergenic
905137287 1:35808817-35808839 CCGGCTGGTAGTAGGCAGCGGGG - Intronic
905251666 1:36652874-36652896 CTGGCTGGTGGGAGATTGCGAGG + Intergenic
905308488 1:37034407-37034429 GGGGCAGGTGGGAGCCCGCGCGG - Intergenic
905357314 1:37393837-37393859 AGAGCTGTTGGGAGCCAGCGAGG + Intergenic
906140434 1:43531099-43531121 GGGGCTGGTGGGGGGCCGGGGGG - Intronic
906202657 1:43970143-43970165 TTGGGTGGTGGGATGCAGCGGGG - Exonic
907319248 1:53592522-53592544 AGGGCTGCTGGGAGACAGCTGGG - Intronic
907438425 1:54463897-54463919 CGGGCTCGTGGGGTGCAGTGGGG + Intergenic
907758318 1:57332863-57332885 GTGGCTGGTGGGAGGCAGACAGG - Intronic
910427659 1:87132467-87132489 CGGGCTGGGGGGCGGGTGCGGGG + Intronic
910678944 1:89843392-89843414 CGGGCGGGTGGCTGGCAGCGAGG + Intronic
911945000 1:104095929-104095951 CAGGCTGGAGGAAGGCAGTGAGG + Intergenic
912795146 1:112688874-112688896 AGGGCTCGAGGGAGGCAGGGCGG - Intronic
912801600 1:112722952-112722974 CGGGTGGGCGGGAGGGAGCGGGG + Intronic
914200037 1:145476208-145476230 GGGGCTGGAGGGCGGGAGCGGGG + Intergenic
914479155 1:148049343-148049365 GGGGCTGGAGGGCGGGAGCGGGG + Intergenic
915458073 1:156053712-156053734 CGGGCTGGCGGGCGGCCGGGTGG - Exonic
915679595 1:157567787-157567809 CTGGCTGGTGGTAGGGAGGGTGG - Intergenic
915839473 1:159202978-159203000 CGGGGGGGTGGGAGGGAGAGGGG + Intronic
915932366 1:160068494-160068516 AGGACTGGGGGAAGGCAGCGGGG + Intronic
916830432 1:168485391-168485413 GGGGGTGGTGGGGGGCGGCGTGG + Intergenic
917490480 1:175494089-175494111 CAGGCTGGTGGGAGGAATCCGGG - Intronic
918066521 1:181105360-181105382 CGGGCTGGAGGGCGGGGGCGGGG + Intergenic
919922317 1:202174036-202174058 CAGGCTGGTGGGGGGCAGGGTGG + Intergenic
919973028 1:202593034-202593056 CTGGGTGGTGGCAGGCAGGGAGG - Exonic
920284412 1:204869136-204869158 GGGGCTGGAGGGAGCCAGGGTGG + Intronic
920441648 1:205984884-205984906 GGGGCTGGGAGGAGGCAGGGAGG - Intronic
920957642 1:210633776-210633798 TGGGTTGGTGGGATGCAGGGTGG - Intronic
920993880 1:210968008-210968030 TGGGGTGGTGGGAGGGGGCGGGG - Intronic
921685306 1:218082982-218083004 GGGGCTGGTGGGAGTCAGTGGGG - Intergenic
922518246 1:226223869-226223891 CAGGCTGGCGGGGGGCGGCGGGG - Exonic
922734427 1:227971722-227971744 CGGGCTGCCGGGAGGCAGGCAGG - Intergenic
922734494 1:227971965-227971987 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
922734715 1:227972854-227972876 TGGGCTGCTGGGAGGCAGGCAGG - Intergenic
922734775 1:227973096-227973118 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
923030500 1:230245843-230245865 TGGCCTGCTGGGAGGCAGGGAGG - Intronic
923385262 1:233459842-233459864 AGGGCTGGTCAGAGGCAGAGGGG - Intergenic
924343437 1:243054740-243054762 CGGGCTGCTGGGAGGTAGGCAGG - Intergenic
924343490 1:243054935-243054957 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
924583738 1:245344076-245344098 AGGGAGGGAGGGAGGCAGCGAGG - Intronic
924588608 1:245381729-245381751 GGGGCTGGTGGGAGGGAGAATGG - Intronic
1062822959 10:548437-548459 CGGGATGGAGGGAGGGAGGGAGG + Intronic
1062829066 10:593419-593441 GGGTCTGCTGGGAGACAGCGGGG - Intronic
1063275741 10:4565739-4565761 GGGGCGGGTGGGAGGAGGCGGGG + Intergenic
1064345971 10:14533170-14533192 CGGGCTGCAGGCAGGCAGGGCGG + Intronic
1065069926 10:22012972-22012994 GGAGCTGGTGGAAGTCAGCGTGG - Intergenic
1065186518 10:23174574-23174596 CGGGCTGGGGGAGGGCAGGGTGG + Intergenic
1066180524 10:32957743-32957765 AGCGCAGGTGGGAGCCAGCGAGG - Exonic
1066732626 10:38449169-38449191 CGGGCTGCTGGGAGGCAGGCAGG - Intergenic
1066733032 10:38450775-38450797 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
1067555597 10:47267720-47267742 GGGGCAGGAGGGAGGCAGCAAGG - Intergenic
1067827719 10:49591490-49591512 TGGGCTGCTGCGAGGCAGTGAGG + Intergenic
1069828797 10:71270365-71270387 AGGGAGGGTGGGAGGCAGGGAGG + Intronic
1069861095 10:71472218-71472240 CTGGATGGTGGGAGGAAGGGAGG + Intronic
1069893302 10:71665325-71665347 AGGGGTAGTGGGAGGCAGTGGGG - Intronic
1069931969 10:71889080-71889102 AGGTCTGCTGGGACGCAGCGCGG + Intergenic
1070752839 10:78974037-78974059 GGAGCTGGGAGGAGGCAGCGAGG - Intergenic
1070780059 10:79132446-79132468 TGGGCTGGAGTGAGGCAGCAGGG + Intronic
1073289997 10:102408821-102408843 GCGGCTTGTGGGAGGCACCGAGG - Intronic
1074148687 10:110739613-110739635 CGTGGTGGTGGAAGGCAGAGTGG + Intronic
1074386446 10:113020291-113020313 CATGCTGATGGGAGGCAGCTGGG + Intronic
1074801548 10:117005387-117005409 CGCGCTGGTGGGAGGGGGGGCGG + Exonic
1074829967 10:117241270-117241292 CGGGCCCGGGGGAGGCAGGGAGG + Intronic
1075105629 10:119538414-119538436 ATGGAGGGTGGGAGGCAGCGAGG + Intronic
1075302299 10:121335689-121335711 CAGGCGGGTGGGAGGCAGTAGGG + Intergenic
1075725391 10:124608269-124608291 CAGGCTGGTGGGGGGCAGACAGG - Intronic
1075799144 10:125141997-125142019 GGGGCTGGTGGGACACAGTGTGG + Intronic
1076103030 10:127797833-127797855 CGGGATGGTGGGAGGGTGGGGGG - Intergenic
1076171319 10:128322518-128322540 AGGGCTGGTTGGAGGCAGAGTGG - Intergenic
1076409580 10:130236347-130236369 TGGGGTGGTGGGAGGCAGGCTGG + Intergenic
1076525939 10:131112408-131112430 AGGGCTTGTGGGAGGCACAGTGG - Intronic
1076830590 10:132992391-132992413 GGTGCTGGTGGGATGCAGAGGGG + Intergenic
1076970187 11:128357-128379 CGGGCTGCTGGGAGGTAGGCAGG - Intergenic
1076970363 11:129037-129059 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
1077027304 11:446586-446608 CTGGCTTGTTGGAGGGAGCGTGG - Intergenic
1077090710 11:777171-777193 CGGGTTGGTGGGATGGAGCTCGG - Intronic
1077166045 11:1139302-1139324 GGGGGTGGTGGGAGGAGGCGGGG + Intergenic
1077172968 11:1176552-1176574 CGGGCTGGTGGCGGACGGCGAGG + Intronic
1077283859 11:1757275-1757297 CGCGTTGCTGGGAGGCAGGGCGG - Intronic
1077328508 11:1973872-1973894 CAGGGTGGTGGGGGGCAGCCCGG + Intronic
1077375998 11:2205378-2205400 TGGGCTGCTGGGAGGTAGGGAGG - Intergenic
1077376071 11:2205592-2205614 TGGGCTGTTGGGAGGTAGGGAGG - Intergenic
1077384002 11:2260511-2260533 CTGGCTGGTGGGGGGCAGAGCGG - Intergenic
1078359418 11:10656920-10656942 AAGGATGGTGGGAGGCAGAGGGG + Intronic
1078439682 11:11353870-11353892 GGGGTTGGTGGGAGGCAATGTGG + Intronic
