ID: 1024273377

View in Genome Browser
Species Human (GRCh38)
Location 7:47658959-47658981
Sequence GAAGTGTTCAGAGCCTGCTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 228}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024273374_1024273377 1 Left 1024273374 7:47658935-47658957 CCTGCAGCATTTAAAAAATGCAG 0: 1
1: 0
2: 9
3: 39
4: 391
Right 1024273377 7:47658959-47658981 GAAGTGTTCAGAGCCTGCTGGGG 0: 1
1: 0
2: 1
3: 15
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024273377 Original CRISPR GAAGTGTTCAGAGCCTGCTG GGG Exonic
901971737 1:12913799-12913821 GAGGTGCTCAGAGCCTGGGGTGG - Intronic
902013431 1:13287941-13287963 GAGGTGCTCAGAGCCTGGGGTGG + Intergenic
903075612 1:20762804-20762826 CAAGTTTTCAGAACCTCCTGAGG + Intronic
903330286 1:22593630-22593652 GAAGCGGCCACAGCCTGCTGAGG - Exonic
904124824 1:28230907-28230929 GAATAGCTCACAGCCTGCTGGGG + Intronic
904881285 1:33698931-33698953 GATGAGTTCAAAGCCTGGTGAGG + Exonic
907249973 1:53131567-53131589 GTGGTGTTCACAGACTGCTGGGG - Intronic
915469239 1:156115724-156115746 CATGTGTTCAGAGCCAGCTTGGG - Intronic
916290771 1:163164051-163164073 GAAATGTGCAGAGCCCGCTTGGG + Intronic
916845948 1:168650136-168650158 GAAGAGATCAGAGCCTGGAGAGG - Intergenic
917542458 1:175927442-175927464 GTAGTTTTCAGGGACTGCTGTGG - Intergenic
918149274 1:181784106-181784128 GAAGTCTTGAGAGGCTTCTGTGG + Intronic
919882535 1:201910125-201910147 GAAGTGGGCAGAGCTTGGTGAGG + Intronic
920018082 1:202929691-202929713 ATAATGTTCAGAGCCTGGTGCGG + Intergenic
920249189 1:204611355-204611377 GGAGTGATCAGAGCCTCCAGAGG + Intergenic
920272686 1:204778105-204778127 GAAATGTGCAGACCTTGCTGAGG - Intergenic
921285741 1:213607774-213607796 GAAGTGTTGAGTGCGTGTTGGGG + Intergenic
922009598 1:221568943-221568965 GAAGTATGCAGAGGGTGCTGAGG + Intergenic
924029710 1:239873924-239873946 GAAGAGTTCAGTGGATGCTGTGG - Intronic
924453189 1:244197859-244197881 GAAGTTGTCATAGCCTCCTGGGG + Intergenic
924933925 1:248752214-248752236 GAAGTGTTCTGTGCCTGCGTTGG - Intronic
1063718153 10:8550545-8550567 GAAGTGTTGAGAGCTGGCTCGGG + Intergenic
1064111655 10:12544965-12544987 GAAGGGTGAAGAGCCTGATGGGG + Intronic
1064389458 10:14929112-14929134 GAAGTTTTCAGGGCCGGTTGTGG + Intronic
1064902061 10:20305908-20305930 GAAGTGTTCACGACCTACTGTGG + Intergenic
1065808832 10:29421979-29422001 GAAGTGGTCAGAGTCCTCTGTGG + Intergenic
1067344182 10:45426041-45426063 GAAGTGTTCTGGGCCTGGTTGGG - Intronic
1067542971 10:47169877-47169899 GAAGTGTTGATTGCCTCCTGAGG + Intergenic
