ID: 1024272800

View in Genome Browser
Species Human (GRCh38)
Location 7:47655295-47655317
Sequence CAGAGTCAACAGAAGGAAGA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 579
Summary {0: 1, 1: 0, 2: 3, 3: 56, 4: 519}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024272797_1024272800 5 Left 1024272797 7:47655267-47655289 CCGGGCAGTGGGATGAGGATGGC 0: 1
1: 0
2: 1
3: 34
4: 350
Right 1024272800 7:47655295-47655317 CAGAGTCAACAGAAGGAAGACGG 0: 1
1: 0
2: 3
3: 56
4: 519
1024272795_1024272800 6 Left 1024272795 7:47655266-47655288 CCCGGGCAGTGGGATGAGGATGG 0: 1
1: 0
2: 7
3: 40
4: 414
Right 1024272800 7:47655295-47655317 CAGAGTCAACAGAAGGAAGACGG 0: 1
1: 0
2: 3
3: 56
4: 519

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024272800 Original CRISPR CAGAGTCAACAGAAGGAAGA CGG Exonic
900032047 1:379284-379306 GAGACTCAAGAGGAGGAAGAGGG - Intergenic
900052596 1:607470-607492 GAGACTCAAGAGGAGGAAGAGGG - Intergenic
900741636 1:4333794-4333816 GAGAATCAACAGAATGAGGAAGG + Intergenic
900745188 1:4356131-4356153 CAGAGTCAAAAGGAGCAACACGG + Intergenic
900803970 1:4755415-4755437 CAGAGCCAGCAGGAGGGAGACGG - Intronic
900861040 1:5231581-5231603 CATAGGAAGCAGAAGGAAGAGGG + Intergenic
902539126 1:17140073-17140095 GAGAGTCATCAGCAGCAAGAAGG - Intergenic
902986529 1:20157763-20157785 CAGAGTGAAAAGATGGAAGTTGG + Intergenic
904222861 1:28987480-28987502 CAGCACCAACAGAAGGAAGAGGG + Exonic
904272050 1:29356545-29356567 CAGAGCTAAGAGAAGGAAGGAGG + Intergenic
905401641 1:37707954-37707976 CAGACCCCACAGAAGGATGAGGG - Intronic
905602821 1:39268902-39268924 GAGAGTCTCCAAAAGGAAGACGG + Intronic
905678720 1:39850190-39850212 CATCGTCAACATACGGAAGAAGG - Exonic
905940238 1:41857240-41857262 CAGAGTAAACAGAGAGAAGCCGG - Intronic
906105682 1:43290737-43290759 CTGAGTGAACAGCAGGAAGGGGG + Intergenic
906259745 1:44377986-44378008 TAGAGAGAACAGATGGAAGATGG + Intergenic
907123456 1:52028275-52028297 CAGAGACATGAGAAGGAAGTAGG - Intronic
907466098 1:54638216-54638238 CAGAATCCACAGAAGCCAGAAGG + Exonic
907501499 1:54884910-54884932 CAGGGCCAACAGATGGCAGAGGG + Intronic
907553344 1:55323454-55323476 CAGAGTCTCAAGCAGGAAGAAGG - Intergenic
907934869 1:59033063-59033085 TAGAGTCTACAGAAGGCAGGAGG + Intergenic
909647568 1:77934621-77934643 CAGAGTCCGAAGAGGGAAGAAGG - Intronic
911697508 1:100907839-100907861 CAAAGACAAGAGAAGGAAAAGGG - Intronic
912131018 1:106600480-106600502 CAGAGTCATCACATGGCAGAAGG - Intergenic
912308442 1:108595284-108595306 AAGAATAAAGAGAAGGAAGAAGG + Intronic
913266072 1:117046019-117046041 CAAAGGCAGCAGAAAGAAGATGG + Intergenic
913379467 1:118192965-118192987 CACAGGCAACAGAAGCAAAAAGG + Intergenic
914452043 1:147801043-147801065 CATAATCAACAGAACTAAGAGGG - Intergenic
914858394 1:151368391-151368413 CAGAGTCAGCAGATAGAAGTAGG - Intronic
915827026 1:159088811-159088833 CAGAGTCCCCACAAGCAAGAAGG + Intronic
915864223 1:159481112-159481134 CAAAGTCAAAAGGAGGAAGACGG + Intergenic
915990504 1:160511516-160511538 CACATTCAACAGAATGAAGTTGG + Intronic
916852130 1:168714212-168714234 CAGACTCACCAGCAGGAATATGG + Exonic
916921674 1:169475631-169475653 GAGAGTCAACAGAGGGTTGATGG - Intronic
916987328 1:170205877-170205899 AAGAGACAACAAAAAGAAGAAGG - Intergenic
917165684 1:172110124-172110146 CAGGGGCAAGAGAAGGAACAGGG - Intronic
917168797 1:172145434-172145456 CAGATTCAACAGACAGGAGAAGG - Intronic
917872842 1:179257128-179257150 CAGAATCAAGAGAAGTAGGATGG + Intergenic
917960147 1:180136216-180136238 CAGAGTCAACATTTGGAAGAGGG + Intergenic
919972580 1:202590674-202590696 AAGAGTCCACATAAGGGAGATGG + Exonic
920049528 1:203154926-203154948 CAGAGAAAAAAGAAGGAAGAGGG - Intronic
920255047 1:204648984-204649006 CAGAGTCATCAGAAGTCAGGTGG + Intronic
921308142 1:213817306-213817328 CAGAGGCCAGAGAAGGAAGGCGG + Intergenic
921628980 1:217411053-217411075 CAGAGGCAAAAGGAGAAAGAGGG - Intergenic
921723494 1:218499571-218499593 CACAGCCAACACAAGGAAAATGG - Intergenic
921885960 1:220306175-220306197 CAAAATCAACACAAGGAACACGG + Intergenic
922419665 1:225451061-225451083 CTGAGTGAGCAGAAGGAAGAGGG - Intergenic
923121817 1:230999089-230999111 CACAGTGAAGGGAAGGAAGAGGG - Intronic
923201551 1:231717471-231717493 CAGAGTCAGCAGAGGGAGGCGGG - Intronic
923322190 1:232845585-232845607 CAGAGTCAAGGGAAGAAAGATGG - Intergenic
924498560 1:244614040-244614062 CAGAGTCCCCACCAGGAAGATGG + Intronic
1062940518 10:1417462-1417484 CTGACTCAAAAGAAGGATGAAGG + Intronic
1064157795 10:12917785-12917807 CAGACTCAACAAAAGGACTACGG - Intronic
1064691968 10:17927567-17927589 CAGATTCACCAGCAGGAAGTGGG + Intergenic
1064709452 10:18108988-18109010 CAGAGTCAAGGAAAGGAAGAGGG - Intergenic
1065990214 10:31001997-31002019 GAAAGTCAACAGAAAGAAGAGGG + Intronic
1067927450 10:50524454-50524476 CACAGTCAAGAGAAGAAAGGAGG - Intronic
1068124499 10:52822347-52822369 CTGAGTTCAGAGAAGGAAGATGG + Intergenic
1068694869 10:59956697-59956719 CACAGTCAACACAATGAAAAAGG + Exonic
1069860326 10:71467146-71467168 CAGAGACCCCAGAGGGAAGAGGG + Intronic
1070161307 10:73868258-73868280 CAGAGGAAGCAGCAGGAAGAAGG + Intronic
1070891316 10:79943892-79943914 CCAAGTCAGCAGCAGGAAGATGG + Intronic
1071339911 10:84636112-84636134 CAGAGTCATCAGCAGCAAGAAGG + Intergenic
