ID: 1024262828

View in Genome Browser
Species Human (GRCh38)
Location 7:47584419-47584441
Sequence TGAAGTTGCAGCCTGCGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024262828_1024262832 29 Left 1024262828 7:47584419-47584441 CCACTTCGCAGGCTGCAACTTCA No data
Right 1024262832 7:47584471-47584493 CATGAACCAGTATCTGAAAAAGG No data
1024262828_1024262833 30 Left 1024262828 7:47584419-47584441 CCACTTCGCAGGCTGCAACTTCA No data
Right 1024262833 7:47584472-47584494 ATGAACCAGTATCTGAAAAAGGG No data
1024262828_1024262831 6 Left 1024262828 7:47584419-47584441 CCACTTCGCAGGCTGCAACTTCA No data
Right 1024262831 7:47584448-47584470 CAAGAAATTAAACAAAAACAGGG No data
1024262828_1024262830 5 Left 1024262828 7:47584419-47584441 CCACTTCGCAGGCTGCAACTTCA No data
Right 1024262830 7:47584447-47584469 CCAAGAAATTAAACAAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024262828 Original CRISPR TGAAGTTGCAGCCTGCGAAG TGG (reversed) Intergenic
No off target data available for this crispr