1080443775 11:32318546-32318568 GGTGCTGGTGGGAGGCAAAGAGG - Intergenic
1080503624 11:32892718-32892740 GGGGCTGGCGGGCGGCCGCGAGG - Intergenic
1081235593 11:40643620-40643642 CGTGCTGGTGGACGGCAGGGGGG - Intronic
1082833781 11:57638222-57638244 CGGACTGTTGGGAGGCGGAGGGG + Intergenic
1082952350 11:58830929-58830951 CGAGCCTGTGGGAGGCAGAGGGG - Intergenic
1083138914 11:60705383-60705405 CAGCCTGGTGGGAGGAGGCGTGG - Intronic
1083298131 11:61726174-61726196 AGGGCTGGTGGGAAGGAGCTGGG + Intronic
1083534322 11:63454555-63454577 CGGCCTGGTGAGGGGCAGCCTGG - Intergenic
1084128952 11:67118980-67119002 CGGGCTGGCGGGAGGGAGGGAGG + Intergenic
1084434007 11:69127440-69127462 CGGGCGGGTGGCAGCCAGAGTGG + Intergenic
1084453015 11:69251184-69251206 AGGGCAGGTGGGAGGCGGTGGGG + Intergenic
1084569284 11:69949747-69949769 AGGGCTGGAAGGAGGCAGGGAGG + Intergenic
1085054141 11:73394323-73394345 TGGGCTGGTGGGAGATAACGGGG + Intronic
1085472718 11:76768482-76768504 CGGGCTGGCTGGGGGCAGGGGGG - Intergenic
1085532978 11:77202678-77202700 CGGGCTGGAAGCAGGCAGCTGGG + Intronic
1086681807 11:89681868-89681890 GGGGGTGGTGGGGGGCAGGGAGG + Intergenic
1086861339 11:91927903-91927925 CGGGGGGGTGGGGGGTAGCGTGG + Intergenic
1087105226 11:94401387-94401409 CGGGCTGGTGGCGGGCGGCGCGG - Exonic
1087672998 11:101128493-101128515 CGGGCTGGTGACAGGCCCCGGGG + Exonic
1087770589 11:102205564-102205586 CGGGGTGGGGGAAGGGAGCGGGG - Intronic
1087847316 11:102988349-102988371 GGGACTGGTGGGAGGAAGCATGG - Intergenic
1088823498 11:113475325-113475347 CGGGCGGGCAGGAGGGAGCGCGG + Exonic
1089262641 11:117232894-117232916 CGGGGGGGTGGCTGGCAGCGGGG + Intronic
1089466575 11:118689881-118689903 GGGGCTGCTGGGAGGCAGAGCGG - Intergenic
1089543824 11:119206778-119206800 CGGGAGGGTGGGGGGCGGCGTGG + Intronic
1089814814 11:121162762-121162784 AGGGCAGGTGGAAGGCAGAGCGG + Intronic
1090275792 11:125418507-125418529 CTGGCTGGGGGGAGGCAGAGCGG + Intronic
1090415068 11:126534983-126535005 GTGGCTGGTGGGAGGAAGTGTGG + Intronic
1202811486 11_KI270721v1_random:29051-29073 CAGGGTGGTGGGGGGCAGCCCGG + Intergenic
1091380206 12:53143-53165 TGGGTTGGTGGGAGGGAGGGAGG - Intergenic
1091882583 12:3991359-3991381 CGGGCGGGTGGGGGGCCGAGAGG + Intergenic
1094218504 12:27970340-27970362 CGGGCTGGCGGGCGGGCGCGCGG + Intronic
1094488422 12:30943150-30943172 CGGGGCTGTGGGAGGCAGCAGGG - Intronic
1094689556 12:32755526-32755548 CGCGCTGGTGGGAGGCGCCACGG - Exonic
1096409280 12:51365466-51365488 CCGGCTGCTGGGGGCCAGCGTGG - Exonic
1096461722 12:51825374-51825396 GGGGCTGGTGAGAGGGAGCCTGG - Intergenic
1098450114 12:70610071-70610093 GGGGCTGGGGCGAGGCAGCGCGG - Intronic
1098867578 12:75780430-75780452 CTGTCTGGAGGGAGGCAGCAGGG + Intergenic
1099646795 12:85367730-85367752 CGGGGTGGTGGGGGGCGGGGGGG - Intergenic
1100167258 12:91929867-91929889 TGGGATGGGGGGAGGCAGTGGGG + Intergenic
1100869427 12:98894937-98894959 CGGGCGGGTGCGAGGGCGCGCGG - Intronic
1101842664 12:108339458-108339480 TGGGCTTGTGGGTGGCGGCGGGG + Intergenic
1102006628 12:109593215-109593237 CAGGCTGGTGAGAGGCACCCGGG + Intronic
1102278129 12:111598659-111598681 TGGGCTGGGGGCCGGCAGCGCGG - Intronic
1102495561 12:113316718-113316740 AGGACTGGTGGGATGGAGCGGGG - Intronic
1102539708 12:113609996-113610018 CGGGCTGGGCGGAGGCCGAGGGG + Intergenic
1102853883 12:116277274-116277296 CGGGCAGGCGGGAGGCGCCGCGG + Exonic
1102959881 12:117085511-117085533 GGGGCCAGTGGGAGGCAGGGTGG - Intronic
1103358966 12:120342510-120342532 AGGGCTGGAGGGAGGCGGCCAGG + Exonic
1103779271 12:123388747-123388769 CGGGCTGGCGGGAGGGCGGGCGG + Intronic
1104595048 12:130115248-130115270 GGGGCTTGCGGGAGGCGGCGTGG - Intergenic
1104680550 12:130748262-130748284 AGGGCTGGTGCGAGCCAGCCTGG - Intergenic
1104932002 12:132344936-132344958 AGGGGAGGTGGGAGGGAGCGGGG - Intergenic
1104970904 12:132530274-132530296 CCGGCTGCTGGGAGGCACCTGGG + Intronic
1105409644 13:20161100-20161122 GGGGCTGTTCGGAGGCGGCGGGG - Intergenic
1106104473 13:26722153-26722175 CGGGTGGGTGAGTGGCAGCGAGG - Intergenic
1106410700 13:29509309-29509331 CGGGCTGTGGGGAAGCAGAGCGG + Intergenic
1107058513 13:36131217-36131239 AGGGCTGGGGGGCGGCGGCGGGG + Exonic
1107468084 13:40666789-40666811 TGGGCTGGTGGGGGGTAGTGGGG + Intergenic
1108530735 13:51324973-51324995 TGGGCTGGTGGGGGGCACGGTGG - Intergenic
1108704890 13:52976039-52976061 AGGGTTGGTGGCAGGCAGCTGGG + Intergenic
1110119628 13:71865871-71865893 CAGGCTGGTGGGAAGGGGCGCGG + Intronic
1112506830 13:99980751-99980773 CGAGCTGGAGGGAGGGAGGGAGG + Intergenic
1113329411 13:109314194-109314216 GGGGCTCGTGGGAAGCAGCCTGG + Intergenic
1116385941 14:44330001-44330023 TGGGCTGCTGGGTGGCAGCAAGG + Intergenic
1117046194 14:51816074-51816096 CGGGCAGGTAGTAGGGAGCGTGG + Intergenic
1117986006 14:61386740-61386762 AGTGCTGGTGGGAGGCAGGGAGG + Intronic
1118750812 14:68806869-68806891 GGGACTGGTGGGAGGGAGGGTGG + Intergenic
1119029393 14:71179826-71179848 TGGGCTGGTGGCAGGAAGCAAGG + Intergenic
1119406186 14:74401213-74401235 AGGGCTGGGGTGAGGCAGCAGGG - Intergenic
1119480872 14:74956824-74956846 GGGGCTGGTGGGTGGCTGTGGGG + Intergenic
1119646157 14:76350072-76350094 CAGGTTGGTGGGTGGCAGCAAGG - Intronic
1119825096 14:77651151-77651173 CAGGGTACTGGGAGGCAGCGGGG - Intergenic
1121473497 14:94174382-94174404 CCTGCTGGTGGGCGGCCGCGGGG + Exonic
1121617017 14:95319993-95320015 CGGGCTGGCGCGAGCGAGCGCGG + Intergenic
1122073068 14:99217793-99217815 CGGGGTGGTGGCAGGCGGCGGGG - Intronic
1122296631 14:100709575-100709597 CGGGCTGTGCGGAGGCAGCCGGG + Intergenic
1122306699 14:100771008-100771030 AGGTTTGGTGGGAGGCAGTGAGG + Intergenic
1122438770 14:101716215-101716237 AGGGCCGGTGGGGGGCAGCATGG + Intergenic
1122487404 14:102090264-102090286 TGGCCTGGTGGGAGGCAGGTGGG - Intronic
1122736575 14:103847190-103847212 CGGGCCGGTGCGAGGCCGGGCGG - Intronic
1122768186 14:104085587-104085609 CGGGAGGGTGGGAGGCCCCGCGG - Intergenic
1202921535 14_KI270723v1_random:33445-33467 GGGGCGGGTGGGAGGGAGCTGGG + Intergenic
1124693155 15:31842562-31842584 GGGGCTGGTGGGGGACAGAGAGG + Intronic
