ID: 1024268500

View in Genome Browser
Species Human (GRCh38)
Location 7:47624749-47624771
Sequence GGTGGTGCAGAGTGAGAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024268492_1024268500 25 Left 1024268492 7:47624701-47624723 CCTTTTGAATTTGCAGTTGCTGC No data
Right 1024268500 7:47624749-47624771 GGTGGTGCAGAGTGAGAAAGTGG No data
1024268498_1024268500 -7 Left 1024268498 7:47624733-47624755 CCAGCCAGGTGCATGAGGTGGTG No data
Right 1024268500 7:47624749-47624771 GGTGGTGCAGAGTGAGAAAGTGG No data
1024268495_1024268500 0 Left 1024268495 7:47624726-47624748 CCAGAAGCCAGCCAGGTGCATGA No data
Right 1024268500 7:47624749-47624771 GGTGGTGCAGAGTGAGAAAGTGG No data
1024268494_1024268500 1 Left 1024268494 7:47624725-47624747 CCCAGAAGCCAGCCAGGTGCATG No data
Right 1024268500 7:47624749-47624771 GGTGGTGCAGAGTGAGAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024268500 Original CRISPR GGTGGTGCAGAGTGAGAAAG TGG Intergenic