1071411420 10:85400495-85400517 CAGAATAAACAGAAGGACCATGG + Intergenic
1071450754 10:85789993-85790015 CAGAGTCAGGAAAAGGGAGAGGG - Intronic
1071582268 10:86783065-86783087 CACATGCAACAGAATGAAGATGG - Intronic
1071752472 10:88496062-88496084 CAAAGGGGACAGAAGGAAGAGGG + Intronic
1071840520 10:89465935-89465957 CAGAATCTACAGGAAGAAGAGGG - Intronic
1072005613 10:91243911-91243933 TATAGACAATAGAAGGAAGATGG + Intronic
1072128360 10:92467599-92467621 TAGAGTCAAAAGAAGTAAGAAGG + Intronic
1072351055 10:94557608-94557630 AAGAGTCACCAGAAAGAAGCAGG - Intronic
1074625592 10:115180905-115180927 CAGAGTCAACAGAATTTAGTAGG - Intronic
1075389576 10:122083026-122083048 GAGAGACAGCCGAAGGAAGAAGG + Exonic
1075711738 10:124534377-124534399 GAGAGCCAACGGCAGGAAGAGGG + Intronic
1076294513 10:129374210-129374232 CAGTGTGAACAGAAAGCAGAGGG - Intergenic
1076642823 10:131930400-131930422 AAAAGCCAAGAGAAGGAAGATGG - Intronic
1076643494 10:131935167-131935189 GAGGCTCAACAGAAAGAAGAGGG - Intronic
1076729400 10:132430977-132430999 CAGGGTCCCGAGAAGGAAGATGG + Intergenic
1077524298 11:3055079-3055101 CTGAGTCAACTTAGGGAAGATGG + Intronic
1078778793 11:14417804-14417826 CAGAGCCAATACAAAGAAGAGGG + Intergenic
1078963555 11:16308877-16308899 CAGATACAACAAAAGGAAAAAGG + Intronic
1080186521 11:29493846-29493868 CAAAGAAGACAGAAGGAAGAGGG - Intergenic
1080384448 11:31802881-31802903 CAGAGTGAAGAGGAAGAAGAGGG + Intronic
1080662606 11:34309785-34309807 CAGAGTCAAAAAAAAAAAGATGG + Intronic
1080688716 11:34537725-34537747 CAGAGGTCACAGAGGGAAGACGG - Intergenic
1081886962 11:46506188-46506210 TAGAGTGGACAGAAGGGAGAAGG + Intronic
1082649831 11:55776128-55776150 CAGGGTAAACAGAGGGAAGCAGG + Intergenic
1083097634 11:60267776-60267798 CAGAGTTAAGGGAACGAAGAAGG + Intergenic
1083366175 11:62142682-62142704 CAGAGTCCACAGAAGGCAGATGG - Intronic
1083484253 11:62973501-62973523 ATGAGACAACAGAAGCAAGAGGG - Intronic
1083520483 11:63306247-63306269 CAGAGGCTAGGGAAGGAAGAAGG - Intronic
1084937368 11:72594317-72594339 CAGAGGGTGCAGAAGGAAGATGG - Intronic
1084996729 11:72987124-72987146 GAGAGACCATAGAAGGAAGAGGG - Intronic
1086060907 11:82698976-82698998 AAGAGTCAGCACAATGAAGAGGG + Intergenic
1086344512 11:85882567-85882589 CTGAGTGAAGAGAAGGCAGAGGG + Exonic
1086841423 11:91689631-91689653 AAGGGACAAAAGAAGGAAGAGGG - Intergenic
1087504909 11:99007345-99007367 CAGCCTTAATAGAAGGAAGATGG - Intergenic
1087897023 11:103597520-103597542 CAGAGTAGACAGAAGGAAACAGG - Intergenic
1088299995 11:108347631-108347653 CAGATTCAAAAGAAGGAATCAGG + Intronic
1089403650 11:118180217-118180239 CAGAGTTGCCAGAAGGCAGAAGG + Intergenic
1090055730 11:123422850-123422872 CAGAGTGAACACGAGGGAGAAGG - Intergenic
1090429107 11:126631082-126631104 CACAGACAACTGAATGAAGAGGG - Intronic
1090534839 11:127629396-127629418 CAGAGCCAAAAGAAAGAACACGG + Intergenic
1090673498 11:128968712-128968734 CAAAGTCTATAGATGGAAGAGGG + Exonic
1090848493 11:130549919-130549941 CAAAGCCAAGAGAAGAAAGAGGG - Intergenic
1090925599 11:131247363-131247385 CTTTGTCAACAGAAGGAAGAAGG - Intergenic
1090986898 11:131775551-131775573 TGGTGTCAACAGAGGGAAGAGGG - Intronic
1091170985 11:133519422-133519444 GAGACACAACAGAAGGACGAGGG + Intronic
1091483906 12:865144-865166 CAGAGGCAACAGCAGAAAGATGG - Intronic
1091963721 12:4720706-4720728 CAGAGTCAGCCCAATGAAGAGGG - Exonic
1092953569 12:13529497-13529519 AAGAGTAAACAGAAGGAAGTGGG - Intergenic
1093372407 12:18380309-18380331 CAGAGTCAACAGAGGTGAGGAGG - Intronic
1093406258 12:18808550-18808572 CAGAGTGATCAGCAGGAAAATGG + Intergenic
1093650086 12:21633386-21633408 CAGAGCCAAGAGCTGGAAGAAGG - Intergenic
1093780142 12:23126058-23126080 CAGAGTCAACAGGAGGAATGTGG - Intergenic
1094020692 12:25910837-25910859 AAGAGTCAACAGAAGAACAATGG - Intergenic
1094037869 12:26090048-26090070 AAGAGGTAACAGATGGAAGAAGG + Intergenic
1094129901 12:27063562-27063584 CAGAAGAAAAAGAAGGAAGAAGG - Intronic
1095912052 12:47437738-47437760 CAAAGCAAACAGAAGGAAGGAGG + Intergenic
1096019197 12:48308004-48308026 TAAAGTGAACAGAAGAAAGATGG + Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096658084 12:53104108-53104130 CACAGTCAACAGGAGGAATTGGG - Intronic
1096896958 12:54830665-54830687 CAGAATGAACAGAGGGATGAAGG - Intronic
1097361736 12:58665924-58665946 CAGAAGCAAGAGAAAGAAGAGGG - Intronic
1097741431 12:63247193-63247215 CAAAGTTAATAGAAGCAAGAGGG - Intergenic
1098202986 12:68076962-68076984 CACATTCAAAACAAGGAAGATGG + Intergenic
1098833102 12:75387659-75387681 CAGAGTCCCCAGTAGCAAGAAGG - Intronic
1099337462 12:81381525-81381547 CAGGGCCAAGAGAATGAAGATGG + Intronic
1099596326 12:84671465-84671487 CAGAGACTACAGAAGGTAGGAGG + Intergenic
1099904321 12:88754021-88754043 CAGAGGCCACAGGAGGAGGATGG + Intergenic
1101022248 12:100565144-100565166 CAGGAGCAACAGAAGGAAGGTGG + Intergenic
1101044931 12:100794993-100795015 AAGAGTCAACAGAAGGAGAAGGG - Exonic
1101280123 12:103244969-103244991 AAGAGTCAACAGAAGCAAAGGGG + Intronic
1103123826 12:118403734-118403756 CAGAGACACCAGAATGGAGAAGG - Intronic
1103311300 12:120011119-120011141 CCGAGTCACAAGATGGAAGATGG - Intronic
1103401127 12:120643430-120643452 CAGAACCAAGAGAAGGCAGATGG + Intronic
