ID: 1024261823

View in Genome Browser
Species Human (GRCh38)
Location 7:47579243-47579265
Sequence TAACCCCTGCAAGCTGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 125}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024261823_1024261831 15 Left 1024261823 7:47579243-47579265 CCAGGCACAGCTTGCAGGGGTTA 0: 1
1: 0
2: 1
3: 12
4: 125
Right 1024261831 7:47579281-47579303 ATTTCTGGGGTCCTACAGGAAGG 0: 1
1: 0
2: 1
3: 11
4: 135
1024261823_1024261836 30 Left 1024261823 7:47579243-47579265 CCAGGCACAGCTTGCAGGGGTTA 0: 1
1: 0
2: 1
3: 12
4: 125
Right 1024261836 7:47579296-47579318 CAGGAAGGACCCGGGGTCCCAGG 0: 1
1: 0
2: 0
3: 36
4: 316
1024261823_1024261824 0 Left 1024261823 7:47579243-47579265 CCAGGCACAGCTTGCAGGGGTTA 0: 1
1: 0
2: 1
3: 12
4: 125
Right 1024261824 7:47579266-47579288 GCTGATTCCCCAGTGATTTCTGG 0: 1
1: 0
2: 1
3: 16
4: 128
1024261823_1024261834 23 Left 1024261823 7:47579243-47579265 CCAGGCACAGCTTGCAGGGGTTA 0: 1
1: 0
2: 1
3: 12
4: 125
Right 1024261834 7:47579289-47579311 GGTCCTACAGGAAGGACCCGGGG 0: 1
1: 0
2: 1
3: 7
4: 102
1024261823_1024261830 11 Left 1024261823 7:47579243-47579265 CCAGGCACAGCTTGCAGGGGTTA 0: 1
1: 0
2: 1
3: 12
4: 125
Right 1024261830 7:47579277-47579299 AGTGATTTCTGGGGTCCTACAGG 0: 1
1: 0
2: 0
3: 9
4: 98
1024261823_1024261825 1 Left 1024261823 7:47579243-47579265 CCAGGCACAGCTTGCAGGGGTTA 0: 1
1: 0
2: 1
3: 12
4: 125
Right 1024261825 7:47579267-47579289 CTGATTCCCCAGTGATTTCTGGG 0: 1
1: 1
2: 0
3: 14
4: 203
1024261823_1024261832 21 Left 1024261823 7:47579243-47579265 CCAGGCACAGCTTGCAGGGGTTA 0: 1
1: 0
2: 1
3: 12
4: 125
Right 1024261832 7:47579287-47579309 GGGGTCCTACAGGAAGGACCCGG 0: 1
1: 0
2: 3
3: 18
4: 204
1024261823_1024261833 22 Left 1024261823 7:47579243-47579265 CCAGGCACAGCTTGCAGGGGTTA 0: 1
1: 0
2: 1
3: 12
4: 125
Right 1024261833 7:47579288-47579310 GGGTCCTACAGGAAGGACCCGGG 0: 1
1: 0
2: 2
3: 15
4: 185
1024261823_1024261826 2 Left 1024261823 7:47579243-47579265 CCAGGCACAGCTTGCAGGGGTTA 0: 1
1: 0
2: 1
3: 12
4: 125
Right 1024261826 7:47579268-47579290 TGATTCCCCAGTGATTTCTGGGG 0: 1
1: 0
2: 0
3: 20
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024261823 Original CRISPR TAACCCCTGCAAGCTGTGCC TGG (reversed) Intronic
901533145 1:9866199-9866221 TGCCCCCTGCAACCTGGGCCAGG - Intronic
917502354 1:175597377-175597399 GAGCCTCTGGAAGCTGTGCCAGG - Intronic
918342325 1:183578151-183578173 GGGCCCCTCCAAGCTGTGCCAGG - Intronic
923516860 1:234705037-234705059 TAATGCTTGCAAGATGTGCCAGG - Intergenic
1063019765 10:2116078-2116100 TCACCCCAGCAAGGTGGGCCTGG - Intergenic
1063376764 10:5558655-5558677 TCACACCCTCAAGCTGTGCCAGG + Intergenic
1063950827 10:11221895-11221917 TAACCCATGCAAGGTGAGCGAGG + Intronic
1065871021 10:29956471-29956493 GAACCCCTGCAAGCAGAGGCAGG - Intergenic
1069122107 10:64579531-64579553 TAAGCCCTGCAAGCTTTTCAAGG + Intergenic
1069897395 10:71688166-71688188 TGAGCCCTGCAACCTGAGCCTGG - Intronic
1071567131 10:86677108-86677130 CACCCCCTACAAGCTGTGGCTGG - Intronic
