ID: 1024265731

View in Genome Browser
Species Human (GRCh38)
Location 7:47605055-47605077
Sequence CAGAATTCTTTCAAATAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024265723_1024265731 10 Left 1024265723 7:47605022-47605044 CCCTGGTCAGCCCTTGCCACATA No data
Right 1024265731 7:47605055-47605077 CAGAATTCTTTCAAATAGCATGG No data
1024265729_1024265731 -6 Left 1024265729 7:47605038-47605060 CCACATAGTTGGGATGCCAGAAT No data
Right 1024265731 7:47605055-47605077 CAGAATTCTTTCAAATAGCATGG No data
1024265727_1024265731 0 Left 1024265727 7:47605032-47605054 CCCTTGCCACATAGTTGGGATGC No data
Right 1024265731 7:47605055-47605077 CAGAATTCTTTCAAATAGCATGG No data
1024265728_1024265731 -1 Left 1024265728 7:47605033-47605055 CCTTGCCACATAGTTGGGATGCC No data
Right 1024265731 7:47605055-47605077 CAGAATTCTTTCAAATAGCATGG No data
1024265724_1024265731 9 Left 1024265724 7:47605023-47605045 CCTGGTCAGCCCTTGCCACATAG No data
Right 1024265731 7:47605055-47605077 CAGAATTCTTTCAAATAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024265731 Original CRISPR CAGAATTCTTTCAAATAGCA TGG Intergenic
No off target data available for this crispr