1068208502 10:53889576-53889598 GAAGTTCTCAGATACTGCTGAGG + Intronic
1068420484 10:56785025-56785047 GAAGTGTTCTGAGCATGTTTAGG - Intergenic
1068733917 10:60390554-60390576 GCAGTGCTCAAGGCCTGCTGGGG + Intronic
1070252598 10:74786010-74786032 TAGGTGTTCTAAGCCTGCTGGGG + Intergenic
1070358392 10:75663021-75663043 TAAGTGTTGAGAGCCTGGTCTGG + Intronic
1071532174 10:86398842-86398864 GAAGTGTTCAAAGGCTACTAGGG + Intergenic
1074761625 10:116670776-116670798 GAAGCTTTCAGAGCCAACTGTGG + Intergenic
1076591900 10:131589157-131589179 GAAGGGTTCTGAGGCTGCTCTGG + Intergenic
1076870701 10:133191879-133191901 GAAGTGTCCAGTGCCTGCCCTGG + Intronic
1079352745 11:19705820-19705842 GCAGTGTGAAGAGCCTACTGAGG - Intronic
1081279526 11:41191281-41191303 CAAGTGTCAGGAGCCTGCTGTGG + Intronic
1083802550 11:65054725-65054747 GCAGCGTTCACAGCCTGCAGTGG + Exonic
1084465301 11:69319864-69319886 GCGGAGCTCAGAGCCTGCTGAGG - Intronic
1085024541 11:73228920-73228942 GGAGTGTGCAGAGGCTGCAGAGG + Intronic
1087094702 11:94307563-94307585 GAAGTGGTTTGAGCCTGCTCAGG + Intronic
1090187380 11:124747201-124747223 CAAGTGTTCAGAGGGTGCCGGGG + Exonic
1090363685 11:126189731-126189753 GCAGGGTCCAGGGCCTGCTGGGG - Intergenic
1090744843 11:129697306-129697328 GAAATGTGCAGAGCTTACTGTGG + Intergenic
1090844268 11:130517874-130517896 GAAGGGCTTAGAGGCTGCTGAGG - Intergenic
1090966534 11:131602337-131602359 GCGGTGTTCAGAGCCTGGTCTGG + Intronic
1091406086 12:210428-210450 GAAGGGATCAAAGCCTGCCGAGG + Exonic
1091582761 12:1799076-1799098 GAACTGAGCAGAGCCCGCTGAGG + Intronic
1092040560 12:5380218-5380240 CAAATGCTCAGAGCCTCCTGCGG + Intergenic
1095643100 12:44507794-44507816 GAAGTTATCAGAACCTGGTGAGG + Intergenic
1096258926 12:50078958-50078980 GGAGTGTGCAGATCCTGCTCTGG + Exonic
1097367557 12:58734604-58734626 GAAGGGTACAGAGCATCCTGTGG - Intronic
1101285327 12:103306111-103306133 GAACTGTTCCAAGCCTGCTTGGG + Exonic
1101963478 12:109266430-109266452 CAAGTCTTCAGGGTCTGCTGAGG - Exonic
1103725077 12:122993706-122993728 GGGCTGTTCAGAGCCTGCAGTGG + Intronic
1104143240 12:126008139-126008161 CAAGAGTTCAAAGCCAGCTGGGG - Intergenic
1108194861 13:47983140-47983162 AAAGAATTCAGAGCCTTCTGAGG + Intronic
1108575092 13:51783680-51783702 GAAGAGGTCAGAGGCTGCAGGGG - Intronic
1109698273 13:65991188-65991210 AAAGTGCTCAGTGCATGCTGTGG - Intergenic
1112433001 13:99368928-99368950 GAAGTGATCAGTCACTGCTGGGG + Intronic
1112433472 13:99373599-99373621 GAAGTGTTCGGGTGCTGCTGAGG + Intronic
1113658646 13:112088140-112088162 GGAGAGTTCAGAGGCTGCAGTGG + Intergenic