1124922201 15:34038544-34038566 CGGGCTGGCGCGAGACAGTGGGG - Intronic
1124960759 15:34392174-34392196 CGGGGGGGTGGGGGGCGGCGAGG - Intronic
1124967656 15:34448443-34448465 CCGGGTGGAGGGAGGCAGGGCGG + Intergenic
1124977388 15:34538395-34538417 CGGGGGGGTGGGGGGCGGCGAGG - Intronic
1126067423 15:44836946-44836968 GGGGGTGGTGGGTGGCAGCTGGG - Intergenic
1126092454 15:45063935-45063957 GGGGGTGGTGGGTGGCAGCTGGG + Intronic
1128220586 15:65965546-65965568 GGGGCTGGAGGGAGCCAGTGAGG + Intronic
1128234337 15:66057255-66057277 TTGGCTGGTGGCAGGCAGCTTGG + Intronic
1128317539 15:66670544-66670566 AGGGGTGGTGGGAGGCAGGCGGG + Intronic
1128335137 15:66780936-66780958 TGGGGAGGTGGGAGGCACCGAGG - Intronic
1128678475 15:69628976-69628998 CTGGCAGGTGCGAGGCAGAGTGG + Intergenic
1128740713 15:70082095-70082117 CTGGCTGCTGGGAGGCTGCTGGG - Intronic
1129232824 15:74206193-74206215 GGGGCAGGTGGGAGGCAATGGGG - Intronic
1129409280 15:75339926-75339948 TGGGCAGGTGGGAGGCAGTCAGG - Intronic
1129424982 15:75456034-75456056 CGGACTGGGGGGAGGCCGCCTGG + Intergenic
1129472332 15:75762650-75762672 AGGGTTGGTGGGAGGCAGCTGGG - Intergenic
1129672259 15:77613885-77613907 AGGGCTGGCGGGGGGCAGCAGGG + Exonic
1129750541 15:78059764-78059786 AGAGCTGGTGGGAGGCTGAGGGG - Intronic
1130051135 15:80484828-80484850 AGGGGTGTAGGGAGGCAGCGGGG + Intronic
1130927308 15:88395399-88395421 CGGGCTGGTTGTGGGGAGCGTGG + Intergenic
1131109838 15:89758370-89758392 CTGGCTGGTGGGAGGCGGCAGGG - Intergenic
1131177593 15:90219774-90219796 CGCGCTGGGGGGAAGGAGCGAGG - Exonic
1131653389 15:94427476-94427498 GGGGCTGGAGGGAGACAGCAAGG + Intronic
1132287038 15:100670918-100670940 AGGGCTGGGGTGAGGCAGCCCGG - Intergenic
1132588793 16:717406-717428 GGGGCTGGTAGGAGGGAGGGTGG + Exonic
1132806342 16:1776853-1776875 AGGTCTTGTGGGAGGCTGCGAGG - Exonic
1132810223 16:1793666-1793688 CAGGCTGCAGGCAGGCAGCGAGG + Exonic
1133058290 16:3158400-3158422 TGGCCTGCTGGGAGGCGGCGGGG + Intergenic
1134135648 16:11674787-11674809 TGGGCAGGTGGGAGGCAGGGAGG - Intronic
1134411158 16:14004067-14004089 AGGACTGGTGGGAGGCAGGCAGG + Intergenic
1136372432 16:29844751-29844773 CGGGCTGGTGGTCAGCAGTGTGG + Exonic
1136683607 16:31981749-31981771 GGGGCTCCTGGTAGGCAGCGTGG + Intergenic
1137561461 16:49504995-49505017 AGGGCAGGTGGGAGGCAGGAAGG + Intronic
1138220652 16:55247555-55247577 CAGTCTGGTGGGATGCAGCTCGG - Intergenic
1138370734 16:56524525-56524547 AGGCCTGGAGGGAGGCAGCGTGG + Intergenic
1138389926 16:56662884-56662906 GGGGCAGGTGGGAGGCATGGTGG + Intronic
1138679520 16:58674936-58674958 AGGGCTGCTGGGAGTCATCGAGG - Intronic
1139361278 16:66401726-66401748 AGGGTTGCCGGGAGGCAGCGTGG + Intronic
1139375719 16:66495291-66495313 AGGGAGGGTGGGAGGCAGGGAGG - Intronic
1139797845 16:69497623-69497645 GGGGCTGGTGGGAGGAGGAGGGG - Intergenic
1139890575 16:70251210-70251232 CGGGCTGCTGGGCAGCGGCGAGG - Exonic
1141096582 16:81167414-81167436 AGGGCTTCTGGGAGGCAGTGTGG - Intergenic
1141558108 16:84849292-84849314 CGGGCAGGTAGGAGGGAGGGAGG - Intronic
1141651243 16:85394195-85394217 CTGGAGGGTGGGAGGCAGCCGGG + Intergenic
1142034428 16:87854799-87854821 CAGCCAGGTGGGAGGCAGCCAGG - Intronic
1142156442 16:88534673-88534695 CGGGCTGCGGGGAGGCGGCGGGG - Exonic
1142173414 16:88634389-88634411 CGGGCGGGTCAGAGGCAGCGCGG - Intergenic
1142194311 16:88732575-88732597 AGGGCTGGTGGGCGGCTGGGCGG - Intronic
1142196027 16:88739697-88739719 GGGGCTGCTGGGAGGCTCCGAGG + Intronic
1142228682 16:88889333-88889355 GGGGGTGGTGGGAGGGAGGGAGG + Intronic
1142228705 16:88889402-88889424 GGGGCGGGAGGGAGGGAGCGAGG + Intronic
1142356225 16:89603473-89603495 GGGGCTGGAGGGAGGCACTGGGG + Intergenic
1142356392 16:89603875-89603897 GGGGCTGGAGGGAAGCAGTGGGG + Intergenic
1142418187 16:89954380-89954402 GGTGCTGGTGGGAGTCAGGGTGG + Intronic
1142449888 16:90168445-90168467 CGGGCTGCTGGGAGGCAGGCAGG - Intergenic
1142450490 16:90170775-90170797 CGGGCTGCTGGGAGGTAGGCAGG + Intergenic
1203086893 16_KI270728v1_random:1189315-1189337 GGGGCTCCTGGTAGGCAGCGTGG + Intergenic
1142457072 17:62916-62938 CGGGCTGCTGGGAGGTAGGCAGG - Intergenic
1142457198 17:63401-63423 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
1142613835 17:1123962-1123984 GGGGCAGGTGGGAGGCAAGGGGG - Intronic
1142614249 17:1125571-1125593 GGGGCTGCTGGGAGGCGGGGAGG + Intronic
1143478426 17:7215903-7215925 TGGGCGGGTGGCAGGCAGCTGGG - Intronic
1143494942 17:7307487-7307509 CGGGTCGGTGGGAGGGAGGGTGG + Intronic
1143513633 17:7408554-7408576 CGGGCAGGCGGGCGGCAGGGTGG - Exonic
1143524551 17:7464470-7464492 GGGGCTGGAGGGAGGCAGACCGG + Intronic
1143539649 17:7561617-7561639 CGGGCTGAGGCGAGGCAGTGGGG - Intergenic
1143769760 17:9161182-9161204 CAGGCTGGTGGGGTGGAGCGGGG + Intronic
1144548009 17:16215537-16215559 CGGGCTGGGGGGAGGGAGAGGGG - Exonic
1144816985 17:18041188-18041210 GGGGCGGGGGGGAGGCAGTGGGG - Intronic
1144948720 17:18982742-18982764 CCCGCTGGTGCGAGGCAGAGGGG + Intronic
1145786484 17:27597203-27597225 GTGGCTGGTGGGAGGCAGGTGGG + Intronic
1145905650 17:28514748-28514770 CCGCCAGGTGGGAGGCAGCAGGG + Intronic
1145963724 17:28902567-28902589 CCGCCAGGTGAGAGGCAGCGGGG - Exonic
1146172050 17:30641935-30641957 GGGGCTGCTGGGAGCCAGAGAGG - Intergenic
1146322661 17:31859014-31859036 CGGGCTGGGCGGGGGCCGCGGGG - Intronic
1146345508 17:32057971-32057993 GGGGCTGCTGGGAGCCAGAGAGG - Intergenic
1147144525 17:38477456-38477478 GGGGCTCCTGGTAGGCAGCGTGG + Intronic
1147254878 17:39175530-39175552 CGGCCTGGTGGGTGGCTGCTGGG + Exonic
1147334148 17:39716629-39716651 CTGGGTGGAGGGGGGCAGCGAGG + Intronic
1148095691 17:45051513-45051535 CGGGCCGGTGAGAGCCAGCCGGG - Intronic
1148440393 17:47708977-47708999 CGGGCAGCTGGGGGGCACCGGGG - Exonic
1148862694 17:50612825-50612847 CATCCTGGTGGGAGGCAGGGAGG + Intronic
1148866030 17:50629149-50629171 TGGGCTGGTGGTCGGGAGCGGGG - Intergenic
1149439202 17:56661345-56661367 TGGGGAGGTGGGAGGCAGTGAGG - Intergenic
1149597891 17:57874844-57874866 CGGGCGGGTGGCCGGCGGCGGGG + Intronic
1149727278 17:58909240-58909262 CGGGGTGGTGAGCGGCAGTGGGG - Intronic
