ID: 1024282249

View in Genome Browser
Species Human (GRCh38)
Location 7:47728962-47728984
Sequence TGCAGTGGCAGTGGAGGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 874
Summary {0: 1, 1: 0, 2: 8, 3: 95, 4: 770}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024282249_1024282256 -4 Left 1024282249 7:47728962-47728984 CCCCAGCCTCCACTGCCACTGCA 0: 1
1: 0
2: 8
3: 95
4: 770
Right 1024282256 7:47728981-47729003 TGCATCTCACAAGAGCTCCAGGG 0: 1
1: 0
2: 1
3: 15
4: 166
1024282249_1024282257 1 Left 1024282249 7:47728962-47728984 CCCCAGCCTCCACTGCCACTGCA 0: 1
1: 0
2: 8
3: 95
4: 770
Right 1024282257 7:47728986-47729008 CTCACAAGAGCTCCAGGGTAAGG 0: 1
1: 0
2: 0
3: 19
4: 181
1024282249_1024282255 -5 Left 1024282249 7:47728962-47728984 CCCCAGCCTCCACTGCCACTGCA 0: 1
1: 0
2: 8
3: 95
4: 770
Right 1024282255 7:47728980-47729002 CTGCATCTCACAAGAGCTCCAGG 0: 1
1: 0
2: 2
3: 25
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024282249 Original CRISPR TGCAGTGGCAGTGGAGGCTG GGG (reversed) Intronic
900109131 1:998272-998294 TACCGGGGCAGGGGAGGCTGCGG + Intergenic
900206073 1:1432415-1432437 TGCAGGGGCAGAGCAGGCTGGGG - Intergenic
900516603 1:3085182-3085204 TGCAGAGGCAGTGCAGCCTTGGG + Intronic
900569146 1:3349841-3349863 TGCGGGGGCTGCGGAGGCTGAGG - Intronic
900735583 1:4297632-4297654 GGGATTGGAAGTGGAGGCTGAGG + Intergenic
900831214 1:4967105-4967127 AGCAGTGGGAATGGAGGTTGGGG - Intergenic
900919362 1:5660984-5661006 GGCAGGGGCAGAGGAGGCAGAGG + Intergenic
900979219 1:6036784-6036806 AGCAGTGGCAGCTGAGGGTGGGG + Intronic
900997610 1:6130841-6130863 TGCAGCTCCAGTGGGGGCTGTGG - Intronic
901005776 1:6170924-6170946 TGCGGTGGCGGGGGAGGCGGAGG - Intronic
901061001 1:6471874-6471896 AGGAGTGGCAGGGGAGCCTGAGG - Intronic
901651356 1:10744935-10744957 TGGAGTGGCCGTGGAGTCTTAGG - Intronic
901751601 1:11413558-11413580 GGCAGTGGCGGAGGGGGCTGGGG - Intergenic
902251347 1:15155685-15155707 TGCTCAGGCAGTGGAGGGTGTGG + Intronic
902808669 1:18876057-18876079 TGCAGTGGACGTGGTTGCTGAGG + Intronic
902818960 1:18932009-18932031 TGCCTTGGCAGTGGAGGTGGTGG - Intronic
902987300 1:20162610-20162632 TGGAGTGTCAGTGGAGGGTCTGG - Intronic
903261841 1:22135852-22135874 TGCACTGGCGGTGGAGGCCTGGG - Intronic
904009208 1:27380372-27380394 AACAGTGGCAGGGGAGGGTGGGG + Intronic
904032164 1:27540056-27540078 TGCAACTGAAGTGGAGGCTGAGG + Intronic
904239618 1:29135242-29135264 GGCAGTGGCAGTGGAGGAGCTGG + Intergenic
904285317 1:29450032-29450054 TGCAGGGGCAGTGGAGGTGGAGG + Intergenic
904665243 1:32115673-32115695 CCCAGTGGCTTTGGAGGCTGAGG - Intronic
905423263 1:37862919-37862941 TGCTGTGTCAGAGGTGGCTGAGG + Intronic
905729292 1:40285220-40285242 TGCAGCTGCTCTGGAGGCTGAGG - Intronic
905946097 1:41902462-41902484 TGCCCTGGCAGTGGGGGGTGGGG - Intronic
905987625 1:42301309-42301331 TGCAGCTGCTTTGGAGGCTGAGG - Intronic
906006871 1:42480993-42481015 TCCAGTTACAGGGGAGGCTGAGG + Intronic
906127992 1:43439352-43439374 TGTGGTGGGAGTGGATGCTGGGG - Exonic
906190946 1:43899162-43899184 AGCGGCGGCAGCGGAGGCTGAGG - Exonic
906551284 1:46668295-46668317 TGCTGTGGTGGTGGCGGCTGCGG - Exonic
906778463 1:48550937-48550959 TGCAATAGCAGTGGAGGAAGAGG - Intronic
907252075 1:53146208-53146230 TGCAGTGGCCATCGGGGCTGGGG + Intergenic
907314630 1:53560527-53560549 TCCAGGGAGAGTGGAGGCTGTGG + Intronic
908021399 1:59902014-59902036 TGTAGTGGGAGTGCAGGCAGAGG - Intronic
908197419 1:61758874-61758896 TTCAGTGGCTTTGGAGGCTGAGG - Intronic
908667633 1:66510363-66510385 TGCAATGGCAGTTGATGGTGGGG - Intergenic
909045414 1:70703782-70703804 TGCAGAGACAGTGGAAACTGAGG + Intergenic
909528125 1:76650152-76650174 TGTGGTGGCAGTGGCGGCAGTGG + Intergenic
909806259 1:79876478-79876500 TGCAGTGGCAGAGGAGTTTTTGG - Intergenic
910333847 1:86105750-86105772 TGAAGTGGCTGTGGTGGTTGAGG + Intronic
910906661 1:92188639-92188661 GGCAGTGGCAGTGGAGACAGAGG + Intergenic
910970767 1:92853500-92853522 TGCAATGCCAGCGGAGGCTTTGG + Intronic
911114991 1:94237565-94237587 TGCAGTGGTGGTGGTGCCTGTGG - Exonic
911952550 1:104193817-104193839 TGCAGTGGTAGTGGATGGTAGGG - Intergenic
913014231 1:114716657-114716679 AGCAGAGGCAGTGGAGCTTGAGG - Exonic
913301232 1:117371546-117371568 TGAAGTGGAATTGGAGGTTGAGG + Intronic
913311372 1:117499413-117499435 TGATGGTGCAGTGGAGGCTGTGG + Exonic
915070310 1:153261031-153261053 GGCAGCGGCGGTGGTGGCTGCGG + Exonic
915298786 1:154940399-154940421 TGGAGAGGAAGTGGAGGGTGGGG + Intergenic
915323766 1:155070211-155070233 CACCGTGCCAGTGGAGGCTGCGG - Intergenic
915359580 1:155277944-155277966 TGAAGTGACCGTGGAGGGTGGGG - Intronic
915524781 1:156468849-156468871 TGCTGTGGCTGTGGCTGCTGTGG + Exonic
915599722 1:156914573-156914595 TGCAGTGGGAGTGGAGGGAGTGG + Intronic
916568150 1:166000447-166000469 TGCAATGGCAGAGGAGGTTTGGG + Intergenic
916752967 1:167740345-167740367 TGGAGTGGCAGAGGCAGCTGTGG - Intronic
917099560 1:171431648-171431670 TGCTCTGCCAGTGGAGCCTGGGG + Intergenic
917214028 1:172659385-172659407 GGCAGCGGTAGTGGAGGCAGTGG - Exonic
917599359 1:176559121-176559143 TGCTGTGGCAGTGTTGGCAGGGG - Intronic
918158253 1:181872225-181872247 TACAGTGGCAGAGGAAGCAGTGG + Intergenic
918951538 1:191146297-191146319 TTCAGTGGTAGTGGTGGCTTTGG - Intergenic
919468020 1:197945689-197945711 TGAAGTGGGAATGGAGGCTCTGG + Intergenic
919750492 1:201034738-201034760 TGCTGGGGCTGTGGGGGCTGGGG - Intergenic
919860537 1:201736980-201737002 TACAGTGGAGGTGGAGGGTGGGG - Intronic
920244303 1:204576343-204576365 TGCAGTGGCAGAGCAGGGGGTGG + Intergenic
920372711 1:205489697-205489719 GACAGTGGAAGAGGAGGCTGAGG - Intergenic
920839047 1:209538487-209538509 TGGAGTGGGAGAGGGGGCTGAGG + Intergenic
922426466 1:225500773-225500795 TCCAGAGGTAGTGGAGGGTGGGG - Intronic
1062803443 10:396891-396913 GGCAGAGGCAGGGGAGTCTGTGG - Intronic
1062885021 10:1009877-1009899 TCCAGTGACACGGGAGGCTGAGG + Intronic
1063636672 10:7788585-7788607 TGCAGTGGAAGTGGAAGCTCAGG - Intronic
1063987186 10:11517372-11517394 TGCAGTGGTAGTGCAGGTGGAGG - Intronic
1064261535 10:13790401-13790423 TGCAGTGGCAGCTGTGGATGGGG + Intronic
1065169058 10:23009899-23009921 CACGGTGGCATTGGAGGCTGTGG + Intronic
1066644122 10:37588132-37588154 TGCAGCTGCTCTGGAGGCTGAGG - Intergenic
1067225439 10:44373235-44373257 TGCCCTGGCAGGGGAGGCTGTGG + Intronic
1067344521 10:45427970-45427992 TGCAGTGGCTGGGGAGGTGGGGG - Intronic
1067407476 10:46036204-46036226 CTCGGTGGCAGTGGAGCCTGAGG - Intronic
1067582239 10:47452975-47452997 TGCAGTAGCAGTGCAGCCAGGGG + Intergenic
1068124942 10:52827791-52827813 TGCACTGGTCTTGGAGGCTGTGG + Intergenic
1069039901 10:63684702-63684724 TGCAGTGCCAGGGGAGCCTAGGG - Intergenic
1069063458 10:63917986-63918008 GGCAGTGGTAGTGGTGGCAGTGG - Intergenic
1069592741 10:69652166-69652188 GGGAGTGGCAGTGGTGGCAGTGG + Intergenic
1069613559 10:69791825-69791847 GGCAGTGGCAGTGAGGGCGGTGG - Intergenic
1069621799 10:69841823-69841845 TGCAGTGGGAAGGGAGGATGAGG + Intronic
1069716110 10:70522568-70522590 TGCAGTGACAATGGAGTGTGAGG - Intronic
1069716173 10:70522874-70522896 TACAGTGGCTGTGGACACTGAGG + Intronic
1071364376 10:84883706-84883728 GGCAGTGACAGGGGTGGCTGGGG + Intergenic