1113886256 13:113660115-113660137 TATGTTTTCAGAGCATGCTGTGG - Intergenic
1114454546 14:22846448-22846470 GGAGTGCCCAGAGCCTCCTGAGG - Exonic
1114790754 14:25655534-25655556 GCACTGTTGAGAGCCTGCTATGG - Intergenic
1114896324 14:26995107-26995129 TGTGTGTTCAGAGCCTGCTCAGG + Intergenic
1115181433 14:30630994-30631016 TAAGTATTCTGAGCATGCTGAGG - Intronic
1115533504 14:34348802-34348824 GAAGTGTCCTGGGCCTCCTGAGG - Intronic
1119260239 14:73233899-73233921 GGAGTCTTCAGAACCTGGTGTGG + Intergenic
1119605489 14:76012626-76012648 GAAATGAGCACAGCCTGCTGGGG - Intronic
1119959130 14:78834736-78834758 GAATTGTGCAGATACTGCTGCGG + Intronic
1121984773 14:98494280-98494302 AAAGTGTTCATAGTCTGGTGGGG - Intergenic
1122503880 14:102219452-102219474 GGAGTGTGCTGGGCCTGCTGTGG - Intronic
1122636441 14:103131935-103131957 GCGGAGTTCAGAGCCTGCTAGGG - Intronic
1124213144 15:27780420-27780442 GAAGTCTTCACAGGCTGCTTGGG - Intronic
1124916273 15:33977874-33977896 GGCGTGTTCACAGCTTGCTGCGG - Intronic
1126950114 15:53871447-53871469 TAAATGAGCAGAGCCTGCTGTGG - Intergenic
1127661062 15:61100592-61100614 GAAATCTTCAGAGCCACCTGTGG + Intronic
1130661954 15:85837801-85837823 GGAGTGTTAAGATTCTGCTGGGG - Intergenic
1132350935 15:101139355-101139377 GAGGTCTTCAAAGCCTGCTTAGG - Intergenic
1132935354 16:2477725-2477747 GAGGTGGACAGAGCCTTCTGTGG + Intronic
1133108748 16:3532983-3533005 GAAGAGTCCAGAGCCTCATGAGG - Intronic
1135082041 16:19444740-19444762 TATGTGTTCAGAACCTACTGGGG + Intronic
1137073325 16:35929149-35929171 GAAATATTTTGAGCCTGCTGAGG - Intergenic
1137812894 16:51369951-51369973 GAAGTTTTAAGAGCCTCATGTGG - Intergenic
1137849075 16:51720656-51720678 GAAGTCTTCAGTGCCTTCTAAGG + Intergenic
1139630293 16:68227643-68227665 GATGTGCTCAGAGCCTTCTGGGG - Exonic
1139674984 16:68517467-68517489 GAATTGTTCAGTGCCTGCTTGGG - Intergenic
1139710235 16:68770479-68770501 GATTCATTCAGAGCCTGCTGTGG + Intronic
1141023192 16:80517535-80517557 GAAGAGTTCAGAGACTTTTGTGG - Intergenic
1143104293 17:4520644-4520666 GGAAAGTTCAGGGCCTGCTGAGG - Intronic
1143248473 17:5504890-5504912 GAAGTGTTCATGCCCAGCTGAGG + Intronic
1144670758 17:17131421-17131443 GTCGTGTCCTGAGCCTGCTGTGG + Intronic
1146830414 17:36064303-36064325 GAAGTGGTCAGAGTGAGCTGGGG - Exonic
1147648069 17:42045874-42045896 GAAGTATTCAGAGGCTGGGGAGG - Intronic
1148129680 17:45255355-45255377 GAAGGCTCCAGAGCCTCCTGGGG + Exonic
1148760494 17:49997245-49997267 GAGGCGTTCAGGGCCTGCTTTGG + Intergenic
1151499779 17:74481367-74481389 GGAGGGTACAGAGGCTGCTGGGG + Intronic