1103883509 12:124184361-124184383 CAGGGTCACCAGAAAGGAGAGGG - Intronic
1104040526 12:125127248-125127270 CAGAGTGAGCAGCAGGAAGGAGG + Intronic
1104057280 12:125240113-125240135 CAGAATCACCAGAAGGTGGAAGG - Intronic
1104223542 12:126809731-126809753 CACATTGAACAGAAGGAAGTAGG + Intergenic
1104294062 12:127495750-127495772 CAGAGTCCACTGAAGGCAGGTGG - Intergenic
1104512159 12:129390692-129390714 CAGAGTCACCAGCAAGAAGAAGG - Intronic
1105517827 13:21105993-21106015 CACAGACAAAAGAAGGCAGAGGG - Intergenic
1106181190 13:27371309-27371331 CACACTCAGCAGAAGGAACACGG - Intergenic
1106988315 13:35383380-35383402 GAGAGTGAACAGATGGAATAGGG + Intronic
1107384528 13:39893802-39893824 CAGAGACACCAAGAGGAAGACGG - Intergenic
1108941552 13:55962285-55962307 CAAAGTAAGCAGAAGTAAGAGGG + Intergenic
1109110220 13:58308208-58308230 CAGAACCAATAGAAGAAAGAAGG - Intergenic
1109305821 13:60640480-60640502 CAGAGACAACTGAATGAAGCTGG - Intergenic
1109551133 13:63902227-63902249 CTGATACAACAGTAGGAAGATGG + Intergenic
1109606631 13:64705813-64705835 CAGAATTAAGAGAAGGAAAAGGG - Intergenic
1110471084 13:75861170-75861192 CAGAGTCATCAGTATGTAGAAGG + Intergenic
1112061393 13:95742803-95742825 CACAGTCCACAGAAGTAAAAAGG - Intronic
1112075270 13:95906772-95906794 CAGAAACAACAGAAGCCAGAAGG + Intronic
1112225711 13:97537942-97537964 CAGTGTCAACAGCCTGAAGATGG + Intergenic
1113793114 13:113041195-113041217 CAGAGTCACCAGAGGGATGAAGG - Intronic
1114981590 14:28171579-28171601 TTCAGTCAACAGAAGAAAGAGGG + Intergenic
1115653033 14:35416948-35416970 CAGAGTCAGGAGTGGGAAGAAGG + Intergenic
1115909421 14:38239173-38239195 CTGAGTCAACACATGGAAGATGG + Intergenic
1116899527 14:50348518-50348540 CAGAGTCTAGTGAGGGAAGAGGG - Intronic
1116910492 14:50458288-50458310 AAGAGTCAAGGGAAGCAAGATGG - Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1116936681 14:50747706-50747728 CCTAGGCAACAGAGGGAAGAAGG + Intronic
1117327638 14:54683997-54684019 AGGAGTCAAGAAAAGGAAGAAGG + Intronic
1117558718 14:56912876-56912898 CAGAGTCAGGGGAAGGATGAGGG + Intergenic
1118236556 14:64010439-64010461 CAGGCTTGACAGAAGGAAGACGG + Intronic
1120129990 14:80795322-80795344 CAGATAACACAGAAGGAAGAGGG - Intronic
1120551264 14:85875965-85875987 CAGAGGCAACAAAAGGAAAGTGG - Intergenic
1120622383 14:86780053-86780075 CAGAGTCAACTGAATCAAAATGG - Intergenic
1120721237 14:87891622-87891644 GAGAGACAAAAGAGGGAAGAAGG + Intronic
1120887392 14:89462571-89462593 CAGAGTCCCCATCAGGAAGAAGG - Intronic
1120963962 14:90151011-90151033 AAGTGTGAACAGGAGGAAGAAGG - Intronic
1120976162 14:90250020-90250042 CAGATACAGCAAAAGGAAGAAGG + Intergenic
1122319595 14:100845732-100845754 CAGAGACAACACAAGGAGGCAGG - Intergenic
1122441788 14:101737033-101737055 CAGAGAAAATAGAAGGCAGAAGG - Intergenic
1122695251 14:103549273-103549295 CAGAGACAGCAGAAGGGAGAGGG + Intergenic
1123960575 15:25395413-25395435 CAGAGTAAACAGAAGTATAATGG + Intronic
1124621583 15:31277031-31277053 CAGAGTCCACAGAGGCAAGCTGG - Intergenic
1124919262 15:34009066-34009088 CAGAATCAACGGAAGCCAGAAGG + Intronic
1125245836 15:37638045-37638067 CAGAGCAAACAGAAGGGAGGAGG + Intergenic
1125795898 15:42403690-42403712 CAGTGTCACCAGAAGCAAGCAGG - Intronic
1126445241 15:48735783-48735805 TAAAGCAAACAGAAGGAAGAGGG + Intronic
1127159550 15:56166989-56167011 GAGAGTCAACCAAAGGAGGATGG - Intronic
1127250799 15:57235659-57235681 CAGAATCAGGAGAAGGAATATGG - Intronic
1127396904 15:58550368-58550390 AAGCATCAAGAGAAGGAAGAAGG + Intronic
1127488640 15:59441581-59441603 CAGTTTCAACAGAAAGATGAGGG - Intronic
1128198150 15:65779153-65779175 CAAATTCAAGAGAAGGAAAAAGG + Intronic
1128443034 15:67731259-67731281 CTGTGTCACCAGCAGGAAGAGGG - Intronic
1128608975 15:69058765-69058787 CAGACTCAACAGAGGGAAAGAGG - Intronic
1128823640 15:70687352-70687374 CAGAGTCTGCTGAAGAAAGAAGG - Intronic
1129697804 15:77750498-77750520 AAGAGGCAACAGCAGGGAGAAGG - Intronic
1129847176 15:78773276-78773298 CAGAGTCAGGAGAAGAAAGCTGG + Intronic
1130077854 15:80705108-80705130 AAGAGGCAAGAGAGGGAAGATGG + Intronic
1131382218 15:91973468-91973490 CAGATGCAACAGCAGGAAGAAGG + Intronic
1132137094 15:99351915-99351937 CAGAGGCAACATCAGGAATAAGG + Intronic
1133290352 16:4716567-4716589 CAGAGTCAAAAGTAGGATGGGGG - Intronic
1133563462 16:6970838-6970860 CAGCATCAATAGAAGAAAGAAGG + Intronic
1134011023 16:10853216-10853238 CAGAGTGAATAGAATGAAGTAGG + Intergenic
1134569968 16:15282676-15282698 CAGAGTCAACAAATGGAACCAGG + Intergenic
1134732410 16:16473374-16473396 CAGAGTCAACAAATGGAACCAGG - Intergenic
1134848687 16:17462415-17462437 CAGAGGCATCACAAAGAAGATGG - Intronic
1134935028 16:18238590-18238612 CAGAGTCAACAAATGGAACCAGG + Intergenic
1136255204 16:29034379-29034401 GAGATTCAACATATGGAAGAGGG + Intergenic
1138036439 16:53611695-53611717 AAGTCTCAACAGAAAGAAGACGG + Intronic
1139191880 16:64873671-64873693 TAGAGTCAAGAGAATGAGGATGG + Intergenic
1139289917 16:65848471-65848493 AAGATTTAACAGAAAGAAGAAGG + Intergenic
1140057680 16:71539635-71539657 CAGTGTGAACAGAGTGAAGAGGG + Intronic
1140996675 16:80266616-80266638 CTGATGCAACAGAAGGAAGAGGG + Intergenic
1141039619 16:80661643-80661665 CAGAGCCAACACCATGAAGAGGG - Intronic