1149853047 17:60052840-60052862 GGGGCTGGTGAGGGGCGGCGGGG + Intronic
1149863826 17:60139484-60139506 CGGGCTGTTCGAGGGCAGCGGGG - Intergenic
1149993330 17:61394713-61394735 GAGGCCGGTGGGAGCCAGCGTGG + Intergenic
1150136285 17:62697055-62697077 CAGGCTGGAGGGAGGGAGGGCGG + Intergenic
1151352700 17:73541169-73541191 CTGGCTGGGGAGAGGCAGCTGGG + Intronic
1151657602 17:75502993-75503015 CGGGCAGGTGGGAGGGGGAGTGG + Exonic
1152205806 17:78973891-78973913 CGTGCAGGTGGGAGGGAGCTGGG - Intronic
1152614429 17:81331306-81331328 CGGGGTGGTGGGGAGGAGCGGGG - Intergenic
1152714266 17:81891151-81891173 GGGGGTGGTGGGCGGGAGCGAGG - Intronic
1152750250 17:82059262-82059284 TGGCCTGGTGGGGGGCAGTGTGG + Intronic
1152751168 17:82063080-82063102 CGGGAGGCTGGGAGGCAGCCCGG + Intronic
1152783134 17:82235267-82235289 AGGGCCGGTGGGAGGCAAGGGGG + Exonic
1152812801 17:82390372-82390394 CGGGCTGGTGGGCCCCATCGTGG - Intronic
1152822031 17:82442335-82442357 AGGGCTGGTGGGTGGCAGCGGGG - Exonic
1153284710 18:3447614-3447636 TTGGCTGGGGGGAGGCAGTGGGG + Intronic
1153442237 18:5133125-5133147 CGGGTTCCCGGGAGGCAGCGAGG + Intergenic
1153584989 18:6611945-6611967 GGAGATGGTGGGAGGAAGCGAGG - Intergenic
1153851851 18:9102586-9102608 GGGGCTGACGGGAGGGAGCGAGG - Intergenic
1154059147 18:11042560-11042582 CGCTGTGGTGGGAGGCAGGGTGG + Intronic
1155671751 18:28379947-28379969 AGAGCTTGTGGGAGGCAGGGTGG + Intergenic
1157134341 18:45039314-45039336 GGGGCTGGTGGGAGGCACTGTGG - Intronic
1159251829 18:65889365-65889387 TGGGCTCGTGGAAGGCAGCAAGG + Exonic
1159511241 18:69400787-69400809 CGGGCCAGGGGGAGGGAGCGGGG + Intergenic
1160156448 18:76437336-76437358 GGGGCTGCTGGGCGGCAGGGAGG + Intronic
1160646985 19:198275-198297 CGGGCTGCTGGGAGGTAGGCAGG - Intergenic
1160647557 19:200506-200528 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
1160716205 19:577949-577971 CGTGCTGGTGGTAGGTGGCGTGG - Exonic
1160859579 19:1232004-1232026 CAGGCTGGTGGGGGCCAACGAGG + Intronic
1161087004 19:2339978-2340000 CGGGCGGGTGGGCCGCGGCGTGG + Intronic
1161152538 19:2717147-2717169 CGGTGTTGGGGGAGGCAGCGGGG + Exonic
1161223979 19:3133857-3133879 TGGGCTGGTGGCTGGCAGCTTGG - Intergenic
1161611502 19:5245692-5245714 GGCACAGGTGGGAGGCAGCGTGG - Intronic
1161723267 19:5915140-5915162 CGGGCAGGTGGGTGGCTGCGCGG + Exonic
1162128812 19:8513145-8513167 GGGGCTGGAGGGATGCAGCAGGG - Exonic
1162247157 19:9410906-9410928 CGGGCTGGGGAGAGGGAGGGAGG + Intergenic
1162300551 19:9842532-9842554 CGGGCTGTGGGGTGGCAGCAGGG - Intronic
1162426885 19:10602460-10602482 CGGGCGGGCGGGAGGCTCCGCGG - Intronic
1162477372 19:10908672-10908694 CGGGCGATCGGGAGGCAGCGTGG - Intronic
1162572446 19:11481004-11481026 CGGGCCGGAGGGAGGGAGGGAGG - Exonic
1162630459 19:11923563-11923585 CAGGCTGGTGGGAGAGAGGGTGG - Intergenic
1163034271 19:14562377-14562399 AGGGCTGGTGGCAGGCGGCATGG + Intronic
1163546338 19:17943316-17943338 CGTGCTGGAGGAGGGCAGCGTGG + Exonic
1163586756 19:18168555-18168577 CCGTCTGGAGGGAGGCAGGGAGG + Intronic
1163673700 19:18644724-18644746 GGGGCTGCTGGGGGGCAGTGGGG + Intronic
1163785504 19:19273028-19273050 TGGGCTGGAGGGAGGATGCGCGG - Intronic
1164754996 19:30682682-30682704 CGGGCTGAGGGGAGGCAGAGAGG - Intronic
1165065852 19:33227190-33227212 CGTGCTGGTGGGACGCCGAGGGG + Intergenic
1165333679 19:35154956-35154978 CGGGCGGGAGCGAGGCAGAGCGG - Exonic
1165349505 19:35268473-35268495 CGCGCTGGGGGGAGGCGGCCCGG - Intergenic
1165729543 19:38135927-38135949 CGGCCTGGCTGGTGGCAGCGAGG - Intronic
1165744734 19:38224085-38224107 CGGGCCGGCGGGAGGCGGAGAGG - Intronic
1166055438 19:40285354-40285376 GGGGCTGGGGGGAGGGGGCGGGG - Exonic
1166309864 19:41956887-41956909 CAATCTGGTGGAAGGCAGCGTGG + Exonic
1166358997 19:42244255-42244277 TGGGGTGGTGGGGGGTAGCGGGG + Intronic
1166802202 19:45465259-45465281 CTGGCTGGTGGCAGACAGAGGGG + Intronic
1166835949 19:45668172-45668194 CGGGGTGATGGGAGGGGGCGGGG - Intergenic
1168404366 19:56103088-56103110 GGGTCAGGTGGGAGGCAGCGGGG + Intronic
1168563500 19:57403594-57403616 GGGGCTGGTGGAAGGCAGGAGGG - Intronic
925017622 2:543738-543760 CTGGAGGGTGGGAGGCAGGGAGG + Intergenic
925017636 2:543776-543798 CTGGAGGGTGGGAGGCAGGGAGG + Intergenic
925017668 2:543868-543890 CGGGAAGGTGGGAGGCAAGGAGG + Intergenic
925017677 2:543891-543913 CGGGAAGGTGGGAGGCAGGGAGG + Intergenic
925017684 2:543914-543936 CAGGATGATGGGAGGCAGGGAGG + Intergenic
925411739 2:3643561-3643583 CTGGGAGGTGGGAGGGAGCGAGG - Intronic
925910005 2:8567629-8567651 CAGGCTTATGGGAGGCAGCCTGG - Intergenic
926136903 2:10342889-10342911 GGGGCCGGGGGAAGGCAGCGGGG - Intronic
927861148 2:26561053-26561075 CAGGCAGGTGGAAGGCAGGGTGG + Intergenic
927884807 2:26711862-26711884 GGGGCTGGGGGGAGGGAGCAGGG + Intronic
928149139 2:28810691-28810713 CGGGCGGGCGGGGGGCAGGGAGG + Intronic
928368694 2:30723107-30723129 CAGGCTGTTGGGAGACAGCTTGG + Exonic
929501563 2:42494571-42494593 CGGGCTGGCAGGCGGCACCGAGG - Exonic
929916237 2:46138370-46138392 ATGGCTGGTAAGAGGCAGCGTGG - Intronic
930136073 2:47905460-47905482 CGGGCGGTTGGGAGGTAGCGCGG + Intronic
931440677 2:62288041-62288063 GGGGCTGGTGGCAGGGAGCCAGG + Intergenic
931941305 2:67254780-67254802 GGTCCTCGTGGGAGGCAGCGTGG + Intergenic
932459383 2:71872599-71872621 GGGGCTGGTGTCAGGCAGGGCGG + Intergenic
932498038 2:72157017-72157039 GGGGCAGGTGGTAGGGAGCGAGG + Intergenic
932571079 2:72938690-72938712 AGGGCTGGCTGCAGGCAGCGTGG - Intergenic
932702248 2:73999975-73999997 AGGGCTGCTGGAAGGCAGGGTGG + Intronic
933727204 2:85433720-85433742 GGGGGTGGTGAGAGGCAGCAAGG - Intronic
933729171 2:85444513-85444535 AGGGCTGGTGGGGGGCATCGGGG - Intergenic
933752421 2:85611635-85611657 CGGGCTGGAGGCAGGCGGGGCGG + Intronic
933779843 2:85794049-85794071 AGGGCTGGGGGGAGGCAGGGAGG - Intergenic
934614406 2:95762384-95762406 GGTGCTGGTGCCAGGCAGCGGGG + Intergenic
934993245 2:98936074-98936096 CGGGCTGTCTGGAGGCCGCGCGG - Exonic
935706498 2:105861920-105861942 CGGGCAGGAGGGAGGGAGGGAGG - Intronic
937236985 2:120437029-120437051 AGGGCTGGGGGAAGGCAGCAGGG + Intergenic
937249961 2:120517392-120517414 ACAGCTGGTGGGAGGCAGCATGG - Intergenic
