ID: 1024273377

View in Genome Browser
Species Human (GRCh38)
Location 7:47658959-47658981
Sequence GAAGTGTTCAGAGCCTGCTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 228}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024273374_1024273377 1 Left 1024273374 7:47658935-47658957 CCTGCAGCATTTAAAAAATGCAG 0: 1
1: 0
2: 9
3: 39
4: 391
Right 1024273377 7:47658959-47658981 GAAGTGTTCAGAGCCTGCTGGGG 0: 1
1: 0
2: 1
3: 15
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024273377 Original CRISPR GAAGTGTTCAGAGCCTGCTG GGG Exonic