1141623285 16:85248390-85248412 CAGAGGAAACAGAAAGAAGAGGG - Intergenic
1143986029 17:10915208-10915230 CATAGTCAATAGAAGGAGAAAGG + Intergenic
1144046908 17:11462174-11462196 CAGAGAGGACAGAAGCAAGAGGG - Intronic
1145238733 17:21227088-21227110 CGGAGTCAGAAGAAGGAGGATGG + Intergenic
1146372082 17:32271107-32271129 CTGAATCAACAGAAGGAATCAGG - Intronic
1147377719 17:40032807-40032829 CAGAGTCCACAGAAGGGTGACGG - Intronic
1147382053 17:40062059-40062081 CAGAGTCAATCTAAGGAAGACGG - Intronic
1147572246 17:41578599-41578621 AAGAGACAACATGAGGAAGAAGG - Intergenic
1147759578 17:42788649-42788671 CAAAGTCAGCAGAGGGGAGAAGG - Intronic
1147981933 17:44280157-44280179 CAGGGTCAGGGGAAGGAAGAGGG - Intergenic
1148063281 17:44851070-44851092 CAGAGGCCACAGAAGGAAGCAGG + Exonic
1148546382 17:48522319-48522341 CAGAGCCAACAGGAGGAGGCTGG + Intergenic
1148598770 17:48878262-48878284 CAGAGCCCTCAGCAGGAAGAGGG + Intergenic
1148999170 17:51739478-51739500 CAGAGTCAAGTGGAGGAGGATGG + Intronic
1149114081 17:53070629-53070651 CAGAGACTGCAGAAGGAAAATGG - Intergenic
1149349335 17:55771524-55771546 CTCAGTCTACAGAAGGAAAAAGG + Intronic
1149560657 17:57605757-57605779 CAGAGGCAGCTGAAAGAAGAGGG - Intronic
1150207442 17:63419771-63419793 CAGAGAGGCCAGAAGGAAGATGG + Intronic
1150437465 17:65165115-65165137 CAGAGCAGACAGGAGGAAGAAGG - Intronic
1151181183 17:72329792-72329814 CACAGTGGCCAGAAGGAAGATGG - Intergenic
1151384022 17:73744256-73744278 CAGAGTGAAAGGCAGGAAGAGGG - Intergenic
1151760322 17:76098022-76098044 CACAGACAACAGAAGGAAGCAGG + Intronic
1151820345 17:76493586-76493608 CAGAGTTAGCAGAGGGGAGAGGG + Intronic
1152367467 17:79864881-79864903 CAGAGGCCACAGCAGGAGGAGGG - Intergenic
1152947607 17:83206430-83206452 GAGACTCAAGAGGAGGAAGAGGG + Intergenic
1154282723 18:13020468-13020490 AAGTGTCCACAGAAGGATGAGGG - Intronic
1154413728 18:14160734-14160756 CAGATGCAAAAGAATGAAGATGG + Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156547881 18:37983881-37983903 CAGAGCTCACAGGAGGAAGAAGG - Intergenic
1157081142 18:44526634-44526656 AAGAGGCAACAGAATGCAGAAGG + Intergenic
1157836815 18:50911500-50911522 GAGAGTTAACAGAGGGAAGTAGG + Intronic
1159000094 18:62965920-62965942 GGGAGCCTACAGAAGGAAGACGG + Intronic
1159761835 18:72436371-72436393 CTAAGACAACAGAATGAAGAGGG - Intergenic
1159955499 18:74515851-74515873 CAGAGGCACCAGGAGTAAGAGGG - Intronic
1160821128 19:1058693-1058715 TAGTGTGAAGAGAAGGAAGAGGG - Exonic
1161168543 19:2801717-2801739 CAGAGTCCCCACCAGGAAGAAGG - Intronic
1161585272 19:5102341-5102363 CAGAGGCAACTGCAGGAAGGAGG - Intronic
1162377983 19:10316317-10316339 CAGAGTCAAGGGAGGGAAGCTGG + Exonic
1162916011 19:13874802-13874824 CAGAGTCACCGGCAGGAGGATGG - Intronic
1163902542 19:20117452-20117474 CAGAGCCAGAAGAAGGAAGGAGG - Intronic
1164142180 19:22481531-22481553 CAAAGTCAACAGAAATAAAAAGG + Intronic
1164859344 19:31550450-31550472 CAGAGTGAAGAGAGTGAAGATGG + Intergenic
1165895064 19:39136463-39136485 CTGACTGAACAGAAGGAAGGAGG - Intronic
1166125221 19:40711176-40711198 AAGAGTCACCAGAAGACAGAGGG - Intronic
1167190129 19:47981655-47981677 CAGAGTAAACTGAGGGCAGATGG - Intronic
1168607388 19:57770775-57770797 CAGAATCCACAGTAGGAAGTAGG + Intronic
1168673119 19:58256501-58256523 AAGAATCAACAGAAGCAAAATGG + Intronic
925725479 2:6866459-6866481 GAGAGTCAGCAAAAGGGAGAGGG - Intronic
926056985 2:9779411-9779433 CAGAGTCTCCGGAAGGAAGATGG + Intergenic
926377017 2:12240703-12240725 CAGAGGAAAGAGAAGGAACATGG - Intergenic
926702837 2:15815308-15815330 CTGAGGAAACAGAAGGAAGGAGG - Intergenic
926991193 2:18682286-18682308 GAGAGTCAACAGCATGTAGATGG + Intergenic
927495847 2:23551182-23551204 CAGCGTAAACTGAGGGAAGAAGG - Intronic
928310327 2:30204497-30204519 AAGAGGCAACAGAAGCAAAAGGG - Intergenic
928752143 2:34482967-34482989 CACAGTCAACATATGGATGAGGG - Intergenic
928997935 2:37315597-37315619 CAGAGAAAACAGGAGGTAGAGGG - Intronic
930225684 2:48790194-48790216 CAGACACAGCAGATGGAAGAAGG + Intergenic
930558802 2:52933489-52933511 CAGAATCAACACAAGACAGAGGG + Intergenic
932457444 2:71858450-71858472 AAGAGACAAGTGAAGGAAGAAGG + Intergenic
933161119 2:79026213-79026235 CAGAGCCAAGAAAAGGAGGAAGG + Intronic
933260107 2:80122995-80123017 CAGAGACAGCAGAAGTGAGACGG - Intronic
934562189 2:95319194-95319216 CAGAGTCTGCAGGAGGAAGGCGG + Intronic
934948273 2:98557912-98557934 CAGAGTGTACAGGAGGAAGGCGG - Intronic
936073949 2:109389909-109389931 CAGATTCAGGAGAAGGCAGATGG - Intronic
936099566 2:109563364-109563386 CAGAGTAAACAAAAGAAAGGGGG - Intronic
936378788 2:111965841-111965863 CAGAGGAAACAAGAGGAAGAGGG - Intronic
936712282 2:115144871-115144893 AAGAGTCAACACTTGGAAGAAGG - Intronic
937629591 2:124085544-124085566 CAAAGGTAGCAGAAGGAAGAGGG - Intronic
938978296 2:136500848-136500870 GAGAGTTAACAGAAGGTACATGG - Intergenic
939193958 2:138949480-138949502 GAGAGTTAACAGAATAAAGAAGG + Intergenic
939545566 2:143548217-143548239 CAGGGGCAAAAGAAGGAAGTGGG + Intronic
939588153 2:144030615-144030637 TAGATTCAAACGAAGGAAGAAGG + Intronic
939880103 2:147621591-147621613 CACATCCAACAAAAGGAAGAGGG + Intergenic
941279655 2:163534315-163534337 AGGAGTCATCAGCAGGAAGATGG - Intergenic