1151981506 17:77512776-77512798 GAAGTGTGCAGATCGTGTTGAGG + Intergenic
1152224093 17:79084742-79084764 GAAGTGTGGAGAGGCTCCTGGGG + Intronic
1152316897 17:79586215-79586237 GAAGTGAGCAAGGCCTGCTGAGG - Intergenic
1152633261 17:81420150-81420172 GAGGGGTACAGAGCATGCTGGGG - Intronic
1156383990 18:36589649-36589671 AAGGAGTTCAGAGCCTGCAGAGG - Intronic
1157763679 18:50282413-50282435 GACATGTTCAGTGCCTGGTGGGG - Exonic
1158493392 18:57930719-57930741 GCAGTATTGAGAGCCAGCTGTGG - Intergenic
1159900565 18:74040970-74040992 GCAGTGTTCTCTGCCTGCTGTGG - Intergenic
1159903266 18:74067521-74067543 GAAGTGTCCAGAGAGTGATGGGG + Intergenic
1160191257 18:76715641-76715663 GCAGTGTTTAGAGCATGCTGGGG - Intergenic
1160417324 18:78720512-78720534 CAAGCGTGCAGAGTCTGCTGTGG - Intergenic
1160716528 19:579292-579314 GAAGAGCCCAGCGCCTGCTGAGG - Intronic
1161436898 19:4268882-4268904 GAGGTGTTGAGAGGCTGGTGAGG - Exonic
1161572622 19:5038781-5038803 GCACTGTGCAGAGCGTGCTGGGG - Intronic
1162950126 19:14066464-14066486 GAAGTGGGCAGGGCCTGCTGGGG + Intergenic
1163298920 19:16430672-16430694 GCATTTTTCAGAGCCTGCAGTGG - Intronic
1164413680 19:28027411-28027433 GAGGTATTCAGAGGATGCTGTGG + Intergenic
1165434138 19:35787486-35787508 AAAGTGATGGGAGCCTGCTGAGG + Exonic
1166952010 19:46435316-46435338 GATGTGTTCCGATCCTGGTGTGG + Intergenic
1168671165 19:58242454-58242476 TAAGTGTTCAGCGTCTGCAGGGG + Intronic
925044488 2:761638-761660 GGAGTGTTCTGAGCCTGGTGTGG - Intergenic
932042584 2:68317246-68317268 GAAGTCTAAAGAGCCTGATGGGG - Exonic
933493909 2:83023444-83023466 GAAGTGTTCTGAGCCTAAGGTGG + Intergenic
933711087 2:85326774-85326796 TAAGTCTTCAGAGCCTACTGAGG - Exonic
933731128 2:85457000-85457022 GAAGTGGTCAGAGCCCTCTTTGG - Intergenic
935935463 2:108177718-108177740 GAAGTGTGCACACCCTGCTTTGG + Intergenic
936870689 2:117131890-117131912 GAAGTACTCAGAGCCTGTGGTGG - Intergenic
937767068 2:125673898-125673920 GAAGTGTTAAGACCTTGCTCTGG - Intergenic
938105660 2:128528254-128528276 GTAGTGTTCACTGACTGCTGTGG + Intergenic
938113260 2:128584684-128584706 GAAATGTTCAGAGTGTGCTTGGG + Intergenic
942250625 2:174044717-174044739 GAAGTGCTCAAAGACTGATGGGG + Intergenic
1171409791 20:24938433-24938455 TGTGTCTTCAGAGCCTGCTGAGG + Intergenic
1171436148 20:25126143-25126165 TATGTCTTCAGAGCCTGCTGAGG - Intergenic
1172045387 20:32076439-32076461 TAAGTGTTCAGACCCTGGAGTGG - Intronic
1172970851 20:38872107-38872129 GAGGTGCACAGAGCCTGCTGAGG + Intronic
1173461413 20:43246298-43246320 CAACAGTTCAGAGCATGCTGAGG + Intergenic