1071667596 10:87576120-87576142 TGCTCTGTCAGTGGAGCCTGGGG - Intergenic
1072359750 10:94647865-94647887 AGCAGTGCCACTGGGGGCTGGGG + Intergenic
1072662918 10:97373543-97373565 GGCTGTGGGAGTGGGGGCTGGGG - Intronic
1072679706 10:97498354-97498376 TGCCGCGGCTGTGGAGGCGGCGG - Exonic
1072693202 10:97584831-97584853 TGCAGTGGCAGTGAAGGGGGTGG - Exonic
1073054149 10:100688399-100688421 TGGGGAGGCAGAGGAGGCTGAGG + Intergenic
1073349031 10:102806095-102806117 TGCAGCTGCTGAGGAGGCTGAGG + Intronic
1073706645 10:105990647-105990669 GGCAGTGGCAGTGGTAGGTGGGG - Intergenic
1074573052 10:114642179-114642201 TGCAGTGGCACTGGGTGCAGTGG - Intronic
1074738772 10:116464379-116464401 AGCAGAGGCACTGCAGGCTGTGG - Intronic
1075465415 10:122647205-122647227 AGAAGGAGCAGTGGAGGCTGTGG + Intergenic
1075534813 10:123261945-123261967 TGCAGTGGATGGGGAGGCAGTGG + Intergenic
1075685815 10:124364519-124364541 TGCAGCAGCAGTGGTGGGTGAGG + Intergenic
1076259622 10:129055123-129055145 TGCAGGGGAAGGGGATGCTGAGG - Intergenic
1076574503 10:131454741-131454763 TACAGAGGCAGGCGAGGCTGGGG - Intergenic
1076703132 10:132284400-132284422 TGCAGGGGCAGGTGAGGTTGGGG + Intronic
1076751036 10:132543242-132543264 TGCAGGGGGTGGGGAGGCTGGGG - Intronic
1077037132 11:500701-500723 TGGGGTGGTGGTGGAGGCTGAGG - Intronic
1077157998 11:1099939-1099961 TGCCGTGGGTGTGGAGGGTGGGG - Intergenic
1077188574 11:1246296-1246318 TGCAGTTGTAGTGGCTGCTGTGG - Exonic
1077189536 11:1250067-1250089 TGCAGTTGTAGTGGCTGCTGTGG - Exonic
1077503723 11:2920646-2920668 AGCAGCGGGAGAGGAGGCTGAGG + Intronic
1077649671 11:3958827-3958849 AGGCGTGGCAGTGGAGGCTGAGG + Intronic
1078147911 11:8734671-8734693 TGCAGTGACTCGGGAGGCTGAGG + Intronic
1078167926 11:8906319-8906341 TGTAGTCCCAGGGGAGGCTGAGG - Intronic
1078316074 11:10294159-10294181 TGCAGCGGCAGTAGCGGCAGCGG + Exonic
1078405681 11:11068122-11068144 TGCAGGGAGAGTGGAGGGTGAGG + Intergenic
1079182313 11:18204565-18204587 GGCAGTGGCAGTGGTGGCAGTGG - Intronic
1079237441 11:18700390-18700412 GGCAGGTGGAGTGGAGGCTGAGG + Intronic
1080408997 11:32005817-32005839 TGCAGAGGCCGTGGCGGGTGAGG - Intronic
1080750087 11:35143019-35143041 TGCAGTGGGTGGGGAGGGTGTGG + Intronic
1081691797 11:45083358-45083380 TGCAGTGGCAGAGGGGCATGCGG + Intergenic
1081695318 11:45105544-45105566 AGCTGTAGCAGTGGAGGCTGAGG - Intronic
1081727225 11:45338882-45338904 TGCAGAGGCAGGAGAGGCTGAGG + Intergenic
1082000894 11:47393250-47393272 TGGAGTGGGGGTGGGGGCTGGGG + Intergenic
1082744719 11:56949360-56949382 TCCAGAGGCACTGGAGACTGAGG + Intergenic
1082881387 11:58041414-58041436 TGAAGGGGCAGAGGAAGCTGAGG + Intronic
1083203076 11:61131896-61131918 TGCAGGGGCACTGAGGGCTGGGG + Exonic
1083401962 11:62429724-62429746 TGCAGTGGCAGAGGTTGCAGAGG + Intergenic
1083638636 11:64133624-64133646 TGCACTGGGAAGGGAGGCTGGGG - Intronic
1083731929 11:64656982-64657004 TGAAGAGGGAGCGGAGGCTGCGG - Intronic
1083999305 11:66287679-66287701 GGCAGTGGCAGTGGCAGCAGCGG + Intronic
1084163887 11:67366201-67366223 TGGAGAGGAAGTGGAGGCAGAGG + Intronic
1084179346 11:67438710-67438732 AGCAGTGGTGGTGGAGGCGGGGG + Exonic
1084714956 11:70867828-70867850 TGCAGGAGCAGTGGAGGCGGTGG - Intronic
1084739888 11:71132910-71132932 TACAGAGACAGTGGAGGCAGAGG + Intronic
1084954200 11:72682931-72682953 TGCAGGTGAAGGGGAGGCTGGGG - Intergenic
1087845221 11:102964659-102964681 TTCACTGCCAGTGGAGCCTGGGG - Intergenic
1088172835 11:107017834-107017856 GGCAGTGGCAGCGGCGGCGGCGG + Exonic
1088830380 11:113531725-113531747 GGCATGGGCAGTGGTGGCTGTGG + Intergenic
1089774331 11:120825862-120825884 GGCAGTGGGGGTGGAGGATGGGG + Intronic
1089832764 11:121343273-121343295 TGCAGTCCCAGCTGAGGCTGAGG - Intergenic
1090074470 11:123571337-123571359 TGCAGTGGGCGTGGGGGGTGAGG + Intronic
1090462689 11:126906077-126906099 TGCAGTGTGATTGGAGCCTGGGG - Intronic
1090824420 11:130374255-130374277 CGCAGTGGGAATGGAGGGTGTGG + Intergenic
1090950804 11:131471608-131471630 TCCAGGGGCATTGGAGGTTGAGG + Intronic
1090958509 11:131535225-131535247 TGCTGTGCTAGTGGAGGCAGGGG + Intronic
1091597944 12:1891263-1891285 GGCATTGTTAGTGGAGGCTGTGG - Intronic
1091893686 12:4083382-4083404 TGGAGGGGCAGTGGGGCCTGGGG - Intergenic
1091934310 12:4423202-4423224 GGCGGCGGCTGTGGAGGCTGAGG - Intergenic
1092253536 12:6914560-6914582 GGCAGTGGCGGCGGCGGCTGCGG - Intronic
1092253537 12:6914566-6914588 GGGAGTGGCAGTGGCGGCGGCGG - Intronic
1092287880 12:7140152-7140174 TGGACTGGATGTGGAGGCTGAGG + Intronic
1092397671 12:8142606-8142628 TGCAGAGGCTCTGGTGGCTGAGG - Intronic
1092720942 12:11439872-11439894 GGCAGTGGAAGAGGAGGTTGTGG + Intronic
1092804535 12:12207416-12207438 GGCTGAGGCAGGGGAGGCTGAGG + Intronic
1093062372 12:14620582-14620604 TGCAGTGGCAGGGAAGGGAGGGG + Intronic
1093104077 12:15065421-15065443 TGCATTTGTAGTGGAGGCTGTGG + Intergenic
1093308149 12:17544516-17544538 TGCACTGGCAGTGGTGGCTGGGG + Intergenic
1094648426 12:32350359-32350381 TGTAGTTTCAGGGGAGGCTGAGG + Intronic
1095225435 12:39672339-39672361 AGCAGTGGCAGCAGAGGCAGTGG + Intronic
1095430518 12:42129063-42129085 TACAGTGGCAGAGGAGAGTGGGG - Intronic
1095537665 12:43270776-43270798 TGCAGCTACAGGGGAGGCTGAGG + Intergenic
1095788871 12:46142930-46142952 TCCTGGGGCAGTGGTGGCTGTGG - Intergenic
1096109902 12:49022395-49022417 GAGAGTGGCAGTGGTGGCTGTGG + Intronic
1096180185 12:49546424-49546446 TGCAGGGGGAGGTGAGGCTGAGG + Intronic
1096524846 12:52204298-52204320 TGCATTGGCAGAGGAGACCGCGG - Intergenic
1096526723 12:52214479-52214501 TGATGTGGCAGTGGGGGCAGGGG - Intergenic
1096550555 12:52369260-52369282 TGCAGAGGAGGTGAAGGCTGTGG - Intergenic
1096650364 12:53059402-53059424 GGCAGGAGCAGTGGCGGCTGAGG - Exonic
1096734471 12:53641787-53641809 TGCAGGGGCCCCGGAGGCTGAGG + Intronic
1096865229 12:54558629-54558651 TGGGGAGGCAGTGGAGGCAGAGG - Intronic
1096967938 12:55643455-55643477 GTCAGTGGCACTGGAGCCTGCGG + Intergenic
1097131513 12:56814325-56814347 TACAGTGGCAGAGAAGTCTGTGG - Intergenic
1097307051 12:58081001-58081023 GGAAGTGCCAGTGGAGGCAGTGG + Intergenic
1097616107 12:61886370-61886392 GGCAGTGGCAGTGGGGGCAGGGG - Intronic
1101373795 12:104153455-104153477 TGTAATCCCAGTGGAGGCTGAGG + Intergenic
1101592801 12:106138906-106138928 GGCGGTGGCAGGGGAGGCGGTGG + Exonic
1101697260 12:107138440-107138462 CGCAGTGGCAGTGGAGGTTGGGG + Intergenic
1101807394 12:108076315-108076337 TACAGTTCCAGAGGAGGCTGGGG + Intergenic
1102089149 12:110172321-110172343 GGCAGAGGCAGAGGAGGCAGAGG - Intronic
1102320673 12:111931242-111931264 TGCAGGGGAAGTGGGGGCAGGGG - Intergenic
1102451228 12:113043514-113043536 CCCAGTGGCAGTGGAGGAAGTGG - Intergenic
1102710065 12:114918080-114918102 TTCAGTGGCATTGGGGGTTGGGG - Intergenic
1103524806 12:121560635-121560657 GGCAGGGGCAGTGGGGGCAGAGG + Intronic
1103867150 12:124062340-124062362 TGCAAGGGCAGTGCAGGCTCAGG - Intronic
1103885896 12:124199961-124199983 AGCAGTGGCTGTCAAGGCTGGGG - Intronic
1104047555 12:125173852-125173874 TGCAGTGGGAGTGGGGGGGGTGG + Intergenic
1104275104 12:127319799-127319821 GGCAGTGGCTGTGGAGACTATGG + Intergenic
1104376204 12:128267145-128267167 TGCGGAGGCTGCGGAGGCTGCGG + Intergenic