941416862 2:165231705-165231727 CAGAGAGAACAAAAAGAAGAGGG - Intergenic
941595646 2:167473675-167473697 CACAATCAAGAGATGGAAGAAGG + Intergenic
942990942 2:182201793-182201815 CAGAGTCACCAAAAGGAGAAAGG + Intronic
943079128 2:183236207-183236229 CAGTGTAAACAGAAAGAATAGGG + Intergenic
943101041 2:183486900-183486922 CAGGGTCCAGAGAAGGCAGAGGG + Intergenic
943347336 2:186754933-186754955 CATTTTGAACAGAAGGAAGATGG + Intronic
943794446 2:191974306-191974328 CAGACTCAACTGAAAGAAGAAGG - Intronic
943851099 2:192724090-192724112 CAGAGTCCCCACCAGGAAGAAGG - Intergenic
943976915 2:194493655-194493677 CAGAGAAAAGAGAAGGAAGCTGG + Intergenic
944321654 2:198351801-198351823 CACAGACAACAGAACAAAGAGGG + Intronic
946536968 2:220641193-220641215 CAGAAACAGCAGAAGCAAGAAGG + Intergenic
946714566 2:222539677-222539699 CAGAAACAGCAGGAGGAAGATGG + Intronic
947483042 2:230520800-230520822 TAGGGTCAGGAGAAGGAAGAGGG + Intronic
947742567 2:232491287-232491309 CAGAGTAACCAGAGGAAAGAGGG - Intergenic
947812983 2:233015823-233015845 GAGAGTGAGCAGAAGGATGAGGG - Exonic
948695855 2:239732717-239732739 CCCAGTCAAAAGAAGGAAGAAGG + Intergenic
1168803522 20:659553-659575 AAGAGTCAAAAGATGGAAGATGG - Intronic
1168874411 20:1160917-1160939 CAAGGCCAACAGAAAGAAGATGG + Intronic
1169079972 20:2792032-2792054 CAGTGTCAACAAAGGCAAGAGGG - Intergenic
1169863870 20:10179340-10179362 CAAAGACCAAAGAAGGAAGAAGG - Intergenic
1170757321 20:19215573-19215595 AAGGGCCAACAGAAGGAAGGAGG - Intronic
1171238414 20:23546384-23546406 CAGGGTCAAGAGAAGGACCAAGG + Intergenic
1171243252 20:23588043-23588065 CAGGGTCAAGAGAAGGACCAAGG - Intergenic
1173016610 20:39231599-39231621 CTGAGTCCACAGAAGGGAAAAGG - Intergenic
1174383202 20:50170905-50170927 CAGAGGGAACGAAAGGAAGAGGG + Intergenic
1174592736 20:51658981-51659003 CAGAGGGAACGGGAGGAAGATGG - Intronic
1174638543 20:52023020-52023042 CAAAGAAAGCAGAAGGAAGAAGG - Intergenic
1176859296 21:13997521-13997543 CAGATGCAAAAGAATGAAGATGG - Intergenic
1177406823 21:20679856-20679878 CAGAGTCAACAAAAGCAAACCGG + Intergenic
1177666104 21:24161719-24161741 CAGAGTCCCCATCAGGAAGAAGG + Intergenic
1177703598 21:24671403-24671425 GAGAGTCTACAGAAGACAGAAGG - Intergenic
1178055670 21:28796009-28796031 CAGAGAAAACAGGAGGTAGAGGG - Intergenic
1178125845 21:29514866-29514888 CACATTCAAAAGAAGGAAAATGG - Intronic
1179425217 21:41272403-41272425 CAGAGTACTCAAAAGGAAGAAGG - Intronic
1179427505 21:41293588-41293610 AAAAGTTCACAGAAGGAAGATGG - Intergenic
1179588022 21:42386164-42386186 GAGAGTCACAAGATGGAAGATGG + Intronic
1180931171 22:19592957-19592979 CAGAGTCTACAGAAATGAGATGG + Intergenic
1182079298 22:27517937-27517959 CAGCCCCAACAGAAGGAAAATGG + Intergenic
1182462462 22:30492194-30492216 GAGACTCAACAGAGGGCAGAGGG + Intronic
1182467430 22:30525971-30525993 GAGACTCAACAGAGGGCAGAGGG + Intronic
1182779026 22:32852663-32852685 CAGAGTTAGCAGACGGGAGAAGG - Intronic
1183023058 22:35042948-35042970 CAGACTGAAGAGAAAGAAGAAGG + Intergenic
1183864629 22:40694451-40694473 CAGCTTCCAGAGAAGGAAGATGG - Intergenic
1184586637 22:45452519-45452541 CATAGTGGACAGAAGGAAGGGGG - Intergenic
1184821064 22:46909636-46909658 CAGCAGCAACAGAAGGAAGAAGG - Intronic
949243424 3:1897001-1897023 CAGAGGAAACAGAAGGCATAAGG - Intergenic
950047139 3:9955467-9955489 CAGAGTCTGCAGAAGGATGCTGG - Intergenic
950486573 3:13277527-13277549 TAGAGTCCACAGAAAGACGAGGG - Intergenic
951758258 3:26116932-26116954 CAAAATCAACAGAAAGAAAAAGG - Intergenic
952186661 3:30976941-30976963 CACAATCAGCAGAAGGAAAAGGG - Intergenic
952207561 3:31195453-31195475 CAAAGTCAATAGAAGGTTGATGG + Intergenic
952887530 3:38020760-38020782 CAGAGTGAACTGAAGGAAGCTGG + Intronic
953787284 3:45920713-45920735 CAGAGTAAACAGAGGCATGATGG - Exonic
954593496 3:51804483-51804505 CAAGATCAACACAAGGAAGAGGG - Intergenic
955369179 3:58336283-58336305 CTGAGTCACCAGAAGGATGAAGG + Intronic
956039585 3:65132031-65132053 TAGAGCCAACAGAGGGAAGGAGG - Intergenic
956578199 3:70779518-70779540 CAGAGCCAACAGATGAAATAAGG + Intergenic
956689627 3:71863860-71863882 CAGGGTCATCAGAAGGCAGAGGG + Intergenic
958822576 3:98992464-98992486 CAGAGGAAACTGAAGGGAGAGGG - Intergenic
958894124 3:99811302-99811324 CAGAATCATCAGAAGGAAAATGG - Intergenic
959946737 3:112133237-112133259 CAGAGACAGCAGAAAGGAGAAGG + Exonic
960545502 3:118910085-118910107 CAGAGTCAACAGAAGTGGGTAGG - Intronic
960972669 3:123150706-123150728 CAGTGTCTGGAGAAGGAAGAGGG - Intronic
961022612 3:123521654-123521676 CAGAGTCACCACAGGGAGGAGGG + Intronic
961430081 3:126875205-126875227 CAGAATCCAGAGCAGGAAGAGGG + Intronic
961455344 3:127021102-127021124 CAGAGTCACCACAAGGGACATGG - Intronic
962241301 3:133753440-133753462 CAGAGTCAACTGAAGCCAGCAGG + Intronic
962330146 3:134471333-134471355 CAGAGTCAATGCAAGGGAGAGGG + Intergenic
963052900 3:141157789-141157811 CTGAGCCAACAGAGGGCAGAAGG + Intergenic
963547287 3:146676159-146676181 CAGATTCAACAGAGGGACTATGG + Intergenic
964301233 3:155287684-155287706 CAGAGTCACCGGGAGGAAAAAGG + Intergenic
965117368 3:164508486-164508508 GAGAGAAAACAGAAGAAAGAAGG - Intergenic
965168379 3:165226730-165226752 GAGAGTCAAAGGAAGGAAAATGG - Intergenic