1173828141 20:46060428-46060450 TAAGTGTTCACTGCCTCCTGGGG - Intergenic
1175869892 20:62203911-62203933 CAGGTGTTCTGAGGCTGCTGGGG - Intergenic
1175916204 20:62427171-62427193 GAAGTGTCCATGGTCTGCTGAGG - Intronic
1178842841 21:36151709-36151731 GAAGTTCTCAGAACCTCCTGAGG + Intergenic
1179050777 21:37887064-37887086 GAAGGCTTCTGAGCCTGCTTGGG + Intronic
1181787315 22:25236554-25236576 GAAGTGCTCAGAGGTGGCTGTGG + Intergenic
1183099503 22:35575219-35575241 GTAGTTTTGAGAGCCTGCTAGGG + Intergenic
1183529677 22:38346682-38346704 AAAGAGCTGAGAGCCTGCTGGGG - Intronic
950658831 3:14453997-14454019 GAAGTGTTCTGGGCAGGCTGCGG - Intronic
951633361 3:24745279-24745301 GAAGTAGTCAGAGCTTGATGTGG - Intergenic
952953313 3:38541780-38541802 GCTGTGTTGAGAGCCCGCTGGGG + Intronic
953392993 3:42544693-42544715 GGGGAGTTCAGACCCTGCTGAGG - Intergenic
953488491 3:43326226-43326248 GAAGTGCTCAGAGCAGACTGTGG - Intronic
953563078 3:44010334-44010356 GAAGCTTTCAGAGCCCGTTGAGG + Intergenic
953877814 3:46676463-46676485 GAAGTGTTGGGAGGCTGGTGTGG - Intronic
954648122 3:52143762-52143784 GCGGTGTCCAGAGCCTGCTGGGG - Intronic
954954628 3:54508344-54508366 GAGGTGTTCAGGGCCTGGTTTGG + Intronic
957409754 3:79824397-79824419 GAACTGTTTCGAGCCTGATGTGG + Intergenic
959904916 3:111700705-111700727 AAGCTGTTAAGAGCCTGCTGAGG - Intronic
961058727 3:123810614-123810636 GAACTGTCCTGAGCCTGTTGGGG - Intronic
961911118 3:130317600-130317622 GGAATGTTCAGAGCCTCCCGAGG - Intergenic
963721037 3:148862245-148862267 GAAAGGCTCAGAGCCTGCTCTGG - Intergenic
967717935 3:192784613-192784635 GAAGTGTTCAAAGAGTGATGGGG + Intergenic
967774494 3:193372377-193372399 CAAGAGTTGAGAGGCTGCTGTGG - Intronic
969367250 4:6703698-6703720 GAGGGGGTCAGAGCCTGGTGTGG - Intergenic
970069927 4:12146430-12146452 GCACTTTTCAGAGCCTTCTGGGG + Intergenic
970268699 4:14319106-14319128 GAATTGTTGAAAGTCTGCTGTGG - Intergenic
971257565 4:25029177-25029199 AATGTATTCAGATCCTGCTGTGG - Intronic
971722841 4:30268776-30268798 GAAGTTTCCAGAGACTTCTGAGG + Intergenic
974729542 4:65843919-65843941 CAAGAGTTCAAAACCTGCTGGGG - Intergenic
975712851 4:77177558-77177580 GCAGTGTTGAGAGCCTGCTGGGG - Intronic
976236082 4:82899141-82899163 GAAGTGTACAGAGCAGGCAGAGG + Intronic
976857243 4:89619239-89619261 GGAGTGAGCAGAGCCTGATGTGG - Intergenic
982062409 4:151617509-151617531 GAACTGTTCAGAGGATGATGAGG - Intronic
984396329 4:179205441-179205463 GAAGTGATCAGAGTCTGTTTTGG + Intergenic
985875687 5:2592166-2592188 GAGGTGTTGAGAGCCGCCTGGGG + Intergenic
986723277 5:10575819-10575841 GAACTGATCAGAGGCTGCTGGGG + Intronic