1104856606 12:131905137-131905159 TGCAGTGTCTGTGGATCCTGGGG + Intronic
1104934809 12:132358755-132358777 AGAGGTGGCTGTGGAGGCTGAGG - Intergenic
1105031351 12:132886569-132886591 GGCAGTGAATGTGGAGGCTGAGG + Intronic
1105903575 13:24780764-24780786 TCCAGTTGCTGGGGAGGCTGAGG + Intronic
1106129419 13:26927162-26927184 GGCAGTGGTGGTGGAGGCAGTGG - Intergenic
1106380393 13:29232052-29232074 TGTATAGGCAGTGGAGACTGTGG + Intronic
1106516117 13:30455407-30455429 TACAGTGGCACCTGAGGCTGTGG + Intergenic
1106861252 13:33911260-33911282 TGCACTGGTGATGGAGGCTGTGG - Intronic
1107060499 13:36154917-36154939 AGCAGAGGCAGGGGAGGCTCGGG + Intergenic
1107070715 13:36265831-36265853 TGCAGGGGTAGGGGAGTCTGTGG + Intronic
1108258913 13:48637687-48637709 TCCAGTGGGACTGGAGGCTGGGG + Intergenic
1108787463 13:53921717-53921739 CGGAGTGGCTGTGGCGGCTGTGG - Intergenic
1110041872 13:70771406-70771428 TGCTGTGGGAGAGGAGCCTGTGG - Intergenic
1110433594 13:75455189-75455211 TACAGAGGCAGTGGAGTGTGAGG - Intronic
1111654910 13:91140256-91140278 AACAGTGGCAGTGGAGTCTAAGG - Intergenic
1111677292 13:91402959-91402981 TGGTGTGGCAGTGGAGACAGTGG - Intronic
1112455119 13:99553298-99553320 TGAAAGTGCAGTGGAGGCTGTGG - Intronic
1112964863 13:105177017-105177039 TGCAGTGACATTGGATTCTGAGG - Intergenic
1113075782 13:106466740-106466762 AGCAGTAGCAGAGGAGGCTGAGG - Intergenic
1113250651 13:108448979-108449001 TCCAGGGGCAATGGAGGCAGAGG - Intergenic
1113387158 13:109859388-109859410 TGCAGTTGTGGTGGAGTCTGTGG + Intergenic
1113836937 13:113334260-113334282 TGTCGTGGCAGTGCAGGGTGGGG - Intronic
1113879958 13:113619527-113619549 GGCAGTGGCAGTGGCTTCTGGGG - Intronic
1114143281 14:19941999-19942021 TGTAGTGGCAGTGAAGCCTAGGG - Intergenic
1115630266 14:35237772-35237794 TGTAGTCCCAGCGGAGGCTGAGG - Intronic
1115724251 14:36195327-36195349 TGCAGTAACAGTGATGGCTGAGG - Intergenic
1116948014 14:50854208-50854230 TGGAATGGTGGTGGAGGCTGTGG + Intergenic
1116978612 14:51143219-51143241 TCCAGCAGCAGTGGAGGGTGGGG + Intergenic
1118693927 14:68365125-68365147 CAAAGTGACAGTGGAGGCTGAGG + Intronic
1118924333 14:70178099-70178121 TGCAGGGCCAGTGGAGGAAGGGG - Intronic
1119326244 14:73761080-73761102 TGCAGTGGTGGTGGTGGCGGCGG + Intronic
1119508079 14:75190132-75190154 AGCAGTGACAGTGGGGGCTAGGG - Intergenic
1119777829 14:77259310-77259332 TCCAGGGGCAGTGGAGGGTCAGG - Exonic
1119862240 14:77944551-77944573 AGCAGGGGAAGTGGAGGCTCAGG - Intergenic
1120715968 14:87840981-87841003 GGCAGAGGCAGTGGAGGAAGGGG - Intronic
1120909261 14:89650941-89650963 GGCAGTGACAGAGGTGGCTGGGG - Intergenic
1121640110 14:95479654-95479676 TGCAGTGGGGGTGGAGGGCGGGG + Intergenic
1121722682 14:96121745-96121767 TGCAGCTGTAATGGAGGCTGTGG - Intergenic
1121779852 14:96615330-96615352 TCCAGTGGGAGTGGAGGAGGAGG + Intergenic
1122114993 14:99523173-99523195 TGCAGGGGCAGGGGAGGCCCAGG + Intronic
1122156458 14:99753211-99753233 TGCGGGGGCAGTGGGGGGTGGGG - Intronic
1122235085 14:100326856-100326878 CGCAGTGGCTCAGGAGGCTGAGG + Intronic
1122322188 14:100861825-100861847 GGCAGTGGCAGTGGCGGCCGTGG - Intergenic
1122322197 14:100861867-100861889 GGCAGTGGCAGTGGCGGCCATGG - Intergenic
1122323293 14:100868036-100868058 TGCAGTGGCTGGGGGAGCTGAGG - Intergenic
1122608223 14:102962439-102962461 TGCAGCTGCAGAGGAGGCCGGGG + Intronic
1122695462 14:103550115-103550137 TGCACTGGCTGGGGAGGCTCTGG - Intergenic
1122780384 14:104140992-104141014 TGGAGAGACAGTGGAGGATGGGG - Intronic
1122795038 14:104201767-104201789 TGCCGAGGCGGTGGAGACTGTGG + Intergenic
1123065864 14:105618851-105618873 TGCAGTGGCTGCGGTGGCTGCGG - Intergenic
1123070021 14:105638097-105638119 TGCAGTGGCTGCGGTGGCTGCGG - Intergenic
1123074613 14:105661759-105661781 TGCAGTGGCTGCGGTGGCTGCGG - Intergenic
1123089260 14:105734884-105734906 TGCAGTGGCTGCGGTGGCTGCGG - Intergenic
1123095047 14:105763041-105763063 TGCAGTGGCTGCGGTGGCTGCGG - Intergenic
1123475807 15:20592136-20592158 TGCAGGGGCTGCGGAGGCTGAGG - Intergenic
1123642203 15:22408227-22408249 TGCAGGGGCTGCAGAGGCTGAGG + Intergenic
1124378940 15:29148396-29148418 TCCAGTGGCAGAGGAGGTTCTGG - Intronic
1124580027 15:30945430-30945452 AGCAGAGGCAGTGGTGTCTGGGG + Intronic
1124594826 15:31083666-31083688 TCCAGTGGCAGTGGAGCGAGGGG - Intronic
1124783377 15:32656894-32656916 GGCACTGGCGGTGGAGGCTGGGG + Intronic
1125726765 15:41872077-41872099 TGTAGGGGCAGAGGAGGGTGTGG + Intronic
1125933980 15:43618812-43618834 TACAGTGTCAGTGGAGCCTCAGG - Intergenic
1125947077 15:43718274-43718296 TACAGTGTCAGTGGAGCCTCAGG - Intergenic
1126270839 15:46815274-46815296 TGCAGTGTCAGTGAATACTGAGG - Intergenic
1127047518 15:55043005-55043027 AGCAGTGGCAGTGGTGGGTGGGG + Intergenic
1127837376 15:62800688-62800710 TGTAAAGGCAGTGGAGGATGAGG + Exonic
1128957770 15:71966672-71966694 TGGAGTGGCAGTAGAGGTTGGGG - Intronic
1129236111 15:74224661-74224683 AGACGTGGAAGTGGAGGCTGAGG - Intergenic
1129876502 15:78978994-78979016 CCCAGAGGCAGTGGAGGCAGCGG + Intronic
1130314917 15:82787000-82787022 TGGAGAGGCAGCGGAGGCCGAGG - Exonic
1131187394 15:90286390-90286412 TGCAGCTGCTGGGGAGGCTGAGG + Intronic
1131455254 15:92578613-92578635 GACAGGGGCAGAGGAGGCTGGGG - Intergenic
1132036285 15:98487449-98487471 TGGATTGGCAGGGGAGACTGAGG - Intronic
1132068724 15:98755601-98755623 CGTGGTGGCAGTGGAGGCTGAGG + Intronic
1132404972 15:101536535-101536557 TCCAGTGCCAGGGGAGGCTGTGG - Intergenic
1132684481 16:1156601-1156623 TGCGGAGGGAGGGGAGGCTGAGG - Intronic
1132727631 16:1345696-1345718 TGGGGAGGCAGGGGAGGCTGGGG - Intronic
1132734179 16:1377496-1377518 TGCAGGGGGAGTGGAGGCAGAGG - Intronic
1132931795 16:2462441-2462463 TGCTGTGGAGGTGGAGGCGGAGG + Exonic
1132974298 16:2703764-2703786 GGCCGAGGCAGTGTAGGCTGGGG + Intronic
1133110634 16:3546020-3546042 GGCAGGGGCAGTGGACGCAGAGG + Intronic
1133210647 16:4261721-4261743 TGCAGAGGGCGTGGAGCCTGGGG - Intronic
1133335470 16:5004201-5004223 TTCAGTAGCAGGGGAGGGTGGGG + Intronic
1133476294 16:6125076-6125098 AGCAGTGGATGTGGAGGATGGGG - Intronic
1133663718 16:7944504-7944526 GGCAGTGGCATTGGTGTCTGTGG - Intergenic
1133783081 16:8954173-8954195 TGCGGTGCCACTGGAGGCAGAGG + Intronic
1133864152 16:9626190-9626212 TCCAGTGACTCTGGAGGCTGAGG + Intergenic
1136026730 16:27473525-27473547 TTCAGTGACAGAGGAGGCTGAGG + Intronic
1136075940 16:27817268-27817290 AGCAGGGGCAGTGGAGGCTGGGG - Intronic
1136275202 16:29175681-29175703 GGCAGTGGCAATGGAAGCAGAGG + Intergenic
1136344685 16:29667043-29667065 TGCAGTGGGAGAGGAGACGGAGG + Exonic
1137341077 16:47606089-47606111 TGCAGAGGCAGCGGTGGCTCTGG + Intronic
1137570639 16:49564167-49564189 TTCAGTGGCAGTGGCGTTTGTGG - Intronic
1137948451 16:52758450-52758472 TGCATTGGGGGTGGAGGGTGGGG - Intergenic
1138329841 16:56204704-56204726 TGCAGTTTCAGTGGAGGGAGAGG + Intronic
1138590703 16:57998207-57998229 TGCGGTGGCTGTGGCTGCTGCGG + Exonic
1139555640 16:67707982-67708004 GGCAGTGGCGGTGGTGGCTGAGG + Intronic
1139972161 16:70782991-70783013 AGCAGTGGCAGCCGTGGCTGTGG + Intronic
1140151364 16:72370478-72370500 TACAGTGGCACTGGCTGCTGTGG + Intergenic
1140187420 16:72787726-72787748 GGCGGTGGCAGTGGCGGCGGCGG - Exonic