937335435 2:121059484-121059506 AGGGCTGGGGGGCGGCAGAGGGG + Intergenic
937900781 2:127017487-127017509 CGGGGTGGTGGGAGGCGAGGTGG - Intergenic
938104248 2:128519569-128519591 AGGACTGGTGGGAGGCAAGGGGG - Intergenic
938536317 2:132252528-132252550 CGGGCGGGTGGGGGGCAGGCAGG + Intronic
938540501 2:132280499-132280521 GGGGCTTGGGGGGGGCAGCGGGG + Intergenic
939629701 2:144516992-144517014 GGGGCTCGAGGGGGGCAGCGGGG + Intronic
940207039 2:151214264-151214286 GAGGCTGGTGGGAGGCAGGTGGG + Intergenic
941808609 2:169734119-169734141 CGGCCTGCTGGGAGCGAGCGGGG + Intronic
942246476 2:174013124-174013146 CGGGAGGTTGGGACGCAGCGGGG - Intergenic
942451280 2:176109180-176109202 CAGGCTGGTGGGAAGGAGGGTGG - Exonic
943220959 2:185105339-185105361 CAGGCTGCTGGGAGGAAGGGGGG - Intergenic
944412601 2:199458340-199458362 GGGGCGGGTGGGAGGCAGGGAGG + Intronic
944927622 2:204480957-204480979 CTGTCTGGTGGGAGGAAGCCTGG + Intergenic
945387013 2:209213677-209213699 CTGGCAGGTGGGGGGCAGTGAGG - Intergenic
945989299 2:216380300-216380322 CAGGCTGGCGGTAGGCAGCAGGG - Intergenic
946022573 2:216651228-216651250 CATGCTGGTGGGAGGGAGGGAGG - Intronic
946056808 2:216909985-216910007 AGGGATGGTGGGAGGCAGACTGG - Intergenic
946061987 2:216950383-216950405 CAGGCTGGAGGGGGGCAGCCTGG + Intergenic
946430988 2:219627437-219627459 CGGGCAGGTGGGGTGCTGCGGGG + Intronic
946908929 2:224442217-224442239 CGGGTTGGCGGGGGGCGGCGCGG - Intergenic
948867238 2:240782337-240782359 GGGGCTGCTGGGAGACACCGAGG - Intronic
948991836 2:241559412-241559434 CCGGGTGGAGGGAGGCGGCGCGG - Intronic
949042199 2:241854579-241854601 AGGGCTCCTGGGAGGCAGCCTGG + Intronic
1168803854 20:661815-661837 AGGGATGGTGGGAGGGAGAGGGG - Exonic
1168803946 20:662134-662156 CGGGCGGGTGGCTGGCAGCCCGG + Exonic
1168856647 20:1013569-1013591 GGGGCTGCAGGGAGGCAGTGAGG - Intergenic
1169149707 20:3279774-3279796 CAGGCAGCTGGGAGGCAGCAGGG + Intronic
1170950743 20:20933713-20933735 AGGGAAGGTGGGAGGCAGCGAGG + Intergenic
1171204278 20:23266948-23266970 AGGGGCGGTGGGAGGCAGAGAGG + Intergenic
1171430681 20:25081722-25081744 CGGACGGCTGGGAGCCAGCGGGG + Exonic
1172105909 20:32517281-32517303 CAGGAAGGTGGGAGGGAGCGGGG - Intronic
1172277182 20:33686112-33686134 GGGGCCGGTGGGAGCCGGCGGGG + Exonic
1172753477 20:37267681-37267703 CGGGCTGCTTGGTGGCAGCCTGG + Intergenic
1172989734 20:39025434-39025456 TGGGCTGGTGCGAGGCAGTGTGG + Intronic
1173026347 20:39310831-39310853 CGGGCTGCTGGGAGGCCTCCTGG + Intergenic
1174017726 20:47502189-47502211 CGGGCTGAGGGGAAGCGGCGCGG - Intronic
1174200689 20:48804574-48804596 GGGTGAGGTGGGAGGCAGCGGGG + Intronic
1174529424 20:51199240-51199262 CGGGTGGGTGGGAGCCAGGGGGG + Intergenic
1174612197 20:51807142-51807164 GGGGCTGGAGGGAGGGAGAGTGG + Intergenic
1175063252 20:56263157-56263179 TGGGCTTGGGGGAGGCAGCAGGG + Intergenic
1175268926 20:57720162-57720184 TGGGCTGGTGGGGGGCAGTGCGG + Intergenic
1175400029 20:58694639-58694661 CGGGCAGGTGGGAGGGAGGTCGG + Intronic
1175712209 20:61230409-61230431 TGGGCTGGTGGCAGGGAGGGAGG - Intergenic
1175828758 20:61950945-61950967 AGGGCTGGTGGGAGGGAGGGTGG - Intergenic
1175946227 20:62560117-62560139 CAGGCTGGGGGGAGGCAGGGCGG - Intronic
1175988142 20:62774519-62774541 TGGGCTGGCGGGAGGCATGGAGG + Intergenic
1176008923 20:62881297-62881319 CTGGCTGGCGGGGGGCAGTGAGG + Exonic
1176030091 20:63007555-63007577 CGGGAAGGTGGAGGGCAGCGCGG + Intergenic
1176031951 20:63017072-63017094 CTGGCTGCCGGGAGGCAGCAAGG + Intergenic
1176080742 20:63272201-63272223 GGCCCTGGTGGGAGGCGGCGGGG - Intronic
1176109493 20:63404945-63404967 CGGGCTGGGGGTAGGCAGAGAGG + Intergenic
1176143885 20:63557006-63557028 GGGGATGGTGGGAGGCATCACGG - Intergenic
1177046893 21:16182535-16182557 AGGGATGGAGGGAGGCAGGGAGG - Intergenic
1178742952 21:35220219-35220241 GGGCCTGTTGGGAGGCAGGGTGG + Intronic
1178958115 21:37041649-37041671 GGGGATGGTGGGTGGCAGTGAGG - Intergenic
1179907951 21:44433929-44433951 GGGGCTGGGTGGAGGCAGGGAGG + Intronic
1180027109 21:45172223-45172245 CGGGGTGGTGGAAGGCCGCTGGG + Intronic
1180096246 21:45556403-45556425 GGCGCTGGTGGGGAGCAGCGGGG - Intergenic
1180225870 21:46391933-46391955 CAGGCACGTGGGAGGCAGAGGGG + Intronic
1181126397 22:20704273-20704295 CGGGCAGGTGGGCGGCGGCTCGG - Intergenic
1181166627 22:20987468-20987490 AGGGGTGGTGAGAGTCAGCGGGG - Intronic
1181239728 22:21469579-21469601 CGGGCAGGTGGGCGGCAACTCGG - Intergenic
1181531690 22:23520998-23521020 GTGGCTGGTGGGAGTCAGTGGGG - Intergenic
1181643093 22:24215087-24215109 CGGGGTGCTGGGAGGCTGCCTGG - Intergenic
1182087770 22:27573467-27573489 CGGGGCGGGGGGCGGCAGCGGGG - Intergenic
1182355253 22:29719928-29719950 CGGGCTGGGGGTGGGGAGCGCGG + Intergenic
1182557842 22:31138647-31138669 CAGGTTGGTGGCAGGCAGCGAGG - Exonic
1182714071 22:32341057-32341079 TGAGATGGTAGGAGGCAGCGGGG + Intergenic
1183086274 22:35489225-35489247 CGGGCTGCTGTGAGGCACTGAGG + Intergenic
1183105261 22:35610847-35610869 TGGGCAGGTGGGAGGATGCGGGG - Intronic
1183429120 22:37755211-37755233 GGGGCTGGTGGTGGGCAGCATGG + Intronic
1183429874 22:37759088-37759110 AGGGCTGGTGGAAGGCAGTGAGG - Intronic
1183667589 22:39254439-39254461 AGGCCTGGTGGGGGGCAGCAGGG + Intergenic
1183729639 22:39610792-39610814 CAGGGTGGTGGCAGGCAGCTCGG + Intronic
1184086905 22:42270707-42270729 CGGGCGGGCGGGAGGGCGCGCGG + Intronic
1184288063 22:43483238-43483260 CGTTCTGGTGGGAGGCAAGGTGG - Intronic
1184401390 22:44276644-44276666 GGAGATGGTGGGAGGCAGCGGGG + Intronic
1184468687 22:44683578-44683600 GGGGCTGGGGGGAGCCAGCCAGG + Intronic
1184778755 22:46635785-46635807 CGGGGGGGTGGGGGGCAGGGAGG - Intronic
1184852936 22:47131158-47131180 GGGCCTGGTGGGAGGCATCTGGG - Intronic
1185035579 22:48475045-48475067 CCGGCCTGTGGGAGGCAGAGGGG - Intergenic
1185288740 22:50013844-50013866 CGGGGTGGTGGGAGGGAGGGAGG - Intergenic
1185382945 22:50518504-50518526 TGGGCTGGGGGGAGACAGCAGGG - Intronic
950012061 3:9731225-9731247 GGGGCTTGTGGGAGGGGGCGGGG - Intergenic
950123594 3:10497935-10497957 CAGGCTGGTGGGAAGAAGCCAGG - Intronic
950421686 3:12903361-12903383 CGGGCAGCTGGGAGGAAGCGGGG - Intronic