986826571 5:11528828-11528850 GAAGTCTAAAGTGCCTGCTGAGG - Intronic
987095374 5:14545028-14545050 GAAGAGTTCAGAGCAGGTTGAGG + Intergenic
987681693 5:21144283-21144305 GATTTTTTCAAAGCCTGCTGAGG + Intergenic
989257462 5:39380884-39380906 GAAGTGCTCAGAGACTGATCAGG + Intronic
989285191 5:39691338-39691360 TAAATCTTCAGTGCCTGCTGTGG - Intergenic
990023425 5:51157053-51157075 GAAGTGTTTTGAGGATGCTGAGG + Intergenic
990061021 5:51648479-51648501 GAAGTCTTCAGAGCTACCTGTGG - Intergenic
990085223 5:51968509-51968531 GAAGAGTTCAGAGTTGGCTGGGG + Intergenic
990671980 5:58141859-58141881 GAAGTGGTCAGAGGCTGCATAGG + Intergenic
990987887 5:61657946-61657968 AAATTGCTCAGAGCCTGCAGTGG - Intronic
991601946 5:68360256-68360278 AACTTGTTCAGAGCTTGCTGAGG + Intergenic
992295177 5:75320472-75320494 GAAATTTTCAGAGCCTTCTGGGG - Intergenic
997298643 5:132785987-132786009 TAAGTGTTCCTTGCCTGCTGGGG + Intronic
999742366 5:154566043-154566065 GAAATGGTCAGAGTCTGCAGGGG + Intergenic
1003157434 6:3608409-3608431 GATGAGGGCAGAGCCTGCTGGGG - Intergenic
1003335476 6:5167945-5167967 GATGTGTTCAGAGACTAATGGGG + Intronic
1003422906 6:5974167-5974189 GCTGTTTTTAGAGCCTGCTGTGG + Intergenic
1003463283 6:6352261-6352283 AAAGCATTCAGAGCCTGGTGTGG - Intergenic
1005856422 6:29866535-29866557 GAGGTGTGCAGAGCCTTGTGGGG - Intergenic
1005862258 6:29910865-29910887 GTGGTGTTCAGAGCCTTGTGGGG - Intergenic
1006252531 6:32800136-32800158 TAAGTGTTCTGAGCATGTTGAGG - Intergenic
1010837828 6:80612107-80612129 GAAGCTTTCAGAGCCTGTTGAGG + Intergenic
1012880398 6:104781320-104781342 GAAGTGTTCAAAGACTGATGGGG - Intronic
1013402722 6:109814732-109814754 GAAGTATTCAAAGGCTGATGAGG - Intronic
1015826246 6:137315335-137315357 GAAGTGTGGAGAGACTGATGGGG - Intergenic
1016606407 6:145934046-145934068 GAAGTGTTCAAGGCCAGGTGTGG + Intronic
1017881792 6:158567206-158567228 GCAGTGTTGAGAGCCGGCAGGGG + Intronic
1018066879 6:160130910-160130932 GGAGTGGTCAGAATCTGCTGTGG + Intronic
1020245720 7:6427810-6427832 GAAGTGCTCAGAACATGATGGGG + Intronic
1022445361 7:30465998-30466020 GAAGTGGTCAGAGCTTGAGGAGG - Intronic
1023556005 7:41423584-41423606 GAAGTCTAGAGAGCTTGCTGGGG - Intergenic
1024215718 7:47246481-47246503 AAAGTATTCAGGGCATGCTGGGG - Intergenic
1024273377 7:47658959-47658981 GAAGTGTTCAGAGCCTGCTGGGG + Exonic
1024810243 7:53202559-53202581 GAAGTGCACAGAGCCTGATCTGG - Intergenic
1024881566 7:54091449-54091471 GGTGTGTTCTGAGGCTGCTGGGG + Intergenic
1024993776 7:55255429-55255451 GAACTGTTCAGGGACTTCTGAGG + Intronic