1140187593 16:72788590-72788612 TGCTGTTGCAGTGGGAGCTGTGG + Exonic
1140593994 16:76386881-76386903 TTCAGAGGGAGAGGAGGCTGTGG + Intronic
1140710151 16:77670266-77670288 TACAGTCACAGTGGGGGCTGGGG - Intergenic
1140723096 16:77788632-77788654 TGCGGTGGCTGCGGTGGCTGCGG - Exonic
1140780140 16:78288432-78288454 TGTGGTGGCAGTGGTGGCTGTGG + Intronic
1141141181 16:81497798-81497820 TGCAGCAGCAGAGGAGGCGGCGG - Intronic
1141623097 16:85247581-85247603 AGAAGTGGCAGTGGTGGCAGTGG - Intergenic
1141956596 16:87376081-87376103 TGCTGTGGCAGTGGAGGGCAGGG - Intronic
1142134051 16:88443623-88443645 TGCAGAGGGAGTGGACACTGAGG + Intergenic
1142138561 16:88462486-88462508 TGCTCTGGCTGTGGAGGCAGCGG + Intronic
1142151169 16:88513103-88513125 TGCAGGGGCAGGGGAGGGGGCGG + Intronic
1142410770 16:89915483-89915505 GGGGGTAGCAGTGGAGGCTGGGG + Intronic
1142596775 17:1033607-1033629 TGCAGGGACAGTGAAGACTGAGG - Intronic
1142978442 17:3658483-3658505 TGCTGTGGAAATGGAGGCAGTGG - Intronic
1143034351 17:3985935-3985957 GGAGGTGGCAGTGGAGGCTGGGG - Intergenic
1143344532 17:6240145-6240167 TGCAGTTCCAGTGGAGGTGGGGG - Intergenic
1143514189 17:7411253-7411275 AGCAGGGGCAGGGGAGGCAGCGG + Intronic
1143592577 17:7894428-7894450 TGCAGTGGCCGGGGAGGAGGAGG + Exonic
1143756522 17:9071862-9071884 TGCAGTATGAATGGAGGCTGGGG + Intronic
1144552884 17:16257048-16257070 TGCAGTGGCAGTGGAGTGCATGG - Intronic
1144579092 17:16447885-16447907 TCCACTGGGAGTGGGGGCTGAGG + Exonic
1144655212 17:17030871-17030893 TGAAGTGGCTGGGGAGACTGGGG - Intergenic
1144763193 17:17718872-17718894 AGCAGGTACAGTGGAGGCTGAGG + Intronic
1144783143 17:17817739-17817761 GGCAGTGGCAGCGGTGGCAGTGG - Exonic
1144991806 17:19238117-19238139 TTCCGTGGGAGTGGGGGCTGGGG - Intronic
1145911522 17:28546171-28546193 TGGGGTGGGGGTGGAGGCTGAGG + Intronic
1146094531 17:29916417-29916439 TGCAGTGGCAGTACAGGGTCTGG - Intronic
1146532439 17:33620876-33620898 TGGAGAGGCTGTGGGGGCTGGGG - Intronic
1146744366 17:35314538-35314560 GGCAGCGGCAGTGGCGACTGTGG + Intergenic
1146748571 17:35354485-35354507 TCCTGTGGCAGTGGAGGAGGGGG - Intronic
1147535056 17:41315445-41315467 TGCGGAGGCTGTGGAGGCTGCGG - Exonic
1147535073 17:41315526-41315548 TGCTGTGGCTGTGGGGGCTCTGG - Exonic
1147793077 17:43025276-43025298 TGCAGGGGCGGGGGAGGCGGCGG + Exonic
1147926290 17:43947971-43947993 TGAAGTGGCATTGAAGGCTGGGG + Intergenic
1148084135 17:44984208-44984230 GGCAGTGGCAATGGAGGTGGTGG + Intergenic
1148087096 17:45000922-45000944 ATCAGTGGCAGTGGGGGTTGGGG - Intergenic
1148212093 17:45814740-45814762 CGGAGTGGCAGTGGAAGCAGTGG - Intronic
1148231045 17:45935241-45935263 AGCAGTTGGGGTGGAGGCTGAGG - Intronic
1148386636 17:47238788-47238810 GGGAGTGGCAGTGGCGGCGGTGG - Intergenic
1148656403 17:49286907-49286929 TGCGGTGGCTCAGGAGGCTGAGG + Intergenic
1148860577 17:50602378-50602400 TGGAGCAGCAGTGGAAGCTGGGG - Intronic
1149538072 17:57447804-57447826 GTCAGTGTCAGTGGGGGCTGGGG - Intronic
1149833613 17:59893149-59893171 GGCAGCGGCTGTGGTGGCTGCGG + Exonic
1150137137 17:62702234-62702256 TGCAGTCCCAGTGGAGGAGGTGG + Intronic
1150221317 17:63497300-63497322 GGGAGTGCCGGTGGAGGCTGCGG - Intronic
1150574476 17:66417640-66417662 TGCAGTGACACTGGAGGCAGAGG - Intronic
1150711333 17:67533004-67533026 TGGTGTGACAGTGGAGGCAGTGG + Intronic
1150745977 17:67817047-67817069 TCCAGTTACTGTGGAGGCTGAGG - Intergenic
1151475393 17:74342079-74342101 AGCAGGTGGAGTGGAGGCTGAGG - Intronic
1151755324 17:76072415-76072437 GGCGGTGGCAGTGGCGGCGGCGG - Exonic
1152295262 17:79463662-79463684 GGCAATGGCAGTGGAGGTGGCGG - Intronic
1152295291 17:79463788-79463810 GGCAGTGGCAGTGGAGATGGTGG - Intronic
1152388846 17:79991337-79991359 TGTAGTCTCAGGGGAGGCTGAGG + Intronic
1152574002 17:81132316-81132338 TGCAGTGGGAGGGGAGGCCTGGG + Intronic
1152941745 17:83176442-83176464 AGCAGCAGCAGCGGAGGCTGGGG + Intergenic
1153358566 18:4166441-4166463 TGCAGCTGCTATGGAGGCTGAGG + Intronic
1153424370 18:4945844-4945866 TGCAGTGGCAGAGGAGTTTCTGG - Intergenic
1153634826 18:7104593-7104615 AGCAGTGGGAGAAGAGGCTGTGG + Intronic
1154231216 18:12557625-12557647 TGCAGCGAGAGTGGATGCTGAGG + Intronic
1154481693 18:14833362-14833384 TCCAGTTGCTCTGGAGGCTGAGG - Intronic
1154488335 18:14897294-14897316 TGCAGCTACAGGGGAGGCTGAGG - Intergenic
1156197778 18:34795080-34795102 AGCAGTGGAAGTGGAGGGGGTGG - Intronic
1156264030 18:35469631-35469653 TGCTGTGAAAGTGGAGGGTGAGG - Intronic
1157229509 18:45901104-45901126 TGCAGAGCAAGGGGAGGCTGGGG + Exonic
1157554617 18:48605348-48605370 TCCAGTGACAGTTGAGGCTATGG + Intronic
1157621816 18:49021255-49021277 AGCTGTGGCAGTGGGGGCAGTGG - Intergenic
1158165532 18:54535441-54535463 AGAAGTGGTAGTGGTGGCTGTGG - Intergenic
1158209545 18:55031913-55031935 GCCAGTGGCAGTGGAGGAGGAGG - Intergenic
1158608935 18:58920918-58920940 GGTAGTGGCAGTGGTGGTTGTGG + Intronic
1158756484 18:60331897-60331919 TGCAGCTGCTGTGGAGGATGGGG - Intergenic
1159496952 18:69219356-69219378 CGCAGTGGCTGGGGAGGCTGAGG - Intergenic
1159931166 18:74314746-74314768 AGCAGTGGCAGTGGAGGGAATGG - Intergenic
1160046335 18:75390581-75390603 TCCAGAGACAGAGGAGGCTGTGG - Intergenic
1160125911 18:76171268-76171290 TGCTGTGGGAGAGGAGGCAGAGG - Intergenic
1160318441 18:77868876-77868898 TGCAGTTGCAGTGGTTGCTAAGG + Intergenic
1160326733 18:77957217-77957239 GGCAGTGGCAGTGGTGTCTTTGG - Intergenic
1160846873 19:1169928-1169950 TGCAGGGGCTGTAGAGGCGGGGG - Intronic
1160917691 19:1505250-1505272 TCCAGCTGCTGTGGAGGCTGAGG + Exonic
1161070307 19:2256522-2256544 TGCAATGGCAGGGAAGGGTGGGG - Intronic
1161473339 19:4472293-4472315 TGCAGCGGCGGTAGCGGCTGCGG - Exonic
1161484171 19:4525815-4525837 TCCAGCGGCACTGGCGGCTGAGG - Exonic
1161496845 19:4591210-4591232 TGCAGTCGCAGAGCAGGCTGGGG - Intergenic
1161587949 19:5115509-5115531 GGCAGTGGCAGGGGCTGCTGAGG - Intronic
1161726340 19:5931452-5931474 AGCAGTGTCAGGGGATGCTGCGG + Exonic
1161767940 19:6217187-6217209 TGCAGTTGCCGAGGGGGCTGGGG - Intronic
1161776022 19:6262597-6262619 TGCAGAGGATGAGGAGGCTGAGG + Intronic
1162094804 19:8304026-8304048 TGCAGGGGCAGGGGAGGCCAGGG + Exonic
1162543682 19:11314886-11314908 TTATGTGGCAGTGGAGTCTGGGG + Intronic
1162651269 19:12090821-12090843 CGCAGTGGCGGCGGTGGCTGAGG - Intergenic
1162905311 19:13819511-13819533 GGCAGTGGCAGGGGGAGCTGGGG + Intronic
1163404361 19:17113151-17113173 TGCAGAGGTATTTGAGGCTGAGG + Intronic
1163826781 19:19528526-19528548 CGCAGTGACACGGGAGGCTGAGG - Intronic
1163867681 19:19787983-19788005 TGCATCCGCAGTGTAGGCTGGGG - Intronic
1164988901 19:32670421-32670443 TGCAGTGGCTTGGGAGGCCGAGG + Intronic
1165071358 19:33256593-33256615 TGCAGTGGGTGAGGAGGCCGGGG + Intergenic
1165110308 19:33498505-33498527 GACAGTGGCTGGGGAGGCTGTGG + Intronic
1165332931 19:35151354-35151376 AGCAGAGGAAGCGGAGGCTGAGG - Intronic
1165385463 19:35507945-35507967 TGGAGAGCCAGTGGGGGCTGAGG + Intronic
1165460404 19:35940651-35940673 AGCAGAGGCAGCGGAGGGTGGGG - Exonic
1166140087 19:40800769-40800791 GGCAGTGGTAGAGGTGGCTGTGG - Exonic
1166196149 19:41207148-41207170 TGCAGTTGCAGAGGTGGCTGGGG - Exonic
1166364736 19:42272726-42272748 TGCAGTGGCTGTGGGGGCTGCGG - Intronic