1073526588 10:104188879-104188901 TAACCTCTACAAGGTGTGCCAGG + Intronic
1074577295 10:114682297-114682319 TAATGCTTTCAAGCTGTGCCAGG + Intronic
1075411898 10:122234256-122234278 TCAGACCTGCAGGCTGTGCCTGG - Intronic
1082997607 11:59265965-59265987 GATCCCCTGCCAGCTGGGCCTGG + Intergenic
1083728057 11:64638501-64638523 TCACCCCGGCAAGCTGTCCTCGG + Intronic
1083765593 11:64840052-64840074 CAACCCCTGCCAGCTGTGCTGGG - Intronic
1083841244 11:65305516-65305538 TGACCACTGCAAGCTGGGCACGG + Intronic
1084247799 11:67872037-67872059 TTACCCCTGTAGTCTGTGCCTGG + Intergenic
1088355725 11:108942048-108942070 AGACCCCTGCAAGATCTGCCTGG + Intergenic
1088953520 11:114594907-114594929 TCACCCCCGCAAGCTGTACTTGG + Intronic
1090042059 11:123299981-123300003 TCAGCCCTGCAAGCTGTGCTTGG - Intergenic
1092418081 12:8307432-8307454 TTACCCCTGTAGTCTGTGCCTGG + Intergenic
1092881568 12:12891337-12891359 TCACCCCTGGAAGCTGGGCGGGG - Exonic
1100657988 12:96667548-96667570 TAACCCCTTCTAGCTATGGCTGG + Intronic
1100848292 12:98682434-98682456 TTAACCCTGCAAGCTGTAGCAGG - Intronic
1102886451 12:116525661-116525683 GAGCCCCTGCAAGCGGCGCCGGG - Intergenic
1102965239 12:117120577-117120599 TGACCTCTCCAAGATGTGCCAGG + Intergenic
1105002860 12:132702521-132702543 TGGCCCCTGCAGGCTCTGCCAGG - Intronic
1106119473 13:26847591-26847613 TAACTCCTGCAAGCTGTTCCTGG + Intergenic
1116018427 14:39432898-39432920 TAACCCCGGCGGGCTGTGCCGGG + Intergenic
1117370935 14:55077807-55077829 TAACTCATGAAAGCTGTTCCAGG - Intergenic
1117484487 14:56180771-56180793 TCATCCCTGCCAGCTGTGCCAGG + Intronic
1119596658 14:75941199-75941221 AAACCCCTTGCAGCTGTGCCCGG + Intronic
1202849702 14_GL000225v1_random:9048-9070 TAACCCCTGCAGGCACGGCCTGG - Intergenic
1124517297 15:30377282-30377304 TGGCCCTTCCAAGCTGTGCCCGG - Intronic
1124725647 15:32153712-32153734 TGGCCCTTCCAAGCTGTGCCCGG + Intronic
1132463491 16:67011-67033 TGACCCCTTCACGCTGTGGCTGG - Intronic
1132467788 16:85528-85550 TGGCCCCTCCAAGCTGTGCCAGG + Exonic
1133357436 16:5147033-5147055 TTACCCCTGTAGTCTGTGCCTGG + Intergenic
1134627905 16:15736002-15736024 TATCCCCCGCAAGCAGTGGCTGG - Intronic
1134793618 16:17013966-17013988 TAACCCCTGCCAGTTCAGCCGGG - Intergenic
1135503336 16:23015739-23015761 TCACCCATGCAAACAGTGCCTGG + Intergenic
1141042765 16:80686089-80686111 TATCGCCTGCGAGCTGTGCATGG - Intronic
1144065236 17:11618770-11618792 TAAACCCTGCAAGGTGGGCAGGG + Intronic
1157861062 18:51140445-51140467 GAACCCTTGCTAGCTGTGCAGGG - Intergenic
1158489127 18:57894348-57894370 TAATCCCTGGAAGCTGTGGATGG + Intergenic
1163248292 19:16110844-16110866 TCACCGCCACAAGCTGTGCCCGG - Intergenic
1164149785 19:22541164-22541186 TAACCAGTGCAAGCTGGGCATGG + Intergenic
1166997634 19:46727376-46727398 CAGCCCCTGCAAGCTCTGACTGG - Intronic
1168098255 19:54127724-54127746 GAACACCTGAACGCTGTGCCAGG - Intronic
1202649745 1_KI270706v1_random:169615-169637 CCACCTCTGCAAGGTGTGCCAGG - Intergenic
927459533 2:23285925-23285947 TCATCCCTGCCAGCTGTGGCTGG + Intergenic