1027176298 7:75905990-75906012 GAACTGTTCAGACAGTGCTGTGG - Intronic
1027738189 7:81962689-81962711 GAAGTGTTCAGATCTTGTTCAGG + Intronic
1028623866 7:92855148-92855170 GAAGTGATGAAAGCCAGCTGTGG - Intergenic
1032400584 7:131621722-131621744 GATGTTTACTGAGCCTGCTGTGG + Intergenic
1034044806 7:147916456-147916478 CAAATGTTCAGAGTGTGCTGTGG + Intronic
1034867233 7:154652120-154652142 GATGTGTTGGGAGCCTGCGGAGG - Intronic
1035033246 7:155878328-155878350 GATGTGTTCTCACCCTGCTGTGG + Intergenic
1036765808 8:11548733-11548755 GACGTGTTCAGAGCTTGGTGAGG - Intronic
1039921901 8:41898799-41898821 GACCTGCTCAAAGCCTGCTGAGG - Intergenic
1040281553 8:46053030-46053052 GAACATTTCAGAGCCAGCTGAGG + Intergenic
1041058467 8:54012609-54012631 GAAGTGCCCAAATCCTGCTGGGG + Intronic
1044617648 8:94158576-94158598 GCAGTTTTCAGAGCTTGCAGTGG - Intronic
1047759352 8:127942575-127942597 GGAGTGTCCAGAGCTTTCTGAGG + Intergenic
1048476852 8:134751355-134751377 TAAGGGTTCTGAACCTGCTGAGG - Intergenic
1048946439 8:139452737-139452759 TCAGTGTTCAGACCCTGCAGGGG - Intergenic
1049462146 8:142735173-142735195 CAAGTGTGCAGAGCCTGGGGAGG + Intronic
1049530640 8:143153108-143153130 GAAATGTTCAGAGCGTGTTCAGG - Intergenic
1049782681 8:144436012-144436034 GCAGTGCTCAGAGCCGGCTGGGG - Exonic
1056646211 9:88414107-88414129 GAAGTGTTCATGCCCTCCTGTGG + Intronic
1057622204 9:96645966-96645988 GAAGCCTTCAGAGCCTGTGGCGG - Exonic
1057903495 9:98967134-98967156 GAAGGGCTCACAGGCTGCTGAGG + Intronic
1058040364 9:100295556-100295578 TAAGTGTTCAGTGCAGGCTGTGG + Intronic
1060522640 9:124302353-124302375 GAAGGGTACAGAGGGTGCTGTGG + Intronic
1061790429 9:133056148-133056170 GAAGAGTTCAGAGACCGCTTTGG - Intronic
1186218006 X:7320930-7320952 GCAAAGGTCAGAGCCTGCTGAGG + Intronic
1188407806 X:29833478-29833500 GAAGTGTTCAGGGACTCCTTGGG - Intronic
1189179721 X:38992141-38992163 TAAGTCATGAGAGCCTGCTGGGG + Intergenic
1189705728 X:43756822-43756844 GAAGAGTTCAGAGGGTGATGGGG + Intergenic
1189872033 X:45394019-45394041 GAAGTGTTCTGAGGCTGCACAGG + Intergenic
1190731637 X:53230305-53230327 GGAGTGGACAGAGCCTGGTGGGG - Intergenic
1194188977 X:90810958-90810980 CAAGTGTTAAGTGCCTGATGTGG + Intergenic
1195527494 X:105908893-105908915 GCACTGTCCAGAGCCTGCAGTGG - Exonic
1197719139 X:129733133-129733155 GCAGTGTCCAGAGGCTGCTCAGG - Intergenic
1199664607 X:150086902-150086924 GAAGTGATCACAGCAGGCTGGGG - Intergenic
1199907115 X:152244260-152244282 CATGTCTTCAGTGCCTGCTGTGG + Intronic
1200535558 Y:4392859-4392881 CAAGTGTTAAGTGCCTGATGTGG + Intergenic