ID: 1024261137

View in Genome Browser
Species Human (GRCh38)
Location 7:47574650-47574672
Sequence CTGAATAATACCGTGTGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 75}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024261137_1024261140 17 Left 1024261137 7:47574650-47574672 CCCACACACACGGTATTATTCAG 0: 1
1: 0
2: 0
3: 9
4: 75
Right 1024261140 7:47574690-47574712 TCGTGACACATGCTACAACATGG 0: 1
1: 24
2: 500
3: 1562
4: 2743

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024261137 Original CRISPR CTGAATAATACCGTGTGTGT GGG (reversed) Intronic
900871305 1:5305539-5305561 CTGACTAATACAGTGGGTCTGGG - Intergenic
903840731 1:26237538-26237560 CTGAATAATACTCTGTTTTTTGG + Intronic
912508741 1:110174286-110174308 TTGAATAAGACAGTGAGTGTAGG + Intronic
912589690 1:110803992-110804014 CAGCATAATACCATATGTGTAGG + Intergenic
919831813 1:201546456-201546478 CAAAATAAAACCTTGTGTGTGGG - Intergenic
919979048 1:202630982-202631004 CTGCCGAATGCCGTGTGTGTGGG - Intronic
921208705 1:212873626-212873648 CTGAAGAAAACCAAGTGTGTTGG - Intronic
1066452451 10:35543158-35543180 TTGTAAAATACTGTGTGTGTTGG + Intronic
1071735094 10:88289764-88289786 CTGAATAATACTTTTTGTGTAGG - Intronic
1073706380 10:105989064-105989086 CACAATAATACAGTGTGTTTAGG - Intergenic
1076415972 10:130288834-130288856 CTGAACAAGGCAGTGTGTGTTGG - Intergenic
1085769853 11:79315083-79315105 CTGAGTAATAGCGTGGGAGTAGG + Intronic
1087187190 11:95212794-95212816 GGGAATAATAATGTGTGTGTAGG - Intronic
1091010379 11:131995733-131995755 CTGAATAAAGCCGTCTTTGTTGG - Intronic
1092944605 12:13441136-13441158 CTGAAAAATAGCCTGTGTGTTGG + Intergenic
1094100549 12:26757501-26757523 ATGAATAAGACCGGGTGTGGTGG - Intronic
1096012658 12:48234079-48234101 GTGAATTATAGTGTGTGTGTGGG - Intergenic
1109045230 13:57402178-57402200 CAGAGTATTACTGTGTGTGTGGG - Intergenic
1111990849 13:95115723-95115745 ATGAGTAATACCTTGTGTGTGGG - Intronic
1113986773 13:114323806-114323828 AAGAATATAACCGTGTGTGTTGG + Exonic
1120965106 14:90159923-90159945 CTTAATAATCGTGTGTGTGTAGG + Intronic
1121472627 14:94167137-94167159 CTGGATCATACCTTGAGTGTTGG + Intronic
1123851276 15:24359740-24359762 CTGAATAAGACTGTGTGGGACGG - Intergenic
1125196518 15:37053554-37053576 CTGAGTCATACTGTGTGTGAAGG + Intronic
1130223319 15:82039626-82039648 CTGGATAATTCCGTGTGTGGGGG + Intergenic
1130732675 15:86515183-86515205 CTGAATAATACCTCTTGTCTAGG + Intronic
1203049204 16_KI270728v1_random:859352-859374 CAGAATAATACTCTGTGTCTGGG + Intergenic
1155194607 18:23461731-23461753 CAGAATATTACTGTGTGTATTGG + Intronic
1158012717 18:52747892-52747914 CTGAAAAATACCGTGTCATTAGG - Intronic
1159028586 18:63208782-63208804 CTGAATAATACTGTGGCTGTAGG + Intronic
1161074850 19:2280652-2280674 CTGAAAAATAACCTGTGGGTTGG - Intronic
1161930665 19:7337343-7337365 CTGAATAATGCAGTGTGGGAAGG + Intergenic
1164130395 19:22356475-22356497 CTGAATTATACCGAATATGTGGG - Intergenic
928569428 2:32588508-32588530 GAAAATAATACTGTGTGTGTGGG - Intronic
929579927 2:43075597-43075619 CTGAGTAATAATGTGTGTGTGGG - Intergenic
930385170 2:50685323-50685345 CTGAATATTCCTGAGTGTGTTGG - Intronic
934305583 2:91819188-91819210 CAGAATAACACTGTGTGTGATGG + Intergenic
934327673 2:92033560-92033582 CAGAATAACACTGTGTGTGATGG - Intergenic