950576996 3:13837970-13837992 GGGGCTGTTGCGGGGCAGCGTGG - Intronic
950694257 3:14685667-14685689 GGGACTGGAGGGTGGCAGCGGGG - Intronic
953399551 3:42600872-42600894 CGGGCCGGCGTGAGGCACCGTGG + Intronic
953571937 3:44078176-44078198 GGGGCTGGAGGGAGGCAGTTAGG - Intergenic
953982056 3:47417978-47418000 CGGGGTGGTGGGAGGGGGTGCGG + Intronic
954368302 3:50157379-50157401 AAGGCTGGTGGGAGGGAGCAAGG - Intronic
954717471 3:52533761-52533783 CGGGCTGGCCGAGGGCAGCGCGG - Exonic
954909105 3:54088049-54088071 CGGGCCCCTGGGCGGCAGCGTGG + Intergenic
955725065 3:61924321-61924343 TGGGCTGGTGGTAGGCAGGATGG - Intronic
955866156 3:63386754-63386776 CAGCCTGGTGGGAGCCAGTGAGG + Intronic
955996572 3:64685825-64685847 CGGGATAGTGGGAGACAGCCTGG - Intronic
956299470 3:67754522-67754544 CGGGGTGGTGGGAGGGTGTGTGG + Intergenic
958718800 3:97820940-97820962 AGGGCTTCTGGGAGGCAGCGTGG + Intergenic
961816786 3:129555258-129555280 GGGGCTGGAGGGGGGCAGCTGGG - Exonic
963732642 3:148987677-148987699 CGGGCTGGCGGGCGGCCGGGTGG - Intergenic
964403188 3:156320622-156320644 TGGCATGGTGGGAGGCAGAGGGG + Intronic
966419995 3:179727695-179727717 CGGGGTGGTGCCAGGCAGAGGGG + Intronic
966912813 3:184568944-184568966 CGGGAAGGAGGGAGGGAGCGAGG - Intronic
967039027 3:185672546-185672568 AGGGGTGGTAGGGGGCAGCGGGG + Exonic
967054335 3:185815753-185815775 GGTGCTGGTGGGAGGGAGAGAGG - Intronic
967970240 3:194994148-194994170 GGGGCAGCTGGGAGGCAGCGAGG - Intergenic
968370285 3:198219607-198219629 CGGGCTGCTGGGAGGCAGGCAGG - Intergenic
968370697 3:198221248-198221270 CGGGCTGCTGGGAGGTAGGCAGG + Intergenic
968426314 4:525858-525880 CGGGCTGCTGGGAGGTTGTGCGG + Intronic
968489625 4:883080-883102 CTGGCTGGTGGGAAGCAGTGAGG + Intronic
968613843 4:1568677-1568699 GGGGTGGGTGGGAGGCGGCGCGG - Intergenic
968613854 4:1568702-1568724 GGGGTGGGTGGGAGGCGGCGCGG - Intergenic
968613887 4:1568779-1568801 GGCGCGGGTGGGAGGCGGCGCGG - Intergenic
968672111 4:1857225-1857247 CGGTCTGCTGGGAGGCTGCACGG - Intergenic
968716710 4:2165411-2165433 GGGGCTGGTGGGAGGGAGGGAGG + Intronic
968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG + Exonic
968914649 4:3492156-3492178 CTGGCAGGCGGGAGGCAGCCTGG + Intronic
969235908 4:5864954-5864976 TGGGCTGGGGGGAGGCAGGGAGG + Intronic
969277438 4:6146224-6146246 GGGGCTGGGGGGAGGTTGCGGGG + Intronic
969537415 4:7765222-7765244 TGGCCTGTTGGGAGGCAGCAGGG - Intronic
969637634 4:8378481-8378503 CAGGCTGGAGGCAGGCTGCGGGG + Intronic
969637658 4:8378577-8378599 CAGGCTGGAGGCAGGCTGCGGGG + Intronic
970456190 4:16226479-16226501 GAGGCTGGAGGGAGGCGGCGGGG - Exonic
971345759 4:25810368-25810390 TGGGCTGGTGAGAGGCTGCAGGG - Intronic
972543233 4:40057037-40057059 GCGGCGGGTGGGAGGCAGGGAGG + Intronic
973895652 4:55410075-55410097 AAGGCTGGTGGGAGGCAAGGAGG - Intronic
977566596 4:98587000-98587022 CCGGCAGTTGGGAGGCAGGGTGG + Intronic
977809704 4:101346070-101346092 CTGGCTGGAGGGTGGCCGCGGGG - Intronic
980256625 4:130388623-130388645 CGGGAGGGTGGGAGGGAGGGAGG - Intergenic
981937793 4:150253564-150253586 CGCGCTGGTCGGACGCAGCGTGG - Intronic
982063238 4:151625344-151625366 CAGGCAGGTGGCAGGCAGTGGGG - Intronic
984767007 4:183407301-183407323 CGGGGTGGCGGGGCGCAGCGCGG + Intergenic
984841289 4:184070074-184070096 GGGCCTGGTGGGAGGCAACTGGG + Intergenic
984946431 4:184972198-184972220 GGGGCTGGAGGGAGGGAGAGAGG - Intergenic
985783073 5:1881052-1881074 CGGGCCGGTGGGGGGGGGCGGGG + Intronic
985889185 5:2702312-2702334 CGGGCTGGTGGGGCTCGGCGGGG - Intergenic
985995656 5:3595740-3595762 AGGGCGGGCGGGAGGCAGGGAGG + Intergenic
985996918 5:3602231-3602253 CGGGCAGCGGGGAGGCAGCTGGG + Intergenic
986195766 5:5535390-5535412 TGGGGTGGTGGGAGGCAGGGAGG + Intergenic
987089289 5:14497118-14497140 GGGGCTGGTGGGTGGGAGGGAGG - Intronic
990852281 5:60220136-60220158 CAGGCTTGTGGGTGGCAGTGGGG + Intronic
991584204 5:68186160-68186182 GGGGCTGGCGGCAGGGAGCGTGG - Intergenic
992249941 5:74866491-74866513 GGGGCTGGAGGGAGGCAGGGCGG - Intronic
992551767 5:77866276-77866298 CGGGTGGGAGGGAGGCAGGGTGG + Intronic
992591056 5:78295738-78295760 CGGGCTGGGGGAAGGCACCCCGG - Intergenic
995244708 5:109922538-109922560 GGGGCTGGGGGGAGGCTGTGGGG + Intergenic
996023604 5:118618954-118618976 AGGGCTGGTGGAAGGCAGAAAGG - Intergenic
996166147 5:120226428-120226450 AGGGATGGAGGGAGGCAGAGAGG - Intergenic
996738314 5:126777083-126777105 CGGGCTGGAGGCAAGCCGCGGGG - Intronic
997361720 5:133299470-133299492 CTGGCAGGTGGGAGGCAGGGAGG + Intronic
998018417 5:138751259-138751281 GGGGCTGGTGGGAGGCATTTGGG - Intronic
998140601 5:139697534-139697556 CTGGCTGGTGGGGGGCGGAGTGG + Intergenic
998849319 5:146338751-146338773 CTGGCGGGTTGGAGCCAGCGGGG + Intronic
999458821 5:151740328-151740350 CGGGCTGGCTGGCTGCAGCGAGG + Intergenic
999868603 5:155728194-155728216 GGGGCTGGAGGGAGGGAGCGAGG - Intergenic
1000379380 5:160615227-160615249 CGGGCTGGGGGGAAACAGAGTGG - Intronic
1001382297 5:171312483-171312505 CTGGGGGGTGGGAGGCAGGGTGG + Intergenic
1001496072 5:172188369-172188391 CGGGCCGGTGGGCGGGCGCGGGG - Exonic
1001688709 5:173616290-173616312 CGGGTCGCCGGGAGGCAGCGAGG + Exonic
1002196291 5:177503473-177503495 CGAGCTGGGAGGAGGCAGTGGGG - Intronic
1002212179 5:177605607-177605629 GGGGATGGTGGGAGTCAGCCCGG - Intronic
1002401750 5:178994957-178994979 CGGGCTGCGGGGAGACAGAGGGG + Exonic
1002431410 5:179206413-179206435 CGGGCTAGAGGCAGGCAGCAGGG - Intronic
1002445186 5:179286360-179286382 TGGGCTGGTTGGAGGAAGGGAGG - Intronic
1002565915 5:180113002-180113024 CGGGCTGGACGGAGGGACCGGGG + Intronic
1002565938 5:180113059-180113081 CGGGCTGGACGGAGGGACCGGGG + Intronic
1002566186 5:180113725-180113747 CGGGCTGGACGGAGGGACCGGGG + Intronic
1002646510 5:180659183-180659205 CGGGGTGGGGGGTGGCGGCGGGG - Intergenic
1002729817 5:181326367-181326389 CGGGCTGCTGGGAGGCAGGCAGG - Intergenic
1002729930 5:181326803-181326825 CGGGCTGCTGGGAGGTAGGCAGG + Intergenic
1002794690 6:463122-463144 AAGGGTGGTGGGAGGCAGGGAGG + Intergenic
1002805860 6:573387-573409 GAGGCAGGTGGGAGGCAGCAGGG - Intronic
1002912879 6:1504629-1504651 CGGCCTCTTGGCAGGCAGCGTGG - Intergenic