1166394645 19:42430049-42430071 TCCAGTTGCTGGGGAGGCTGAGG + Intronic
1167147825 19:47693751-47693773 AGCAGAGGCAGTGGTGGCGGTGG - Intronic
1167153438 19:47723223-47723245 TGCTGTGTGTGTGGAGGCTGAGG - Intronic
1167436245 19:49480430-49480452 TGCACTGGCAGAGGACGCGGCGG + Exonic
1167570115 19:50281626-50281648 GGCAGGGGCACTGGAGGCAGGGG + Exonic
1167637846 19:50665893-50665915 TGTGGTGGCATGGGAGGCTGAGG + Intronic
1167646784 19:50710330-50710352 TGCCGAGGCAGAGGGGGCTGAGG + Intronic
1167743658 19:51339071-51339093 AGCAGCGGAAGCGGAGGCTGCGG + Exonic
1168672098 19:58248356-58248378 TGCTGTGGCACCTGAGGCTGGGG - Intronic
925513501 2:4653637-4653659 TGGGGTGGGAGTGGAGGCTGAGG - Intergenic
925777046 2:7346072-7346094 TGAATTGGCAGTGGAGTCTAGGG - Intergenic
925984832 2:9207042-9207064 TGCTGCGGCAGTTGAGGCGGCGG + Exonic
926139034 2:10357469-10357491 TGCAGAGGGAGTGGACCCTGTGG + Intronic
926146439 2:10399511-10399533 GGCAGTGGCGGTGGTGGCGGCGG - Intronic
926724527 2:15986955-15986977 TGCAGGGGCAGTGGTGCCCGTGG + Intergenic
927083148 2:19650201-19650223 AGCAGTGGCCGAGGAGGATGAGG + Intergenic
928175564 2:29031778-29031800 GGCAGTGTCATTGGAGGCTATGG + Intronic
928610338 2:32986279-32986301 TGCAGAGGCAGCCGGGGCTGAGG + Intronic
928954324 2:36847113-36847135 TGCTGTGGCATTGGAGACTACGG - Exonic
929829419 2:45335047-45335069 TGCAGTGTCAGTGCTGGGTGAGG - Intergenic
929883776 2:45860638-45860660 TGTAGTGGCTGTGGTGGCTGTGG + Intronic
930262441 2:49163503-49163525 GATACTGGCAGTGGAGGCTGAGG + Intergenic
930493637 2:52109724-52109746 TTCAGTCACATTGGAGGCTGTGG - Intergenic
931527430 2:63172390-63172412 TGCAGTTGCTCGGGAGGCTGAGG + Intronic
931716557 2:65033376-65033398 TGCGGTGGGAGTGGGGGCTATGG + Intergenic
932405784 2:71511966-71511988 GGCAGTGGCACTTGAGCCTGGGG + Intronic
932644682 2:73488225-73488247 TGCAGGGGCAGGGAGGGCTGAGG - Intronic
933728304 2:85438485-85438507 CGCAGGGGCTGTGGAGGCTGGGG + Intergenic
933759401 2:85663599-85663621 TGCAGTGGCAGGGTAGGGGGAGG + Intronic
933774003 2:85760983-85761005 TGCAGTGGCAGCCCAGGCTGGGG + Intronic
933866471 2:86522734-86522756 TGCAGTGTGATTGGAGGCAGTGG - Intronic
933897584 2:86825324-86825346 GGCTGTGGGAGTGGAGGGTGAGG + Intronic
934864348 2:97792604-97792626 GGCGGTGGCAGAGGAGGCTGAGG + Exonic
935103205 2:100016248-100016270 GGCAGTGGTAGTGGTGGCGGTGG + Intronic
935171301 2:100613000-100613022 GGCAGTGGGTGTGGGGGCTGAGG + Intergenic
935328167 2:101956629-101956651 TGCAATGGCCATGGTGGCTGGGG + Intergenic
935693822 2:105753460-105753482 TGCAGTGGCACTGGATGAGGGGG + Intronic
936082807 2:109446500-109446522 AGCAGGAGCAGGGGAGGCTGAGG + Intronic
936480248 2:112879189-112879211 GGTAGTGACGGTGGAGGCTGAGG + Intergenic
936582751 2:113718336-113718358 TCCAGTGACTCTGGAGGCTGAGG - Intronic
936868801 2:117109004-117109026 AGCAGTGGTAGTGGTAGCTGCGG + Intergenic
937325606 2:120988225-120988247 TTCAGTGGCAGTGGGGGCGGCGG + Exonic
937375504 2:121333323-121333345 TGAAGGGGGAGTGGAGGGTGGGG + Intergenic
937545053 2:123005864-123005886 TGCAGTGCTAGTGGAGGCTGTGG - Intergenic
937699437 2:124847284-124847306 TGCAGCTGCTGTGGAGGATGTGG + Intronic
937907359 2:127058772-127058794 TGCAGTGGGGGTGGGGGCTGGGG + Intronic
938088430 2:128416999-128417021 AGCAGTGGCAGTGGTGGAGGTGG - Intergenic
938415441 2:131100240-131100262 TGAAGTAGCAGTAGAGGCTCAGG + Intergenic
940041004 2:149360673-149360695 TCCAGAGGCAGTGGAGACAGTGG - Intronic
940153076 2:150624225-150624247 GGAAGAGGAAGTGGAGGCTGAGG + Intergenic
940579093 2:155553489-155553511 TGCTGGGGAAGTGGAGGCAGGGG - Intergenic
941311796 2:163941860-163941882 TTGTGTGGCTGTGGAGGCTGTGG - Intergenic
942211580 2:173676625-173676647 TGCGGTTGCAGTGGAGCCCGTGG + Intergenic
942467647 2:176225405-176225427 TGCAATGGAGGTGGAGGCTGAGG - Intergenic
942729623 2:179049869-179049891 TTCAGTTGCTGTGCAGGCTGGGG - Exonic
943129674 2:183839996-183840018 TGCAGCTGCTGTGGAGGATGGGG - Intergenic
943234542 2:185300662-185300684 AGGTGGGGCAGTGGAGGCTGTGG + Intergenic
944237780 2:197455879-197455901 AGCCCAGGCAGTGGAGGCTGCGG + Intronic
944403127 2:199351411-199351433 TGCAATGGCTGGTGAGGCTGAGG - Intronic
944668429 2:201975552-201975574 TGGCGTGGAAGTGGGGGCTGGGG + Intergenic
944859780 2:203804295-203804317 TGGGGTGGCAGAGGAGGCTAGGG + Intergenic
944992447 2:205253556-205253578 TGAAGAGGCAGAGGAGGCAGGGG - Intronic
945292087 2:208136740-208136762 TGCTGGGGCAGTGCTGGCTGAGG - Intergenic
946163321 2:217848852-217848874 AGCAGTGGCACTGGAGGCCCCGG + Exonic
946219858 2:218217194-218217216 TGAAGCGGCAGTGGCGGCGGCGG + Exonic
946281097 2:218666005-218666027 GGCAGTGGCAGTGGAAGTAGTGG + Exonic
946332747 2:219019471-219019493 TGGAGTGGGGGTGGGGGCTGGGG - Intronic
946415745 2:219538870-219538892 AGCAGGGGCAGGGGAGCCTGTGG + Intergenic
946528638 2:220547510-220547532 GACAGTGGCAGTGGGGGCAGAGG - Intergenic
947120595 2:226810706-226810728 TGCTGTCTCAGTGGAGGCAGAGG + Intergenic
947178117 2:227387903-227387925 TGTGGTGGCTGTGGTGGCTGCGG - Intergenic
947178121 2:227387921-227387943 TGCTGTGGTTGTGGAGGTTGTGG - Intergenic
947199094 2:227598899-227598921 TGCTGTGGTTGTGGAGGTTGTGG + Intergenic
947200270 2:227608790-227608812 TGCTGTGGTTGTGGTGGCTGCGG + Intergenic
947206591 2:227666810-227666832 TGCTGTGGTTGTGGAGGTTGTGG + Intergenic
947212965 2:227724729-227724751 TGCTGTGGGTGTGGTGGCTGCGG - Intergenic
947215455 2:227745900-227745922 TGCTGTGGGTGTGGTGGCTGCGG + Intergenic
947589892 2:231379557-231379579 CGCAGAGACAGGGGAGGCTGGGG + Intergenic
947625208 2:231614487-231614509 AGCCGGGGCAGGGGAGGCTGGGG - Intergenic
947718489 2:232353360-232353382 GGCAGTGGGGGTGGAGGCTGTGG + Intergenic
947765574 2:232635006-232635028 TGCAGGGGCAGCGGAGGCTCAGG - Intronic
947901571 2:233725207-233725229 GGCAGAGGCAGAGGAGGCAGAGG + Intronic
947901574 2:233725222-233725244 GGCAGAGGCAGAGGAGGCAGAGG + Intronic
947901577 2:233725237-233725259 GGCAGAGGCAGAGGAGGCAGAGG + Intronic
947901580 2:233725252-233725274 GGCAGAGGCAGAGGAGGCAGAGG + Intronic
948058543 2:235027256-235027278 TGGAGTGAGAGAGGAGGCTGGGG + Intronic
948229224 2:236337389-236337411 GGCAGTGGCAGTGGAGGTAGAGG - Intronic
948257511 2:236578672-236578694 TGCTGTGAATGTGGAGGCTGTGG + Intronic
948488597 2:238297118-238297140 TGCATTGGCAGTGCAGCCTCAGG - Intergenic
948563206 2:238867448-238867470 TGCAGTGGCTCTGGGGGCAGGGG + Intronic
948668708 2:239552610-239552632 AGCAGTGGATGTGGAAGCTGAGG + Intergenic
948742526 2:240057131-240057153 TGCAGAGGGAGAGGAAGCTGAGG + Intergenic
948995028 2:241573677-241573699 TCCATTGTCAGTGGAGGGTGAGG + Exonic
949024933 2:241763029-241763051 TGCAGTGGGTGGGGAGGGTGAGG + Intronic
949030733 2:241796005-241796027 GGCACTGGCATTGGAGTCTGAGG + Intronic
1168745201 20:233365-233387 GGCAGGGGCTGTGGGGGCTGAGG + Intergenic
1168750239 20:276954-276976 TGCAGTGGGCCTGGAGGCAGAGG + Intronic
1169194006 20:3673780-3673802 TGCAGTGGCGCCGGGGGCTGTGG - Exonic
1169388923 20:5173771-5173793 AGCAGTGGCATGGGAGGCTGAGG - Intronic
1169451363 20:5714636-5714658 TACAGTGGGAGTGGGGGCAGGGG - Intergenic
1169591414 20:7147056-7147078 GGTAGTGGCAGGGGAGGCTGGGG - Intergenic
1169594559 20:7183168-7183190 TGCAGTGGCACTAGAAGATGGGG + Intergenic
