ID: 1024262807

View in Genome Browser
Species Human (GRCh38)
Location 7:47584357-47584379
Sequence CTGGATCCCCAATCGGGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024262795_1024262807 23 Left 1024262795 7:47584311-47584333 CCGGGTTCCCCACACCTCGTCTA No data
Right 1024262807 7:47584357-47584379 CTGGATCCCCAATCGGGACCTGG No data
1024262793_1024262807 25 Left 1024262793 7:47584309-47584331 CCCCGGGTTCCCCACACCTCGTC No data
Right 1024262807 7:47584357-47584379 CTGGATCCCCAATCGGGACCTGG No data
1024262798_1024262807 15 Left 1024262798 7:47584319-47584341 CCCACACCTCGTCTAGAGGCACA No data
Right 1024262807 7:47584357-47584379 CTGGATCCCCAATCGGGACCTGG No data
1024262799_1024262807 14 Left 1024262799 7:47584320-47584342 CCACACCTCGTCTAGAGGCACAT No data
Right 1024262807 7:47584357-47584379 CTGGATCCCCAATCGGGACCTGG No data
1024262797_1024262807 16 Left 1024262797 7:47584318-47584340 CCCCACACCTCGTCTAGAGGCAC No data
Right 1024262807 7:47584357-47584379 CTGGATCCCCAATCGGGACCTGG No data
1024262794_1024262807 24 Left 1024262794 7:47584310-47584332 CCCGGGTTCCCCACACCTCGTCT No data
Right 1024262807 7:47584357-47584379 CTGGATCCCCAATCGGGACCTGG No data
1024262800_1024262807 9 Left 1024262800 7:47584325-47584347 CCTCGTCTAGAGGCACATGAAGG No data
Right 1024262807 7:47584357-47584379 CTGGATCCCCAATCGGGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024262807 Original CRISPR CTGGATCCCCAATCGGGACC TGG Intergenic
No off target data available for this crispr