1002981700 6:2144364-2144386 CAGGCTGGTGAGAGGCAGAGTGG + Intronic
1003130977 6:3394992-3395014 CGGGCAGGTATGAGGCAGGGAGG + Intronic
1003544966 6:7051681-7051703 CTGGCTGGTGTGGGGCTGCGGGG + Intergenic
1003869363 6:10390081-10390103 AGGGCTGATGGGAGCCAGCGAGG + Intergenic
1003869658 6:10391398-10391420 CTGCCTGGGAGGAGGCAGCGCGG - Intergenic
1004174545 6:13328430-13328452 CGGGAAGGAGGGAGGCGGCGGGG + Intronic
1005450050 6:25963386-25963408 CGGGCGGGGGGGAGGGATCGGGG + Intronic
1006153530 6:32001887-32001909 AGGGCTGGGGGGAGACAGGGAGG + Intronic
1006159838 6:32034624-32034646 AGGGCTGGGGGGAGACAGGGAGG + Intronic
1006174870 6:32115759-32115781 GGGGCTGGTGGGAGGCCTGGTGG + Exonic
1006393326 6:33771633-33771655 AGGGCCGGTGGGCGGCGGCGCGG + Exonic
1006437327 6:34032847-34032869 TGGGCTGCTGGCAGGCAGCCAGG + Intronic
1006547500 6:34792064-34792086 CGCGCTGGTGGGTGGGATCGTGG + Exonic
1006547579 6:34792378-34792400 CGGGCTGGAGAGAGGCAGACTGG - Intronic
1006632003 6:35436567-35436589 CCTGCTGGTGGGAGGCATGGAGG - Intergenic
1006640214 6:35485809-35485831 CGGGCTGCTGGGAGGAATAGGGG + Intronic
1006984274 6:38166974-38166996 CGGGCCGGTGTGAGGCGGTGAGG - Intergenic
1007072700 6:39048756-39048778 CGGGCTGGTGGCGGGCGGTGGGG - Intergenic
1009833813 6:68971952-68971974 CCCGCTGGTGGGAGGCAGGATGG + Intronic
1015390715 6:132678446-132678468 GGGTCTGGTGGGAGGCATCTGGG - Intergenic
1015444098 6:133283813-133283835 TGGGCAGGTGGGAGGGAGTGAGG - Intronic
1017470556 6:154733803-154733825 CGGGCTGCTGCGTGGCCGCGAGG - Intronic
1018089020 6:160329517-160329539 TGGGGTGGTGGGAGGCAGGCTGG + Intergenic
1018769233 6:166957051-166957073 CGAGGTGGCGGGAGGCTGCGGGG - Intronic
1018978197 6:168581772-168581794 GGGGCTGCAGGGAGGCAGCGGGG - Intronic
1019441510 7:1049904-1049926 CTGGCTGGTGGGAGGCAATCAGG - Intronic
1019475559 7:1242480-1242502 CGGGCTGCGGGGAGCGAGCGCGG + Intergenic
1019477277 7:1249953-1249975 AGGGACGGAGGGAGGCAGCGCGG + Intergenic
1019516554 7:1442689-1442711 CGAGCTGCAGGGAGGCAGAGGGG - Intronic
1019817802 7:3213934-3213956 CAGGCTCCTGGGAGGCAGCGTGG - Intergenic
1019905087 7:4056720-4056742 CGGGCGTGTGGGGTGCAGCGTGG - Intronic
1020080343 7:5283160-5283182 CGGGCGGGCGGGAGGGGGCGGGG - Intronic
1020278288 7:6637463-6637485 GGGGCCGGTGGGCGGCGGCGCGG + Intronic
1021692930 7:23247883-23247905 CGGGCTGCTAGGAGGACGCGCGG - Intronic
1022319947 7:29278935-29278957 AGGCCTGGGGGGAGGCAGCAAGG - Intronic
1023067150 7:36389667-36389689 CGGGGTGGAGGCGGGCAGCGGGG - Intronic
1023109874 7:36798999-36799021 ATGGCTGGTGAGAGGCAGTGAGG + Intergenic
1023991795 7:45133014-45133036 GTGGCTGGTGGGGGGCAGTGGGG + Intergenic
1024074485 7:45811620-45811642 CGGGCTGCCGGGAGGCAGGCAGG - Intergenic
1024074816 7:45812978-45813000 CGGGCTGCCGGGAGGCAGGCAGG - Intergenic
1024260934 7:47573363-47573385 CGGGCTGGTGGGAGGCAGCGTGG - Intronic
1024299141 7:47873149-47873171 GGGGCCGGTGGGAGGAAGCTGGG + Intronic
1024648591 7:51387627-51387649 CGGGCTGCCGGGAGGCAGGCAGG + Intergenic
1024983947 7:55180050-55180072 CAGGCTGGCGGGAGGCAGGGTGG - Intronic
1025052538 7:55742451-55742473 CGGGCTGCCGGGAGGCAGGCAGG + Intergenic
1025052923 7:55743908-55743930 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
1025129826 7:56369458-56369480 CGGGCTGCCGGGAGGCAGGCAGG + Intergenic
1025176153 7:56803472-56803494 AGGGCTGCTGGGAGGCAGGCAGG + Intergenic
1025176429 7:56804552-56804574 CGGGCTGCCGGGAGGCAGGCAGG - Intergenic
1025178120 7:56812097-56812119 CAGGCTGCTGGGAGGCAGGCAGG + Intergenic
1025178550 7:56813836-56813858 CAGGCTGCTGGGAGGCAGGCAGG + Intergenic
1025178988 7:56815626-56815648 CAGGCTGCTGGGAGGCAGGCAGG + Intergenic
1025179444 7:56817512-56817534 CTGGCTGCTGGGAGGCAGGCAGG + Intergenic
1025179893 7:56819350-56819372 CAGGCTGCTGGGAGGCAGGCAGG + Intergenic
1025180368 7:56821332-56821354 CAGGCTGCTGGGAGGCAGGCAGG + Intergenic
1025180811 7:56823170-56823192 CAGGCTGCTGGGAGGCAGGCAGG + Exonic
1025181238 7:56824921-56824943 CAGGCTGCTGGGAGGCAGGCAGG + Intronic
1025690231 7:63750236-63750258 CAGGCTGCTGGGAGGCAGGCAGG - Intergenic
1025690679 7:63752059-63752081 CAGGCTGCTGGGAGGCAGGCAGG - Intergenic
1025691130 7:63753882-63753904 CAGGCTGCTGGGAGGCAGGCAGG - Intergenic
1025691562 7:63755658-63755680 CAGGCTGCTGGGAGGCAGGCAGG - Intergenic
1025692004 7:63757481-63757503 CAGGCTGCTGGGAGGCAGGCAGG - Exonic
1025692453 7:63759304-63759326 CAGGCTGCTGGGAGGCAGGCAGG - Intergenic
1025692897 7:63761127-63761149 CAGGCTGCTGGGAGGCAGGCAGG - Intergenic
1025693313 7:63762806-63762828 CAGGCTGCTGGGAGGCAGGCAGG - Intergenic
1025693756 7:63764629-63764651 CAGGCTGCTGGGAGGCAGGCAGG - Intergenic
1025813484 7:64889604-64889626 CGCGCTGTTGGAAAGCAGCGGGG + Intronic
1026195526 7:68170199-68170221 CGGGCTGGTGGGAGACTTGGGGG + Intergenic
1026236925 7:68535107-68535129 CGGGGTGGTGGGTGGCCGGGGGG + Intergenic
1026732763 7:72925605-72925627 CGGGCAGGTGGGCGGCGGCCAGG - Intronic
1026836712 7:73644634-73644656 CGGGCTGGGGGGAGGAAAAGAGG - Intergenic
1027111309 7:75442253-75442275 CGGGCGGGTGGGCGGCGGCCAGG + Intronic
1028762439 7:94510306-94510328 CGGGCCGGCGGAAGGCCGCGTGG - Intronic
1029421139 7:100472414-100472436 TGGGATGGAGGGAGGCAGGGAGG + Intronic
1029435699 7:100562899-100562921 CGGGTTGGTGGAAGGCAGCGGGG - Exonic
1030980669 7:116182074-116182096 GGGGGTGGGGGGAGGCAGGGAGG + Intergenic
1032051533 7:128653488-128653510 TGGGCTGCTGGGAGGCAGGCAGG - Intergenic
1032051600 7:128653727-128653749 CGGGCTGCTGGGAGGTAGGCAGG + Intergenic
1032220574 7:129991103-129991125 CTGGCAGGTGGGCAGCAGCGGGG - Intergenic
1032405409 7:131652248-131652270 AGGGCTAGCAGGAGGCAGCGAGG + Intergenic
1032551259 7:132786648-132786670 CGGGTTGGCGGGAGGCAGGTGGG - Intronic
1033366932 7:140678858-140678880 TGGGCTGGTGTGAGGCAGGCGGG + Intronic
1034264841 7:149775917-149775939 TGGGCTGCGGGGAGGCTGCGTGG + Intergenic
1034344784 7:150379488-150379510 CGGGCCGGGCGGAGGCAGCACGG - Intronic
1034684640 7:152959229-152959251 CAGGCTGGCAGGAGGCAGAGGGG - Intergenic
1035223277 7:157419160-157419182 CTGGTGGGTGGGAGGCAGGGGGG + Intergenic