927613468 2:24565829-24565851 CACTCCCTGCAAGCTGTGTCTGG + Intronic
928073218 2:28238588-28238610 TAAAGCCTGGAATCTGTGCCAGG - Intronic
932428065 2:71656218-71656240 TAACACCTTCAAGCTGTACCGGG + Exonic
935100314 2:99988414-99988436 TAACCTCAGGATGCTGTGCCAGG - Intronic
939851816 2:147313555-147313577 TATCCCCTGCAAGCTGTAGGGGG + Intergenic
946042423 2:216793653-216793675 TAACCCCTGGAAGCTCTAGCTGG - Intergenic
946891663 2:224283257-224283279 TAACTCCTGCAAGCATAGCCTGG + Intergenic
947670397 2:231932137-231932159 GCACCCTTGCAACCTGTGCCTGG + Intergenic
947996741 2:234534438-234534460 TAACCCCTGAAAGCAGAGCTAGG - Intergenic
948884084 2:240874374-240874396 CAGCCCCTGGAAGCTGAGCCAGG - Intronic
1169235996 20:3930471-3930493 TAACCCCCACAAGAGGTGCCAGG + Intronic
1171431090 20:25083553-25083575 TCCCCCTTGCAAGCTGTTCCCGG + Intergenic
1173407103 20:42776008-42776030 TAATCCCTGTAAGCAGTCCCTGG + Intronic
1176388645 21:6152147-6152169 TCTGCCCTGCAAGCAGTGCCTGG + Intergenic
1176602077 21:8802932-8802954 CCACCTCTGCAAGGTGTGCCAGG + Intergenic
1176919567 21:14670759-14670781 TAGCCCTTCCAGGCTGTGCCTGG - Intergenic
1179734827 21:43386101-43386123 TCTGCCCTGCAAGCAGTGCCTGG - Intergenic
1180344361 22:11694483-11694505 CCACCTCTGCAAGGTGTGCCAGG + Intergenic
1181727911 22:24824379-24824401 ACAGCCCTACAAGCTGTGCCTGG - Intronic
1182119556 22:27777996-27778018 TAGCCCTTAAAAGCTGTGCCTGG - Intronic
1182271171 22:29154490-29154512 TTACCTCTGCCAGCTGGGCCAGG - Intronic
1182781184 22:32869183-32869205 CATCCCCAGCAAGCTGTGGCCGG - Intronic
1184291661 22:43500717-43500739 TAACTCCTGCAGTGTGTGCCTGG + Intronic
1184470491 22:44692877-44692899 TAACACCACCCAGCTGTGCCTGG - Intronic
1185334587 22:50265904-50265926 GGACCCCAGCAAGCAGTGCCTGG - Intronic
1185334622 22:50265996-50266018 TGACCCCAGCAAGCAGTGCCTGG - Intronic
953623911 3:44555094-44555116 TAAGCCCTGCCAGCTCTCCCGGG + Intergenic
957062007 3:75489862-75489884 TTACCCCTGTAGTCTGTGCCTGG + Intergenic
957300766 3:78389145-78389167 TAATCCCTGCATGCTGTGGGAGG + Intergenic
959100040 3:102000060-102000082 CAACCCATGCAATCTATGCCAGG - Intergenic
959583174 3:108002532-108002554 TAATCCCTGAAAGCTGTGAATGG - Intergenic
961291396 3:125849539-125849561 TTACCCCTGTAGTCTGTGCCTGG - Intergenic
969005900 4:4019953-4019975 TTACCCCTGTAGTCTGTGCCTGG + Intergenic
969071419 4:4542206-4542228 TAAACCCTCCAAGCTTTGCTGGG - Intronic
969578303 4:8049060-8049082 TGACCACTGCCAGCTGGGCCCGG + Intronic
969807049 4:9617337-9617359 TTACCCCTGTAGTCTGTGCCTGG - Intergenic
970234126 4:13941122-13941144 TAACCACTAAAAGCTGTGTCTGG + Intergenic
973365399 4:49204739-49204761 CCACCTCTGCAAGGTGTGCCAGG + Intergenic
973395190 4:49587715-49587737 CCACCTCTGCAAGGTGTGCCAGG - Intergenic
973886246 4:55325039-55325061 TAACCCCTTCAAGCATTGCCTGG - Intergenic
983575274 4:169254795-169254817 CAACCCCTGCTTGCTGTGCTTGG - Intronic
985696959 5:1346073-1346095 CAACCCCTGGAAGCTGGGCCAGG + Intergenic
996424071 5:123293806-123293828 TAAACCATGTAAACTGTGCCGGG - Intergenic