965529098 3:169753112-169753134 CAGAGTTAACACCAGGAAAAAGG + Intergenic
965690053 3:171346148-171346170 CAGATGAAACAGCAGGAAGAAGG + Intronic
966757582 3:183385902-183385924 CAGTGTCCAAAGCAGGAAGAAGG - Intronic
966773792 3:183526448-183526470 CAGAGTCAACAGAAATCAGTGGG + Intronic
967264492 3:187678324-187678346 CAAAGCCAAGAGAAGGAAAAGGG + Intergenic
967419839 3:189260782-189260804 CTAAGTCAACAGGAGGCAGATGG - Intronic
967431329 3:189389289-189389311 AAGATTAAACAGAAGAAAGATGG - Intergenic
967727028 3:192871671-192871693 CAGAGCCAAGAGAATGAAGAGGG + Intronic
967790545 3:193544108-193544130 AAGAGTCCAGAGAAGTAAGAGGG - Intronic
969193886 4:5545505-5545527 CAGAGTTATCAGGAGGAAGCAGG + Intronic
969372524 4:6742977-6742999 CGGAGTCAACAGCAGGAACGAGG + Intergenic
970811589 4:20100458-20100480 CAGAGTCTCCACAAGGAAGCTGG + Intergenic
970954323 4:21792972-21792994 CAGAGTCAACAGATGAGAGAAGG + Intronic
970959341 4:21854791-21854813 CAGAGTCCAAAGAAGAAATAGGG - Intronic
971096458 4:23409911-23409933 CAGAATCAACAGAAGCCAGAAGG - Intergenic
973787780 4:54349629-54349651 CAGAATAAACAGTAGGAACATGG + Intergenic
975167394 4:71192675-71192697 AAAACTTAACAGAAGGAAGAGGG - Intronic
975250840 4:72176193-72176215 CAGATACAGCAAAAGGAAGAAGG + Intergenic
977004463 4:91547530-91547552 AAAAGTAAACAGAAGGAAGAAGG - Intronic
977194833 4:94045569-94045591 CACAAGCAACAGAAGAAAGATGG + Intergenic
978337732 4:107687903-107687925 CAGAGGGACCATAAGGAAGATGG - Intronic
978352881 4:107838892-107838914 CAGTGGCTACAGAAGGCAGATGG - Intronic
978386506 4:108180785-108180807 AAGAGGGAAGAGAAGGAAGAAGG + Intergenic
980796473 4:137690662-137690684 CACAGCCAACAGAGAGAAGAAGG - Intergenic
981141858 4:141278265-141278287 TAGAGTCTTCAGAAGGAACATGG + Intergenic
981235678 4:142412669-142412691 CAGAGAATACAGAAGAAAGATGG - Intronic
981491915 4:145348679-145348701 CAGAGCCCACAGAAGGAGAATGG - Intergenic
981889716 4:149720245-149720267 CAGAGTTAGCAGAAGAAAAATGG + Intergenic
981898072 4:149828263-149828285 AAGAGTAAACAGAAGGCAGATGG - Intergenic
982312059 4:153996787-153996809 CAGAGTCTACACAAATAAGAAGG - Intergenic
982434415 4:155367269-155367291 CAGAGAAAACACAGGGAAGAAGG + Intronic
983018243 4:162641337-162641359 GAGAGTCTTCAGAAGGAACATGG + Intergenic
983279964 4:165667953-165667975 CAGATTCACCAGAGGGAAAAGGG + Intergenic
983569361 4:169187961-169187983 CAGAGACATCAGAGTGAAGAAGG + Intronic
984208065 4:176811353-176811375 CTGATTCTACAGAAGTAAGAAGG - Intergenic
984568621 4:181362671-181362693 CAGACTCACCAGCAGGAAAAAGG + Intergenic
984646273 4:182223948-182223970 CAGAGGCAATGGAAGAAAGATGG + Intronic
985485831 5:147949-147971 CAGTGTAAACAGAATGAAGGGGG + Intronic
985614983 5:914867-914889 CAGAGTCCACAGAAAGGAAATGG + Intronic
985986526 5:3521036-3521058 CAAAGTCAAAAAAAGGAAAAAGG + Intergenic
986422873 5:7601696-7601718 CAGAGTGAAGAGAAGAATGAAGG - Intronic
986615238 5:9610151-9610173 CAGAGGTAACAGAATGAAGCTGG + Intergenic
986776773 5:11022633-11022655 GAGAATCAAGAGAAGGAAAATGG - Intronic
986855939 5:11868813-11868835 CAGAGTCTCCAGCAGCAAGAAGG + Intronic
987605815 5:20134744-20134766 CAAAGTCAAAAGGAGGAAGGAGG - Intronic
988570707 5:32362401-32362423 CAGAGACAAAGGAAGGAAGAGGG + Intronic
989994002 5:50805287-50805309 CATAGTTAACAGAAGAAAGGAGG + Intronic
990231286 5:53715853-53715875 GAGAGTGAACAGAAGCAAGATGG + Intergenic
991154506 5:63415499-63415521 CATAGTCAGCAGAACAAAGAGGG - Intergenic
991332824 5:65510940-65510962 CAGAGTCACCAGCAGCAAGAGGG + Intergenic
992462683 5:76976466-76976488 TATAGTCAACAGAATGGAGAGGG + Intronic
992507863 5:77405921-77405943 GAGAGTCAACAGAAAGGACAAGG + Intronic
993033258 5:82728862-82728884 CACAGTTTACAGAAGGAAAAGGG - Intergenic
993060881 5:83037589-83037611 CAGAGTCATTAGAAGGAAGCAGG + Intergenic
993748476 5:91633025-91633047 CTGTGTCAACAGAAGGAAAGTGG + Intergenic
994076707 5:95659941-95659963 CAGTGTTCAAAGAAGGAAGAGGG - Intronic
994247424 5:97495568-97495590 CTGATTCCAAAGAAGGAAGAAGG + Intergenic
995315014 5:110759814-110759836 CAGGGTCAGAAGTAGGAAGATGG + Intronic
995971489 5:117976320-117976342 CATAGTCAACCGAAGCAAAAAGG - Intergenic
995995036 5:118287590-118287612 CAAAGTCAACAAAAGCAACAGGG - Intergenic
996538912 5:124608555-124608577 CAGAGTGAAGAGAAGGCAGATGG + Intergenic
996985149 5:129552992-129553014 GAGAGTCAACAGTAGGAAGATGG - Intronic
997142480 5:131397524-131397546 CAGATTGAAAAGAGGGAAGAAGG - Intronic
997167038 5:131672326-131672348 TAGAGTCAACAGAGGAAACATGG - Exonic
998744557 5:145243372-145243394 CAGGGTTAACAGAATGAAAAGGG + Intergenic
998894346 5:146782807-146782829 GAGAGGAAACAGAAGAAAGAAGG + Intronic
998965710 5:147538468-147538490 CAGAGAAAACAGAATGAACATGG - Intergenic
999154876 5:149450916-149450938 CAGACCCAGCAGAAGGAAGAGGG - Intergenic
999477342 5:151912664-151912686 CAGAGCCAATAGAAGGAGGATGG + Intronic
1000154744 5:158539411-158539433 CAGAGCTAACAGAAGGAAAGAGG - Intergenic
1001137200 5:169112480-169112502 CAGAGCCTCCAGATGGAAGAAGG - Intronic
1001241011 5:170069829-170069851 CAGAGTCCACAGGAAGAAGAGGG - Intronic
1001859686 5:175043075-175043097 CATAGGCAACAGAAAGGAGATGG - Intergenic
1002591699 5:180295152-180295174 CAGAGTCCCCAGCAGCAAGAAGG + Intergenic