1035259906 7:157654342-157654364 GGTGCTGGTGGGAGTCAGGGTGG - Intronic
1035677745 8:1467245-1467267 GGGGCTGGGGGGAGGGACCGTGG - Intergenic
1036963973 8:13276246-13276268 CTGGCAGGTGAGAGGCAGAGGGG - Intronic
1037273758 8:17156612-17156634 CGGGCTCCTGGGCGGCGGCGGGG - Exonic
1037611950 8:20483294-20483316 AGGGCAGGTGGCAGGCAGGGAGG + Intergenic
1037839233 8:22232191-22232213 CGGGCTGGTGGGAGGGGGAAAGG + Exonic
1039903298 8:41767796-41767818 CGGGGAGGCGGGAGGCAGGGAGG - Intronic
1040287086 8:46105961-46105983 CGGGCTGCAGGGACTCAGCGTGG - Intergenic
1042903047 8:73747029-73747051 CGGGCCGGCGGGAGGCGGAGTGG - Intronic
1043986973 8:86705399-86705421 CGGGTGGGTTGGGGGCAGCGGGG - Intronic
1045489386 8:102656843-102656865 CCAGCTGGTGGGAGGCAGGCTGG + Intergenic
1045738094 8:105319175-105319197 CGGGCAGGAGAGAGGCTGCGAGG + Intronic
1047615344 8:126558259-126558281 CCAGCTGGCGGGAGGAAGCGCGG - Exonic
1048319773 8:133389325-133389347 CTGGCTTGTGGGAGGCAGCAGGG - Intergenic
1048709669 8:137195219-137195241 CGGGAAGGAGGGAGGCAGGGAGG + Intergenic
1048959360 8:139563130-139563152 AGGGATGGAGGGAGGCAGCCAGG - Intergenic
1049183212 8:141234205-141234227 GGTGCTGGTGGAAGGCAGCCTGG + Intronic
1049420414 8:142513943-142513965 TGGACTGGTGGGAGGCTGGGAGG + Intronic
1049541396 8:143210761-143210783 GGGGCTTGAGGGAGGCTGCGTGG + Intergenic
1049548883 8:143247201-143247223 CGGGGTGCGGGGAGGCGGCGGGG - Exonic
1049704393 8:144033988-144034010 CGTGCTGGCGGGATGCAGCCAGG + Intronic
1049740795 8:144239970-144239992 GGAGCAGGTGGGGGGCAGCGGGG + Intronic
1049888864 9:48416-48438 TGGGTTGGTGGGAGGGAGGGAGG - Intergenic
1051170230 9:14313981-14314003 CGGGCGGGCGGGAGGGAGAGCGG + Intronic
1051228199 9:14925007-14925029 GGGACTGGTGGGAGGCAGAGAGG + Intergenic
1053180050 9:35960985-35961007 CGGGGAGGTGGGAGGCAGCTAGG + Intergenic
1054763500 9:69023879-69023901 CTGGCAGGTGGGTGGCAGAGAGG - Intergenic
1054798683 9:69325575-69325597 CGGGCGGGCGGGCAGCAGCGCGG - Intronic
1055531421 9:77187993-77188015 GGGACTGGTGGGAGGCAGTTGGG + Intronic
1056824570 9:89867916-89867938 GGGACTGGTGGGAGCCAGCCTGG + Intergenic
1057047596 9:91898070-91898092 CAGGCTTGTGGGAGTCAGAGAGG - Intronic
1057176602 9:93004776-93004798 CGGGCTGGTGGGACACAGAAGGG - Intronic
1057215948 9:93228877-93228899 CAGGGTGGTGGGAGTCAGAGGGG + Intronic
1057294031 9:93825096-93825118 CAGGCAGGTGGGGGGCAGAGAGG - Intergenic
1057869677 9:98708576-98708598 CGGGCTGCTGGGCGGCGGCCGGG + Exonic
1058687246 9:107489633-107489655 CGGGCGGGTGGGAGGGTGGGGGG + Exonic
1059145613 9:111896896-111896918 GGGTCTGGTGGGCGGCCGCGAGG + Exonic
1059368456 9:113805885-113805907 TTGGCTGGTGTGAGGCAGGGTGG - Intergenic
1059466395 9:114471458-114471480 CAGGCCGGTGAGAGGCAGTGTGG - Intronic
1060292636 9:122318497-122318519 CAGACTGGTGGAAGGCAGGGAGG + Intronic
1060667281 9:125439452-125439474 CTGGCTGGTGGGAGGCTGGATGG - Intronic
1060790287 9:126481450-126481472 CAGGCTGGGGGGTGGCAGAGGGG - Intronic
1060797619 9:126523172-126523194 CTGGCTGGTGGGAGGGAACTTGG - Intergenic
1060934141 9:127506049-127506071 CGGGCAGGAGGGAGGCAGGCTGG + Exonic
1060992057 9:127854805-127854827 TGGGATGGGGGGAGGCAGTGGGG + Intergenic
1061181751 9:129028437-129028459 CGGGCTGGTTGGCGGAAGCCGGG + Intergenic
1061248817 9:129414788-129414810 GGAGCCGGTGGGAGTCAGCGGGG + Intergenic
1061577160 9:131514315-131514337 AGGGCTGGGGGGAGCCAGGGTGG - Intronic
1061592016 9:131603802-131603824 CAGGCTGCTGGGAGCCAGCTCGG - Intronic
1061625513 9:131838748-131838770 CGTGCTGGTGTCAGCCAGCGTGG - Intergenic
1061949893 9:133930319-133930341 AAGGCTGCTGGGAGGCAGTGTGG - Intronic
1062125427 9:134858154-134858176 AGGAGTGGTGGGAGCCAGCGTGG - Intergenic
1062200825 9:135301818-135301840 CGGCCTGTTGGGCGGGAGCGTGG + Intergenic
1062291208 9:135795566-135795588 GGGACAGGTGGGAGGAAGCGGGG + Intergenic
1062399028 9:136364429-136364451 CGGGCTGGGGAGCGGCAGCCGGG - Intronic
1062754229 9:138278879-138278901 CGGGCTGCTGGGAGGCAGGCAGG - Intergenic
1062754345 9:138279317-138279339 CGGGCTGCTGGGAGGTAGGCAGG + Intergenic
1203577789 Un_KI270745v1:21636-21658 CGGGCTGCTGGGAGGCAGGCAGG - Intergenic
1203578249 Un_KI270745v1:23477-23499 CGGGCTGCTGGGAGGTAGGCAGG + Intergenic
1185819854 X:3191972-3191994 TGGGCTGGTGGGGGCCAGCATGG + Intergenic
1188270660 X:28136437-28136459 CAGGCTGGAGTGAAGCAGCGTGG + Intergenic
1189240315 X:39519698-39519720 GGGGAGGGAGGGAGGCAGCGTGG - Intergenic
1189322319 X:40094478-40094500 CGGGCTGGTGGGAGCGCGGGGGG - Intronic
1192436810 X:71148233-71148255 AGGGCAGGCGGGAGGCAGGGAGG - Intronic
1194977383 X:100408860-100408882 CGGGCTGGAGGGAGGGGGCTCGG - Exonic
1195156034 X:102125662-102125684 CGGGCTGGCGGGCGGGCGCGGGG - Intergenic
1195270131 X:103220824-103220846 CGAGCTGGTGCGTGTCAGCGGGG - Intergenic
1195544573 X:106100594-106100616 CCGGCTGGTGGGTGTCAGCAGGG + Intergenic
1197228821 X:123981314-123981336 CTGGGAGGTGGGAGGGAGCGAGG - Intronic
1197708830 X:129652296-129652318 CGGGGTGATGAGAGGCAGCGTGG + Intronic
1198214578 X:134545016-134545038 CGGGCTGGTGGGCGGCGCCCCGG + Intergenic
1199213571 X:145242298-145242320 GGGGCTGGTGGTAGACAGCTTGG + Intergenic
1199609167 X:149598932-149598954 CGGGCTGCTGGGCTGCAGTGAGG + Intronic
1199629951 X:149770423-149770445 CGGGCTGCTGGGCTGCAGTGAGG - Intergenic
1200071313 X:153530808-153530830 GGGGCCGGTGGGGGGCAGAGGGG + Intronic
1200184431 X:154172918-154172940 TGTGCTGATGGGAGGCAGAGGGG - Intergenic
1200190083 X:154210051-154210073 TGTGCTGATGGGAGGCAGAGGGG - Intergenic
1200195836 X:154247860-154247882 TGTGCTGATGGGAGGCAGAGGGG - Intergenic
1200201490 X:154284976-154284998 TGTGCTGATGGGAGGCAGAGGGG - Intronic
1200213112 X:154355633-154355655 CGGGGAAGCGGGAGGCAGCGGGG + Intronic
1200214276 X:154360548-154360570 GGGGCTGCAGGGAGGCAGTGCGG - Exonic
1200361636 X:155612909-155612931 CGGGCTGGGGGAGGGGAGCGTGG - Exonic
1200919585 Y:8601392-8601414 CAGGATGAAGGGAGGCAGCGAGG + Intergenic
1202380884 Y:24276087-24276109 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
1202489900 Y:25394038-25394060 CGGGCTGCTGGGAGGCAGGCAGG - Intergenic