1170918767 20:20655609-20655631 TGGAGAGGCAGGCGAGGCTGGGG + Intronic
1171367013 20:24632111-24632133 TTCTGTGGAAGTGGGGGCTGTGG + Intronic
1171406808 20:24917258-24917280 AGCTGGGGCAGTGGAGACTGTGG - Intergenic
1172328261 20:34054508-34054530 TGATCTGGCAGTGGTGGCTGGGG - Intronic
1172396176 20:34607349-34607371 TCCACTGCCAGTGGAGCCTGGGG - Intronic
1172413414 20:34743221-34743243 TGCTGAGGCAGTTGTGGCTGTGG + Exonic
1172531899 20:35637134-35637156 TGAACTGGAAGTGGAGGCTTTGG - Intronic
1173229398 20:41182460-41182482 CCCAGTGGCAGTGGGGGATGTGG - Exonic
1173527512 20:43744297-43744319 TGCAGAGGCAGTGGGGACTGGGG + Intergenic
1173818981 20:46008699-46008721 TGACTTGGCAGTGGAGACTGCGG + Intergenic
1173843793 20:46175510-46175532 TGGTGTGGCAGAGGAGGGTGAGG - Intronic
1174172460 20:48625911-48625933 GGCAGAGGCGGTAGAGGCTGGGG + Exonic
1175897688 20:62346604-62346626 TGCAATGGCCGTTGAGTCTGGGG + Intronic
1175915978 20:62426057-62426079 AGCAGTGGCAGTGGTGACAGTGG + Intronic
1175915989 20:62426147-62426169 AGCAGTGGCAGTGGTGACAGTGG + Intronic
1175915991 20:62426162-62426184 GACAGTGGCAGTGGAAGCAGCGG + Intronic
1176301732 21:5101865-5101887 TGAAGGGGAACTGGAGGCTGCGG + Intergenic
1178388923 21:32182556-32182578 TGCAGTGGCAGGTGAGCCTCGGG + Intergenic
1178540094 21:33442229-33442251 GGGAGTGGCAGTGAAGGGTGGGG - Intronic
1178596654 21:33960379-33960401 TGCAGAGGCACAAGAGGCTGAGG - Intergenic
1178933057 21:36836210-36836232 TGCAGTGGGAGAGGTGACTGTGG - Intronic
1179032908 21:37735802-37735824 GGCAGTGGCAGTGGCAGCTGGGG + Intronic
1179081819 21:38178598-38178620 GGCAGTGGCGGTGGAGGAGGAGG + Intronic
1179352782 21:40628995-40629017 TGCAGTGGCCAGGGAGGCCGAGG - Intronic
1179540416 21:42079880-42079902 TGCTGTGGCTGTGGCGACTGTGG + Intronic
1179714613 21:43280603-43280625 TGGAGGGGCAGTGGAGGTGGAGG + Intergenic
1179855299 21:44160034-44160056 TGAAGGGGAACTGGAGGCTGCGG - Intergenic
1179987637 21:44930388-44930410 CGGAGTGGCAGTGGGGACTGGGG + Intronic
1180059133 21:45375640-45375662 AGCAGAGGCACTGCAGGCTGGGG + Intergenic
1180088760 21:45523425-45523447 TGGTGTGGCCGTGGAGGCTGTGG - Intronic
1180898866 22:19356797-19356819 TGCAGGGGCAGGGAAGGCAGTGG - Intronic
1181003269 22:19997925-19997947 GGCAGGCGCAGTGGAGGCGGAGG + Intronic
1181172354 22:21016813-21016835 AGAAGTGGCAGTTGAGGCTGGGG - Intronic
1181324008 22:22031017-22031039 TGCAGTGGAGGAGGAGGGTGAGG - Intergenic
1181331666 22:22097760-22097782 TGCAGTGGAGGAGGAGGATGAGG - Intergenic
1181410064 22:22712439-22712461 TGCAGTGAGAGAGGAGGCCGAGG - Intergenic
1181417618 22:22771853-22771875 TGCAGTGAGCGAGGAGGCTGAGG - Intronic
1181886110 22:26023585-26023607 AGCAGTGGCAGTGGGAGCTAGGG + Intronic
1181921266 22:26322311-26322333 GTCAGTGGAAGTGGAGGCTACGG - Intronic
1182296099 22:29311832-29311854 GGCAGGGGCAGTGGGGGCTCGGG + Intronic
1182318569 22:29463825-29463847 TGCAGAGGCTGTGGAGGCCCAGG + Intergenic
1182513956 22:30841748-30841770 TGCAGTGGTTTGGGAGGCTGAGG + Intronic
1182931416 22:34178117-34178139 TGCAGAGGCAGGGGAGATTGGGG - Intergenic
1182969916 22:34564244-34564266 TGCAGTAGCCGTGGAGACAGAGG + Intergenic
1183400665 22:37602011-37602033 AGCTGGGGCAGAGGAGGCTGGGG + Intergenic
1184301079 22:43561445-43561467 GGCAATGACAGTGGTGGCTGAGG - Intronic
1184432592 22:44450097-44450119 TGGGGTGGCTGTGGAGGGTGTGG + Intergenic
1184772676 22:46607114-46607136 TGCAGGAGCAGTGAAGCCTGGGG + Intronic
1185187521 22:49411268-49411290 AGCAGTGGCAGTGGGGGGGGGGG - Intergenic
1185361260 22:50408547-50408569 GGGAGTGGGAGTGGAGGCAGCGG + Intronic
950472408 3:13194264-13194286 AGCAGAGGCAGGGGAGGTTGGGG + Intergenic
950499286 3:13353602-13353624 GGCAGTGGCAGTGATGGCTGTGG + Exonic
950702516 3:14760041-14760063 TGCAGGGGCAGAGGTGGCTGCGG - Intronic
950796659 3:15515923-15515945 GGATGTGGCAGTGGTGGCTGTGG + Intronic
950935354 3:16833972-16833994 TGCAGTGGCACTCCATGCTGTGG + Intronic
951072599 3:18349615-18349637 TGCTGTGGCTGTGGAGGCGGCGG + Exonic
951563831 3:23993257-23993279 TGCAGTGGGGGTGGAGGGGGCGG - Intergenic
951682484 3:25309254-25309276 TGTAGTCTCAGTTGAGGCTGAGG - Intronic
951967122 3:28399251-28399273 TGCAGCTGCTGTGGAGGATGGGG - Intronic
952036649 3:29210781-29210803 TTCAGTAGCAGTGGAGGGTGAGG + Intergenic
952173564 3:30836237-30836259 TGGAGAAGCAGTGGAGGCAGAGG - Intronic
952354385 3:32570824-32570846 GGCGGTGGCGGTGGAGGCGGCGG + Exonic
952549161 3:34456757-34456779 TGTGGTGGTTGTGGAGGCTGTGG + Intergenic
952972090 3:38657878-38657900 ATCAGTGGCCGTGGTGGCTGGGG + Intergenic
953313184 3:41900526-41900548 TGAAGTGGAAGTGAAGGCAGAGG + Intronic
953373130 3:42406801-42406823 TGCGGGGGCACTGGAGGCTATGG - Intronic
954205627 3:49056993-49057015 TCCAGTGGCTGTGCAGGCTGTGG - Exonic
954625559 3:52020189-52020211 TGCAGTGGGGCTGGAGACTGAGG + Intergenic
954666113 3:52253402-52253424 TGGTGAGGTAGTGGAGGCTGTGG - Intergenic
954681477 3:52348453-52348475 TGCAGTGGCAGTGACTGGTGGGG - Intronic
954706392 3:52483005-52483027 TGCAGTGGAGGTGGTGTCTGAGG + Intronic
954739510 3:52737050-52737072 CCCAGCGGCAGGGGAGGCTGAGG - Intronic
954808585 3:53234359-53234381 AGCATTGGCTGAGGAGGCTGTGG - Intronic
955472022 3:59295825-59295847 ACCAGTGGCAGTGGTGGGTGGGG - Intergenic
956757229 3:72400857-72400879 TTCAGTGGTAGTGGTGGCAGTGG - Intronic
958762512 3:98326363-98326385 GGCATCAGCAGTGGAGGCTGTGG - Intergenic
959950353 3:112174481-112174503 TACTGTGGCAGTGGAGGGAGCGG + Intronic
959964200 3:112335087-112335109 GGCACTGGCAATGGAGCCTGAGG + Intronic
960082082 3:113552646-113552668 TCTAGTGGCAGTGGAGGCAGTGG - Intronic
961222152 3:125209707-125209729 TGCAGTGACACAGGATGCTGTGG + Intronic
961326313 3:126111486-126111508 AGCAGTGGCAGTCTAGGCTGGGG - Intronic
961375519 3:126462925-126462947 TGCAGTGGTAGGGGAGGCTGTGG - Intronic
961478552 3:127164359-127164381 TGCTGTGGCAGAGGTGGATGGGG + Intergenic
961504882 3:127363338-127363360 CGCAGTGGCAGTCTCGGCTGAGG - Intergenic
961524774 3:127489748-127489770 TGCAGTCACAGTGGAGGCAAGGG - Intergenic
961585404 3:127918090-127918112 TGCAGCTACAGGGGAGGCTGAGG + Intronic
961708433 3:128807875-128807897 TGCAGAGGCTGTGAAGTCTGAGG + Intronic
962784495 3:138754184-138754206 TGCTGTGGCTCTGAAGGCTGAGG + Intronic
962855736 3:139343278-139343300 GGCAGTGGCAGTGGTGGTGGTGG + Intronic
963029155 3:140950250-140950272 TTCAGGGGCAGTGGGGGGTGGGG - Intronic
963599442 3:147365044-147365066 TTCTGTGGAAGTGGAGGATGAGG + Intergenic
963975907 3:151480620-151480642 TGCAGTGGCAGCCGAGCCTCAGG - Intergenic
964256575 3:154781358-154781380 TGTGGTGGCATGGGAGGCTGAGG - Intergenic
964773106 3:160245285-160245307 TGTGGAGGCTGTGGAGGCTGCGG + Intronic
964773110 3:160245303-160245325 TGCGGAGGCTGCGGAGGCTGCGG + Intronic
964834845 3:160926714-160926736 TGCTATGCCAGTGGTGGCTGTGG + Intronic
964980387 3:162670361-162670383 TGCACTGGAAATGCAGGCTGGGG + Intergenic
965662456 3:171056118-171056140 AGAAGTGGCAGTGGCGGCTGAGG + Intergenic
966100867 3:176267731-176267753 CGTAGTGGCAGTGGAGCCTCAGG + Intergenic
966187821 3:177244080-177244102 CGCAGCTGCTGTGGAGGCTGAGG - Intergenic
966250116 3:177856270-177856292 CCCAGTGGCTTTGGAGGCTGAGG + Intergenic
966714198 3:182999890-182999912 AGCAGTGGTAGTGGCAGCTGTGG + Intergenic