1002741773 5:181439584-181439606 GAGACTCAAGAGGAGGAAGAGGG + Intergenic
1005214983 6:23515324-23515346 CAGAGGAAACAGCAGTAAGAGGG - Intergenic
1005323304 6:24676779-24676801 CAGAGTCACCAGAAAGGAAAGGG - Intronic
1005493131 6:26365306-26365328 CAGAGCCCACAGAATAAAGACGG - Exonic
1006304661 6:33211802-33211824 CGGAGGCAACAGCAGGAAGCAGG + Exonic
1006651417 6:35554874-35554896 CAGAGTCAGCAGCAGGGAGAAGG + Intergenic
1006714795 6:36110272-36110294 CTGAGTCAACTGGAGCAAGAAGG + Exonic
1007855714 6:44854295-44854317 AAGAGTCCATAGAAGGATGATGG - Intronic
1008048339 6:46874336-46874358 AAGAATCAGCAGGAGGAAGAGGG - Intronic
1008932366 6:56954513-56954535 CAGAAGCAACAAGAGGAAGAGGG + Intronic
1009457924 6:63878576-63878598 CAGAGTCTACAGAAGCAGGCAGG + Intronic
1010132423 6:72509882-72509904 CAGAGTCAACAGAATACACATGG - Intergenic
1010402055 6:75457129-75457151 AAGACTCAACATAAGGATGAGGG - Intronic
1012152980 6:95778819-95778841 CAAAGTAAACAAAAGGAAAATGG - Intergenic
1012304431 6:97634544-97634566 CTGAGTCAACACCACGAAGATGG - Intergenic
1012786960 6:103642638-103642660 CAGAGTCTCAAGAAGAAAGAAGG + Intergenic
1013535364 6:111058710-111058732 CAGAGTCAAACAAAGGAGGAAGG + Intergenic
1013670467 6:112396946-112396968 TAGAGTCTACAGCATGAAGAGGG + Intergenic
1014161621 6:118176247-118176269 GAGAGTCATAAGAATGAAGAGGG - Intronic
1014472623 6:121835100-121835122 CAGAGAAAACAGCAGGAACAAGG - Intergenic
1014830188 6:126094130-126094152 CAGAGCCAACAGCAATAAGATGG - Intergenic
1015323345 6:131900602-131900624 CAGAGGCAACAAAAGGAATGGGG - Intergenic
1015678057 6:135772474-135772496 AAGAGTAAACATAAGGAAGGTGG - Intergenic
1017071068 6:150576039-150576061 CAGTGTCTACACGAGGAAGATGG + Intergenic
1017219136 6:151945424-151945446 GAGAATCAACTGAAGGAACAAGG - Intronic
1017232524 6:152088679-152088701 CAGAGTCCCCAGCAGAAAGAAGG + Intronic
1017841468 6:158226058-158226080 CAGAGTCAAAAGATAGAAGTGGG + Intergenic
1018082602 6:160271296-160271318 GAGAGGCAACAAAAGGAAGGAGG - Intronic
1018425334 6:163674882-163674904 CAGAGTGAAGAGGGGGAAGATGG + Intergenic
1018547663 6:164956024-164956046 CACAGTCACAAGAAGGAGGAAGG - Intergenic
1018574480 6:165245004-165245026 CAGAGCCAGCAGGAGGAATAAGG + Intergenic
1019246913 6:170715341-170715363 GAGACTCAAGAGGAGGAAGAGGG + Intergenic
1019312737 7:370611-370633 CAAAGTCCACAGGAGGCAGATGG - Intergenic
1019771681 7:2887233-2887255 CAGAGGAAAAAAAAGGAAGAAGG + Intergenic
1019949837 7:4362416-4362438 CAGAGACCATAGAAGGAACAGGG - Intergenic
1020824237 7:13007464-13007486 CAGAGACCACAGAAGGAATTTGG - Intergenic
1020993746 7:15235066-15235088 CAGAATCTATAGAAAGAAGAGGG - Intronic
1021284176 7:18758990-18759012 TAGAGTCAAAAGAAAGAATAAGG + Intronic
1021371006 7:19846733-19846755 CAGAGACAACATGAAGAAGATGG + Intergenic
1021587327 7:22223088-22223110 CAGAGTCATCAGAATACAGATGG + Intronic
1022923971 7:35042141-35042163 AGGAGTCAACAGAAGCAAGCTGG - Intergenic
1023048514 7:36231703-36231725 CAGAATCAGCAGAAGAAAGGCGG + Intronic
1023461068 7:40397836-40397858 CAGAGTGGACAGAAGGGATATGG - Intronic
1023564174 7:41507166-41507188 CAGAGCCAACACCAGAAAGAGGG + Intergenic
1024272800 7:47655295-47655317 CAGAGTCAACAGAAGGAAGACGG + Exonic
1024839701 7:53571652-53571674 CAGACCCAGGAGAAGGAAGAGGG - Intergenic
1026293416 7:69029240-69029262 CAGAGTCAGCTGAAGAGAGATGG - Intergenic
1027542966 7:79491731-79491753 CAGTGTGAAGACAAGGAAGATGG - Intergenic
1027641635 7:80741058-80741080 TAGAGTCACTAGAATGAAGATGG + Intergenic
1027762747 7:82300650-82300672 GATAGTCAACCAAAGGAAGAAGG + Intronic
1027772854 7:82429378-82429400 TAGAGGCAACAGAAGGAAGAAGG + Intronic
1028217267 7:88149432-88149454 AAGAGTCAAGAGAAAGAAAAGGG - Intronic
1028453972 7:91018482-91018504 CAGAGTCTACACATGGTAGAAGG + Intronic
1028575069 7:92339892-92339914 CAAACTCAAGAAAAGGAAGAAGG - Intronic
1028889608 7:95972228-95972250 CAGAATCAACAGGAGGCAGAAGG + Intronic
1029822286 7:103157914-103157936 AGGAGTCAACAGAAGCAAGCTGG - Intergenic
1029945221 7:104525903-104525925 CAGAGTCAAAAGAAGATAAAGGG - Intronic
1031102886 7:117504313-117504335 CAGAATCAACAGAAGGGATTTGG - Exonic
1031137739 7:117903303-117903325 CAAAGTCCACATAAGGAAAATGG + Intergenic
1032418789 7:131761041-131761063 CACAGTCAACAGAAAGTTGAAGG + Intergenic
1032654584 7:133913791-133913813 CAGAGTCATCAGAATATAGATGG + Intronic
1032803332 7:135333957-135333979 CAAAGTCATCAGAAGGCAGAAGG + Intergenic
1033124745 7:138697810-138697832 AAGAGAGAAGAGAAGGAAGAAGG + Intronic
1033172172 7:139093911-139093933 CAGAGTGATCAGAAGAAAGTCGG - Intronic
1033237880 7:139652772-139652794 CAGAGTTGAGAGAAGGGAGAGGG + Intronic
1034468510 7:151243682-151243704 CAGTGCCAAGAGGAGGAAGATGG - Exonic
1034847523 7:154460373-154460395 CAGAGTGAAGAGACGGAAGTGGG - Intronic
1034936910 7:155205763-155205785 CAGAGTCAGCTCACGGAAGATGG - Intergenic
1035501228 8:92612-92634 GAGACTCAAGAGGAGGAAGAGGG - Intergenic
1035696827 8:1604110-1604132 CAGTGTCCACAAAATGAAGAAGG - Intronic
1037765986 8:21772584-21772606 CAGAGTCAACAGAGGCAATGAGG + Intronic
1038510728 8:28132180-28132202 CAAAGTTAACACAAGGAACAAGG - Intronic
1039577175 8:38632910-38632932 CTGAGTGAACAGAATGGAGAAGG - Intergenic
1040483740 8:47851115-47851137 CAGAGTAAACATAAAGAAGTTGG - Intronic