944487262 2:200220033-200220055 GTAAATAATACTGTGCGTGTGGG + Intergenic
1173998015 20:47354310-47354332 TTGCATAATACTGTGTTTGTTGG - Intronic
1180096863 21:45559775-45559797 CTTAAAAATACCCTGTGTGAGGG - Intergenic
1181734811 22:24873336-24873358 CTGAATAATTCCTTGTGTGGGGG + Intronic
949220134 3:1622798-1622820 CTCATTAATACAGTGTGAGTAGG + Intergenic
950316862 3:12009634-12009656 CTGAAAAATACTGTTTGTGTCGG + Intronic
951890843 3:27566515-27566537 CTGAATAAAAACGTGGGTGAAGG - Intergenic
952365050 3:32666655-32666677 GTAAATAATGCCGGGTGTGTTGG + Intergenic
961999547 3:131281081-131281103 CTGAATCACACTGTATGTGTGGG + Intronic
962024935 3:131537927-131537949 CTGAATAATTCTTTGTGTGGGGG + Intronic
964857858 3:161166306-161166328 CTGAAAAATACCATTTATGTGGG + Intronic
964932658 3:162045804-162045826 CTGGATTATACTGTGTATGTGGG - Intergenic
967568878 3:191003900-191003922 CTGATTAAAACAGGGTGTGTGGG + Intergenic
1202736296 3_GL000221v1_random:2271-2293 ATGAGTAAGACTGTGTGTGTAGG + Intergenic
969507931 4:7599609-7599631 CTGAATGGAACCGGGTGTGTGGG - Intronic
970748693 4:19331789-19331811 CTGAATAATAATGTGGGTGGTGG - Intergenic
970767825 4:19572354-19572376 CTGAATAAATCCGTGCATGTGGG - Intergenic
982269776 4:153574510-153574532 GTGCATAATACTGTGTGTGGGGG + Intronic
982759740 4:159267063-159267085 CTGAATATTTCAGTGTGTATAGG + Intronic
983387944 4:167090153-167090175 CTGAGTCATACGGTATGTGTAGG + Intronic
984223855 4:177010812-177010834 GTTCATAATACCGTGTGAGTTGG - Intergenic
984452050 4:179914604-179914626 CTGACTAATACACTCTGTGTAGG + Intergenic
987879832 5:23729248-23729270 CTGGACAATACCTTGTTTGTAGG - Intergenic
995401796 5:111750457-111750479 CTGAATAATAACGAGTGTCAAGG + Intronic
995979660 5:118086410-118086432 CTGACTAATACAGTGAGTTTAGG - Intergenic
999468468 5:151829918-151829940 CTGAATAATACCCTGTTTTATGG + Intronic
1003123919 6:3340106-3340128 CTGGATAATACCGCTTTTGTGGG - Intronic
1014876503 6:126667495-126667517 TTGTGTAATACCTTGTGTGTTGG - Intergenic
1018452057 6:163918516-163918538 CTGAATAAAAGCATGTGTGTTGG + Intergenic
1023329189 7:39095916-39095938 CTGAATATTGCAATGTGTGTTGG + Intronic
1024261137 7:47574650-47574672 CTGAATAATACCGTGTGTGTGGG - Intronic
1026899033 7:74027252-74027274 CAGAATAGAACCCTGTGTGTCGG + Intergenic
1028576751 7:92360533-92360555 GTGAATAATACTGTGAATGTTGG + Intronic
1028674166 7:93439684-93439706 CAGAATAATCCTGTCTGTGTAGG + Intronic
1030454918 7:109760893-109760915 CTGAATACTTCCCTGTGTGCTGG - Intergenic
1031502857 7:122542902-122542924 CTGAAAAATACTGTCTTTGTTGG - Intronic
1037528503 8:19750848-19750870 ATGAATAAGATCGAGTGTGTGGG - Intronic
1041240187 8:55842543-55842565 CTGGATAAAACTGTGTGGGTTGG + Intergenic
1042078059 8:65017589-65017611 TAGAAAAATACCGTGTGTGACGG - Intergenic
1052920183 9:33959239-33959261 CCAAATAATACTGTGTGTGAAGG + Intronic
1059656394 9:116361487-116361509 ATGAAAAATATCGTGTGTGCTGG - Intronic
1060210633 9:121708061-121708083 CTGAATTATACCCTCTGGGTGGG + Intronic
1203705025 Un_KI270742v1:32710-32732 ATGAGTAAGACTGTGTGTGTAGG + Intergenic
1188525815 X:31086641-31086663 CTGAAAGATATCGTGTTTGTAGG + Intergenic
1192594574 X:72393257-72393279 CTGTACAATTCCGTTTGTGTTGG - Intronic
1198520914 X:137451489-137451511 CTGCAAAATACCATGTGAGTGGG - Intergenic
1200100771 X:153688333-153688355 CTGAAGAATCTCATGTGTGTCGG - Exonic