966865824 3:184258809-184258831 TGTGGTGGCAGAGGAGGTTGGGG - Intronic
966899203 3:184468150-184468172 TGCGGAGGCTGCGGAGGCTGAGG - Intronic
967627331 3:191702145-191702167 TGTAGTGTCAGTGGAGGCCATGG + Intergenic
968121612 3:196129885-196129907 TGCAGTTACTCTGGAGGCTGAGG + Intergenic
968573403 4:1353989-1354011 TGGGGTGTGAGTGGAGGCTGGGG + Intronic
968807706 4:2786481-2786503 AGGAGGGGCAGTGCAGGCTGGGG + Intergenic
968903660 4:3442286-3442308 TGGACTGGCCTTGGAGGCTGGGG + Intronic
969032558 4:4226538-4226560 TGCAGCTGCTGTGGATGCTGTGG - Exonic
969517182 4:7654338-7654360 GGCAGAGGCAGTGGACGGTGGGG - Intronic
971281780 4:25247404-25247426 TGCAGTGGAAATGAAGGCTTTGG + Intronic
972052948 4:34764049-34764071 AGAAGTTGCAGTGGAGGCTGTGG + Intergenic
972053011 4:34764370-34764392 TCCACTGCCAGTGGAGCCTGGGG - Intergenic
972121923 4:35713548-35713570 TGCAGTGTTAGTGGGTGCTGTGG - Intergenic
972545848 4:40079722-40079744 AGCATGGGCAGTTGAGGCTGTGG + Intronic
973114915 4:46443932-46443954 TTCAGTTGCTCTGGAGGCTGAGG + Intronic
973280632 4:48357625-48357647 GGAAGTGGAAGTGGAGGCTGCGG - Intronic
974175004 4:58310173-58310195 TGCACTGCCAGTGGAGCCTGGGG + Intergenic
974316093 4:60282548-60282570 TGCAATGACAGTGGAGGATCAGG + Intergenic
975254525 4:72217007-72217029 TGAAGCCGCAGTGGAGGCTCCGG + Intergenic
975667086 4:76742726-76742748 TACAGTGGAAGTGAAGCCTGAGG - Intronic
975738146 4:77401647-77401669 TGCAATGGCGGTTGAGGCTAGGG + Intronic
975808447 4:78138153-78138175 TCCAGTGGCATTGGAGGCTCTGG + Intronic
976468427 4:85398508-85398530 GGAAGTGTCAGGGGAGGCTGAGG - Intergenic
976854845 4:89591316-89591338 CACAGTGGCAGTGGTGGTTGTGG + Intergenic
977482230 4:97593296-97593318 AGCAGTGGAAGGGGTGGCTGTGG - Intronic
977868789 4:102063947-102063969 TGCTTTGGCAGTGGAGGTTAGGG + Intronic
979785601 4:124712553-124712575 TGCAGTTGGAGTGGAGTCTTGGG - Exonic
980231737 4:130054105-130054127 TGCAGTGGCAGTGAAAGATTGGG + Intergenic
980523096 4:133957211-133957233 TACAATGGCAGTAGAGGCAGTGG + Intergenic
980629621 4:135415082-135415104 GGCAATGACAGTGGTGGCTGGGG - Intergenic
982288276 4:153757040-153757062 TGCAGGGGCAGTGGAGAGAGGGG - Intronic
983050943 4:163047391-163047413 TGATGTGGAAGTGGGGGCTGGGG - Intergenic
983544933 4:168953089-168953111 TGCAGCTGCTGTGGAGGATGTGG + Intronic
983577135 4:169271383-169271405 GGCGGCGGGAGTGGAGGCTGGGG + Intergenic
984130152 4:175864919-175864941 TGCAGCTGCTGGGGAGGCTGAGG - Intronic
984711865 4:182892511-182892533 GGGTGTGGCAGGGGAGGCTGAGG + Intronic
984898014 4:184559266-184559288 TGTGGTGGCAGGGGAGGCCGAGG - Intergenic
985129681 4:186726824-186726846 AGCAGCGGCCGTGGAGGCTGCGG + Intergenic
985542487 5:493384-493406 TGGAGGGGCGGTGGAGGCAGTGG + Intronic
985640067 5:1059414-1059436 TGCAGTGACGGCGGAGGCAGGGG - Intronic
985704808 5:1394118-1394140 TTCAGAGGCATTGGAGGATGGGG - Exonic
985972864 5:3392080-3392102 TGGGGTGGCTGGGGAGGCTGGGG + Intergenic
985990917 5:3560579-3560601 TGTTGTGGGAGTGGAGGCTCTGG - Intergenic
986276475 5:6279567-6279589 TGCGGTGGAAGTGGGGGCTCAGG - Intergenic
986814777 5:11396948-11396970 TGCAGTGGATGTGGAGATTGTGG - Intronic
987268470 5:16280242-16280264 TCCACTGTCAGTGGAGCCTGGGG + Intergenic
987318299 5:16744640-16744662 TGCAGAGGGAGCGGTGGCTGGGG + Intronic
987407753 5:17587320-17587342 TGCAGGAGGAGTTGAGGCTGAGG + Intergenic
987579272 5:19767983-19768005 TGCAGTGGAGGTGGAGGGAGGGG - Intronic
988331804 5:29850833-29850855 TGCAGTGGCAGAGGGGATTGAGG + Intergenic
988597068 5:32604872-32604894 TCCAGCTACAGTGGAGGCTGAGG + Intergenic
988771590 5:34438391-34438413 AGCAGTGGCCTTGGAGACTGAGG - Intergenic
988828859 5:34968479-34968501 AGCAGTGGCAGTGGTGGCCTTGG + Intergenic
988921228 5:35944791-35944813 TGGATTCGAAGTGGAGGCTGTGG + Intergenic
989210629 5:38855692-38855714 GGCGGTGGCAGTGGGGGTTGGGG - Intronic
989523095 5:42423809-42423831 TACAGTGGCGGTGGCGGCGGCGG + Intronic
989698403 5:44232062-44232084 GGCAGTGGCAGTGGGGGTGGGGG + Intergenic
989988745 5:50735859-50735881 GGCAGTGGGGGTGGAAGCTGGGG + Intronic
990237955 5:53788145-53788167 TGCTGTGGGAGTTTAGGCTGGGG + Intergenic
990288001 5:54319665-54319687 TACATTGTCAGTGGGGGCTGGGG + Intergenic
990312517 5:54553319-54553341 GACACTGGCAGTGGAGGCTGGGG + Intergenic
993036223 5:82760610-82760632 TGCTCTGCCAGTGGAGCCTGGGG - Intergenic
993338592 5:86693033-86693055 TCCAGTTGCTGGGGAGGCTGCGG - Intergenic
996326999 5:122286484-122286506 TGCAGTCACTGTGGAGGATGGGG + Intergenic
996467811 5:123823751-123823773 TACAGTTAAAGTGGAGGCTGTGG - Intergenic
996790749 5:127290690-127290712 TGCCGGGGCAGTGGCCGCTGGGG - Intergenic
996935897 5:128947981-128948003 TGTAGTTGCAATAGAGGCTGAGG - Intronic
997467205 5:134096213-134096235 GGCAGTGTCAGTGGGGCCTGGGG - Intergenic
998122250 5:139588211-139588233 GGCAGGTGCAGTGGAGGCTGAGG - Intronic
998209244 5:140181759-140181781 TGCAGTGGCAGTGGCCCCCGTGG - Intronic
998943644 5:147313155-147313177 AGCCTTGGAAGTGGAGGCTGCGG + Intronic
999843368 5:155452583-155452605 TGCAGTGGGGGTGGGGTCTGGGG - Intergenic
1000300337 5:159950860-159950882 GGCAGTGCCAGTAGAGGCAGGGG + Intronic
1001051943 5:168420747-168420769 TGCAGGAGCAGCTGAGGCTGAGG - Intronic
1001805160 5:174578088-174578110 TGTAGTCCCAGAGGAGGCTGAGG + Intergenic
1002479035 5:179487208-179487230 TCCAGTGGCTGTGAAGGATGGGG - Intergenic
1003260240 6:4510270-4510292 TGCACAGGCACTGGGGGCTGTGG - Intergenic
1003690598 6:8349993-8350015 TACAGTCACATTGGAGGCTGGGG + Intergenic
1003864330 6:10349518-10349540 TGCAGTGGCAAAGGAGGAAGAGG - Intergenic
1005325206 6:24693373-24693395 AGCAGAGGCAGTGGAGGCAGTGG + Intronic
1005844555 6:29767299-29767321 GGCAGGTGCAGTGTAGGCTGAGG - Intergenic
1006001159 6:30966141-30966163 TGCAGTGGCCCCAGAGGCTGTGG - Intergenic
1006501747 6:34463827-34463849 TGGAGTGGGAGTGGGGGGTGGGG + Intergenic
1006521637 6:34574404-34574426 GGCAGTGGCTGTGGGGGTTGGGG - Intergenic
1006735424 6:36269694-36269716 TGCAGAGGCGGTGGTGGGTGGGG + Intronic
1006860726 6:37170184-37170206 TGCAGCGGCCGCGGTGGCTGAGG + Exonic
1007425407 6:41743241-41743263 GGCATGGGGAGTGGAGGCTGGGG - Intronic
1008660491 6:53662578-53662600 AGCAGAGGGAGAGGAGGCTGTGG - Intronic
1008820501 6:55625933-55625955 AGCAATGGCAGAGGTGGCTGGGG - Intergenic
1009332884 6:62445757-62445779 GGCAGTGAAAGTGCAGGCTGGGG + Intergenic
1009389706 6:63130883-63130905 TGCAGCTGCTGTGGGGGCTGGGG + Intergenic
1009621617 6:66085017-66085039 TGCAATGGCAGTGCAGGGTGGGG + Intergenic
1010323672 6:74541281-74541303 TGCAATGACAGGGGTGGCTGGGG - Intergenic
1011160193 6:84381087-84381109 TGGGGTGGCAGTGGAGGGTTGGG + Intergenic
1012692744 6:102335239-102335261 TGCTCTGCCAGTGGAGTCTGGGG + Intergenic
1013099485 6:106974879-106974901 GGCGGTGGCAGTGGCGGCGGCGG - Intronic
1014072894 6:117203913-117203935 TGCAGTGGCAGCAGGGGCTATGG - Intergenic
1014440995 6:121473745-121473767 TCCAGATGCTGTGGAGGCTGAGG + Intergenic
1015445048 6:133293872-133293894 GGCTTTGGAAGTGGAGGCTGTGG + Intronic
1016395392 6:143618588-143618610 GGGACTGGCAGGGGAGGCTGGGG + Intronic
1016416863 6:143842897-143842919 TGCCGTAGCAACGGAGGCTGGGG - Intronic