1040720018 8:50308574-50308596 AAAAGAAAACAGAAGGAAGATGG - Intronic
1040920235 8:52607971-52607993 CAGTGTCAACAGAAACAAAAGGG + Intergenic
1041241983 8:55855991-55856013 CAGTGGCAAAAGAAGAAAGAGGG + Intergenic
1043337896 8:79199682-79199704 CAGAGTCAGAAGAAGGATAATGG - Intergenic
1044493550 8:92849283-92849305 CAGAGTCTGAGGAAGGAAGAAGG + Intergenic
1044533340 8:93332827-93332849 CAGAGTCAACAGCATAAAAAGGG + Intergenic
1044892471 8:96851895-96851917 CTGAATAAAGAGAAGGAAGAGGG - Intronic
1045193726 8:99908760-99908782 CAGAGAGAAGAGAAGGAGGAGGG + Intergenic
1045479694 8:102582115-102582137 CAGAGTCACCAAAAGGCAAAGGG - Intergenic
1045499675 8:102735525-102735547 CAGAGTGACAAGAAGGAAAATGG + Intergenic
1045773159 8:105769334-105769356 CAGAGTCAATCAAAGGAAAACGG - Intronic
1046420613 8:113979093-113979115 GAAAGTAAACAGAAGGAAGTAGG - Intergenic
1047988560 8:130261934-130261956 CAGAATGAACAAAAGGAATATGG + Intronic
1048307076 8:133291939-133291961 CAAACACAACAGCAGGAAGAGGG + Intronic
1048458891 8:134603298-134603320 GGGAGGCAAGAGAAGGAAGAAGG + Intronic
1048477275 8:134754926-134754948 CAGAGCCAAGAGATGGGAGATGG + Intergenic
1048799341 8:138181757-138181779 AAGAGTCATCAGAAGCAATATGG - Intronic
1049010351 8:139883240-139883262 CAGAGTCCCCAGCAGCAAGAGGG + Intronic
1049299079 8:141860338-141860360 CAGAGCCAACAAATGGCAGAGGG - Intergenic
1050572724 9:6958182-6958204 CAGAGTTAACAGGTGAAAGACGG - Intronic
1050712601 9:8482746-8482768 AAGTGGCAAGAGAAGGAAGAAGG - Intronic
1051423884 9:16915379-16915401 CAGAGAAAAGAGATGGAAGAGGG - Intergenic
1051500217 9:17768584-17768606 CAGAGTGAACAAGAGGGAGAAGG - Intronic
1052435435 9:28421950-28421972 CACATGCAACAGAATGAAGATGG + Intronic
1052857905 9:33418399-33418421 CAGAGAGTACAGCAGGAAGAGGG + Intergenic
1055200838 9:73659549-73659571 CAACGTCAACAAAAGCAAGATGG + Intergenic
1055202994 9:73690476-73690498 CAGATTCAAGACAAGGTAGAGGG + Intergenic
1055291447 9:74786121-74786143 CAGATCTAAAAGAAGGAAGAAGG + Exonic
1055513790 9:77018366-77018388 CAGAGAGAAGAGAAGCAAGAAGG + Intergenic
1055570943 9:77616494-77616516 CTAAGTCAGCAGCAGGAAGATGG + Intronic
1056024858 9:82483331-82483353 TACAGTCTAAAGAAGGAAGAGGG - Intergenic
1056385358 9:86092362-86092384 CAGAGTCAGGAGAAGGAAAGAGG - Intronic
1056468147 9:86879126-86879148 CAGGGTCATCAGAAGGCAGAGGG + Intergenic
1057281954 9:93719791-93719813 CCAAGTCATCAGAAGGAACAAGG - Intergenic
1057370198 9:94464535-94464557 TAGAGTATCCAGAAGGAAGAAGG + Intergenic
1058906122 9:109484028-109484050 CAGAGTGAAGAGGAGGAAGTTGG - Intronic
1059091249 9:111360963-111360985 CATGGGCAACAGAAGGAAGGAGG + Exonic
1059282329 9:113145562-113145584 CAGAGAGAACAGAAGGGACAGGG + Intergenic
1059432627 9:114259201-114259223 CAGGGTCAAAAGAGGGACGAGGG + Intronic
1059588973 9:115637012-115637034 TAGAGCTTACAGAAGGAAGAGGG - Intergenic
1060192682 9:121603091-121603113 CAGAGGCCACAGTAGGAGGATGG - Intronic
1060496536 9:124123384-124123406 CAGAGGCCAGAGAAGGCAGATGG + Intergenic
1061074452 9:128332651-128332673 AAGAGTGAACAGAAGGGAGTAGG - Intronic
1061187599 9:129063742-129063764 CAGAGTCTACAGAACGGAGTAGG - Intronic
1061297760 9:129686237-129686259 CAGAGTCAAGACAAGGGTGAGGG + Intronic
1061786438 9:133031305-133031327 GAGAGCCAACAGAACAAAGAAGG + Intronic
1062160970 9:135079643-135079665 CAGAGGCTGCAGCAGGAAGAAGG + Intronic
1203607684 Un_KI270748v1:70800-70822 GAGACTCAAGAGGAGGAAGAGGG + Intergenic
1185954035 X:4469461-4469483 CTGAGTAAAGATAAGGAAGAGGG - Intergenic
1186265162 X:7824687-7824709 GCAAGTCAACAGAAGGAAAAAGG - Intergenic
1187845279 X:23529573-23529595 CATAGACAACAGAAGGAAATAGG + Intergenic
1188615393 X:32152109-32152131 CTCATTCAACAGAAGAAAGAAGG + Intronic
1188698676 X:33231704-33231726 AAGAGTCAAGTGAAGGAAGTAGG + Intronic
1189024488 X:37377898-37377920 TAGAGTCAACAACAGCAAGATGG - Intronic
1189294707 X:39910202-39910224 CAGCGTCAACAGCAGGCAGCAGG + Intergenic
1189948149 X:46201784-46201806 CAAGATCAACAGAAGGAAGTTGG - Intergenic
1190653200 X:52587635-52587657 CAGAATGAACTTAAGGAAGAAGG + Intergenic
1193617444 X:83707378-83707400 GAAAGTCAACAGAAAGAAAATGG - Intergenic
1193871306 X:86802367-86802389 AAGAGTCAATGGAAGGTAGAAGG - Intronic
1194022328 X:88707245-88707267 CAGAGTCAAGAGAAGAAGAAGGG + Intergenic
1194639265 X:96383102-96383124 CTGAATTAACAAAAGGAAGAAGG + Intergenic
1195246698 X:103001613-103001635 TAGAGACTACAGCAGGAAGATGG + Intergenic
1195540060 X:106053296-106053318 CAGAGGCTGCAGAAGGAAGGGGG + Intergenic
1195615069 X:106905674-106905696 GAGAATCAGCAGAAGGAAGGAGG + Intronic
1196006540 X:110843316-110843338 CAGAGGAAACAGTAGGAAGTGGG - Intergenic
1196885297 X:120239023-120239045 TAGAGTCAAGAGAAAGAACATGG + Intergenic
1196945742 X:120823750-120823772 CAGAGTCAACATTAGGCAGCTGG + Intergenic
1197835737 X:130692022-130692044 CATATTGAACAAAAGGAAGAGGG - Intronic
1198149254 X:133892190-133892212 CAAAGACAGCAGAAGGAAGTTGG - Intronic
1199977592 X:152903595-152903617 CAGAGACAACTGCAGGATGAGGG + Intergenic
1200383289 X:155862394-155862416 CAAAGTCAAAATAAGGAAGTAGG - Intergenic
1200494021 Y:3859083-3859105 AAGAGTCAACAGACAGAGGAAGG + Intergenic
1202043532 Y:20713028-20713050 CAGATGCATCAGAAGGAAGCTGG - Intergenic