997414215 5:133712570-133712592 TAACCCCTGAGAACAGTGCCTGG + Intergenic
997564116 5:134874294-134874316 TAACACCTGGCAGCTGTGGCGGG - Exonic
998004817 5:138649837-138649859 TGACCCCTCCTAGCTGTCCCCGG - Intronic
999224711 5:150011492-150011514 GTACCCCTGCAATCTGTCCCAGG + Intronic
1001349335 5:170942235-170942257 TATTCCATGCAACCTGTGCCTGG + Intronic
1002081968 5:176742748-176742770 TAGGCCCTGCAAGATCTGCCAGG - Intergenic
1002930836 6:1633895-1633917 TACCGCCTGCAGGCTGTGGCTGG + Intronic
1003311147 6:4970960-4970982 TGACCCCTCCTCGCTGTGCCTGG - Intergenic
1004220104 6:13739352-13739374 TAAGGCCTGCAAGCTTTACCAGG + Intergenic
1005583210 6:27252051-27252073 TAACTCCTCCCAGCTGTGCCAGG - Intronic
1005649458 6:27873378-27873400 TAACGCCTCCACGCCGTGCCAGG + Exonic
1009637442 6:66284301-66284323 TAACCCCTGCATGTTGTGGGAGG + Intergenic
1010792659 6:80082541-80082563 TAACACCTGCAGGCTTTGGCTGG + Intergenic
1012521089 6:100121984-100122006 AAACACCTGCAATCTTTGCCAGG + Intergenic
1017911329 6:158795591-158795613 TAACTACTGCAAGGTGTGCCAGG + Intronic
1017982751 6:159416505-159416527 TAACCCCTTCAAGATATGCTGGG + Intergenic
1019165678 6:170096184-170096206 TTAACCCTGCAGGCTGTGTCTGG + Intergenic
1019593047 7:1845167-1845189 TGAGCCCAGCAGGCTGTGCCAGG - Intronic
1022807972 7:33842300-33842322 TGACCCAGCCAAGCTGTGCCTGG - Intergenic
1023482444 7:40648507-40648529 TAACCCCTGGCACCTGTGTCTGG + Intronic
1024261823 7:47579243-47579265 TAACCCCTGCAAGCTGTGCCTGG - Intronic
1026200136 7:68207276-68207298 TTAGCCCAGCAAGCTGTGCTGGG - Intergenic
1031918219 7:127582760-127582782 TCAGCTCTGCAAGCTGTTCCTGG + Exonic
1035460894 7:159038160-159038182 TGAGCCCTGCAGGCTGTCCCTGG + Intronic
1036793570 8:11739875-11739897 TAAAACCTGCAAGCTGGGTCTGG - Intronic
1040351799 8:46576394-46576416 TAACAACTGCCAGCTGTGTCAGG - Intergenic
1041195517 8:55397920-55397942 TAACCCCTGAGAGGTGTGACTGG - Intronic
1042840919 8:73122811-73122833 CAATCCCTGCAAGATTTGCCAGG - Intronic
1049234727 8:141506922-141506944 CAACCCCTGCAGGCTGCTCCTGG + Intergenic
1052205472 9:25834305-25834327 TAAACCCTGGAAGCTTTGCTAGG - Intergenic
1055009781 9:71552738-71552760 CAACCACTGCAACCTGTGGCAGG - Intergenic
1055932829 9:81577091-81577113 TCACACCTGCCATCTGTGCCTGG + Intergenic
1059665858 9:116446036-116446058 TAACCCCTCCAGGCACTGCCTGG - Intronic
1062002306 9:134222474-134222496 TTAACCCTCCAGGCTGTGCCAGG - Intergenic
1062024315 9:134333280-134333302 TCACCCCAGCAGGCAGTGCCTGG - Intronic
1186317346 X:8385329-8385351 TAGCCCCAGAAATCTGTGCCAGG + Intergenic
1188847838 X:35095880-35095902 GAACCCATCCATGCTGTGCCTGG - Intergenic
1192162260 X:68797296-68797318 TAAGACCTGGAATCTGTGCCAGG - Intergenic
1194007847 X:88519143-88519165 TAATCTCTTCAAGCTGTGCAGGG + Intergenic
1194971969 X:100353659-100353681 TAACCCCAGGCAGATGTGCCAGG + Intronic
1196060696 X:111404940-111404962 TAGCCCTTGGAAGCTGTGGCAGG - Intronic
1196890829 X:120289086-120289108 TCACCCATCCAAGCTGTGCTAGG + Intronic
1198675436 X:139125917-139125939 CAACCCCTGCTACCAGTGCCTGG + Intronic