1016825921 6:148388397-148388419 TGCTGTGTCAGTCCAGGCTGTGG + Intronic
1016988955 6:149916375-149916397 TGCAGTGTGAGGAGAGGCTGAGG - Intergenic
1018416853 6:163609116-163609138 TGAAGTGGAAGTGGGGGTTGAGG - Intergenic
1018707086 6:166470975-166470997 GGCAGTGGCGGCGGTGGCTGGGG + Intronic
1018715234 6:166527242-166527264 TTCAGTGGCGGGGGAGGGTGAGG + Intronic
1018992396 6:168684257-168684279 CCCAGTGGCAGTGGCTGCTGAGG + Intergenic
1018996920 6:168717109-168717131 TGGCGGGGAAGTGGAGGCTGTGG + Intergenic
1019267813 7:128656-128678 GGCAGTGGGAGTGGTGTCTGTGG - Intergenic
1019368841 7:650337-650359 GGCAGTGGCTCTGGGGGCTGTGG - Intronic
1019452097 7:1104282-1104304 TGCAGTGGCCCGGGAGGCTGAGG + Intronic
1019603653 7:1897853-1897875 TCCAGAGGCAGTGGTGCCTGGGG - Intronic
1020042189 7:5012609-5012631 TGCAGTGGCTGGGTGGGCTGGGG + Intronic
1020086311 7:5312678-5312700 TGCAGAGGCTGTGTGGGCTGCGG + Exonic
1020132793 7:5569062-5569084 AGCAGTGGCACAGGAGGCTGAGG + Intergenic
1020359191 7:7308851-7308873 TGCAGAGCCTGTGGAGGGTGTGG - Intergenic
1020607758 7:10359944-10359966 GGCAGTGACAGTGGAATCTGGGG + Intergenic
1020812664 7:12864914-12864936 AGCAGTGGCAGAAGTGGCTGTGG - Intergenic
1021391317 7:20096160-20096182 TCCAGTGGCTGTAGTGGCTGTGG - Intergenic
1022710555 7:32845225-32845247 GGCAGTGACACTTGAGGCTGAGG + Intergenic
1022782790 7:33602794-33602816 TGCTGTGGGTGTGGAGTCTGAGG + Intronic
1022817782 7:33929968-33929990 TGCAAAAGCAGTGGAGGTTGGGG + Intronic
1022955546 7:35376908-35376930 AGCAGTGGCCTTGGAGGCTCTGG + Intergenic
1023232420 7:38049524-38049546 TGTGGTTGCAGTAGAGGCTGTGG + Intergenic
1023418284 7:39951334-39951356 CGCTGTGGCTGTGGCGGCTGCGG - Exonic
1023674859 7:42618434-42618456 TGCAATGCCATTGGAGGATGGGG + Intergenic
1024182640 7:46911394-46911416 TCCAGTGACTGAGGAGGCTGAGG - Intergenic
1024255496 7:47537293-47537315 AGGAGTGGCCGTGGAGGCTGCGG - Intronic
1024282249 7:47728962-47728984 TGCAGTGGCAGTGGAGGCTGGGG - Intronic
1024484738 7:49905321-49905343 TGCTGTAGCAGTGGCTGCTGTGG - Intronic
1024769908 7:52709653-52709675 TACAGAGGCTGTGTAGGCTGTGG - Intergenic
1024842899 7:53607813-53607835 AGCAGTGGCAGAGGACACTGAGG + Intergenic
1024947749 7:54828002-54828024 TGGAGGGGCAGAGGAGGGTGAGG + Intergenic
1025028621 7:55537795-55537817 TGGAGGGGAAGTGGGGGCTGTGG - Intronic
1025207996 7:57004394-57004416 TGCAGAGGCTGTGTGGGCTGCGG - Intergenic
1025262643 7:57430115-57430137 AGCAGTGGCAGTAGTGACTGTGG - Intergenic
1025663955 7:63572481-63572503 TGCAGAGGCTGTGTGGGCTGCGG + Intergenic
1025740037 7:64187641-64187663 AGCAGTGGCAGTAGTGACTGTGG - Intronic
1026141691 7:67712257-67712279 TGAAGCTTCAGTGGAGGCTGTGG + Intergenic
1026359203 7:69587277-69587299 AGCAGTTTCAGTGGAGGCTTTGG + Intergenic
1026952394 7:74356331-74356353 TGAAGAGGCAGAGGAGGCAGGGG + Intronic
1027856658 7:83520459-83520481 AGCAGTGGTAGTAGAGGCAGAGG - Intronic
1028938373 7:96490903-96490925 TGCAGTGGCAGTGGATACAGTGG + Intronic
1029270863 7:99375592-99375614 TGCATTGGCAGAGGAGGCAGGGG - Intronic
1029495092 7:100892303-100892325 TGCAGAGGGAGAGAAGGCTGGGG - Intronic
1029907301 7:104104573-104104595 TGGAGTGGCTGTTGAGCCTGGGG - Intergenic
1030845066 7:114399678-114399700 TTCAGTGGAGGTGGAGGCAGAGG + Intronic
1031330112 7:120453469-120453491 GGCAGTGGCAGTGCAGGATTGGG - Intronic
1031378340 7:121054631-121054653 TGCAGTGGGGGTGGAGGTTGGGG - Intronic
1031380966 7:121085518-121085540 TGGAGTGGAAGTGGAGCCTGTGG + Intronic
1031787037 7:126045939-126045961 TGCATTGACAGTGGAGCGTGAGG + Intergenic
1032700251 7:134372907-134372929 CTCAGTGTAAGTGGAGGCTGGGG + Intergenic
1032702426 7:134394180-134394202 TGCAGTGGCAGGGAAGGGAGTGG - Intergenic
1033098832 7:138453621-138453643 GGGAGTGGCAGTGGGGGGTGGGG - Intergenic
1033412613 7:141132720-141132742 TACAGTGGCAATGGTGGCTTGGG - Intronic
1033428576 7:141267486-141267508 TGCAGAGGAAGAGAAGGCTGAGG - Intronic
1033510046 7:142051357-142051379 GGGAGTGGGAGTGGGGGCTGGGG + Intronic
1033512838 7:142077336-142077358 GGGAGTGGGAGTGGGGGCTGGGG + Intronic
1033606738 7:142933139-142933161 TTTAGTGGCGGTGGAGGATGTGG - Intronic
1034224929 7:149474832-149474854 GGCAGCGGCAGTGGCGGCGGCGG - Exonic
1034253833 7:149714044-149714066 TGGAGGGGAAGGGGAGGCTGTGG - Intergenic
1034399524 7:150852830-150852852 TGCAGTGGCAGTGGGGGTGGTGG - Intronic
1034504456 7:151476238-151476260 TTCACTGGCAGTGGAGTATGTGG + Intronic
1034658045 7:152744932-152744954 TGCTGAGGCAATGGAGGCTGAGG - Intergenic
1034708695 7:153171182-153171204 CGCAGCGGCAGTGGTGGCAGCGG + Intergenic
1035161089 7:156950225-156950247 GGCAGCGGCGGTGGCGGCTGCGG - Exonic
1035395746 7:158533913-158533935 AGCAAAGGCAGTGGTGGCTGGGG - Intronic
1035566802 8:646709-646731 TGCAGGTGCAGGGGAGGCTGGGG - Intronic
1036587475 8:10137700-10137722 GGCAGTGGGAGTGGTGACTGGGG + Intronic
1036717425 8:11139362-11139384 TGCAGGGGCAGTGACTGCTGGGG - Intronic
1037588487 8:20294480-20294502 TACAGTGCAGGTGGAGGCTGGGG + Intronic
1039477053 8:37844610-37844632 TCCAGTGACAGTGGAGACAGGGG + Exonic
1039637337 8:39180399-39180421 CACAGAGGCAGGGGAGGCTGAGG - Intronic
1039926046 8:41933190-41933212 TGCTGGGGTGGTGGAGGCTGTGG + Exonic
1040104296 8:43531990-43532012 TACATTGGCAGTGGAGGTTGTGG + Intergenic
1041083535 8:54235841-54235863 TGCAGTTACTCTGGAGGCTGAGG + Intergenic
1041433970 8:57817494-57817516 GGCAGTGGCAGTAGGGGCAGTGG - Intergenic
1042000960 8:64123205-64123227 GGCAGTGACAGGGGAGGCTGGGG + Intergenic
1042167840 8:65963463-65963485 TCCAGTGGCAATGAAGGGTGTGG + Intergenic
1042227865 8:66528743-66528765 TGCAGTGGTAGTGGATGCTGCGG - Intergenic
1042227867 8:66528758-66528780 GGCAGTGGTAGTGGATGCAGTGG - Intergenic
1042768425 8:72352682-72352704 TGCAGTTGCTGTGGGGGTTGGGG + Intergenic
1043116171 8:76255791-76255813 TGTTGTTGTAGTGGAGGCTGTGG - Intergenic
1043232491 8:77820659-77820681 TGCAGTGGGAGTGGAGGCCATGG + Intergenic
1045537464 8:103045267-103045289 TGCTGTGGCAATAGAGACTGAGG + Intronic
1045594453 8:103636213-103636235 TGCTGTGGAAGTGGGGCCTGCGG + Intronic
1045661674 8:104444356-104444378 CCCAGAGGCAGTGGAGGCAGAGG - Exonic
1045864622 8:106851135-106851157 TGCAATGACAGTAGAGGATGTGG - Intergenic
1046476967 8:114758013-114758035 TGCAGTCCCAGAGGAGGCTGAGG + Intergenic
1046547208 8:115667931-115667953 TGCAGTGGCGGCGGCGGCGGCGG + Intronic
1046983368 8:120360939-120360961 TGGAGTTGCAGAGGAGGCAGGGG - Intronic
1047534679 8:125708742-125708764 TGCACTGGGTTTGGAGGCTGTGG - Intergenic
1048072843 8:131040137-131040159 GGCAGCGGGAGTGGAGGCTCGGG - Exonic
1048961409 8:139582498-139582520 CGCAGTGACAATGAAGGCTGAGG - Intergenic
1049319987 8:141991155-141991177 TCCCGTGACCGTGGAGGCTGAGG - Intergenic
1049325679 8:142020314-142020336 AACAGTGGCTGAGGAGGCTGAGG - Intergenic
1049397332 8:142407203-142407225 AGCAGTGGCTGTGGAATCTGGGG - Intergenic
1049664684 8:143837683-143837705 CGCGGTGGAAGAGGAGGCTGTGG + Exonic
1049682411 8:143925470-143925492 TGCACGGGCGGAGGAGGCTGAGG - Exonic
1050150552 9:2615680-2615702 TGCAGTGTCAGAGGAGGTTGTGG - Intergenic
1051361492 9:16285407-16285429 TGGAGAGGCAGCGGTGGCTGAGG - Intergenic
1051416179 9:16843433-16843455 GGCTGAGGCAGTGGAGGCTGAGG - Intronic
1052343429 9:27384904-27384926 GGCAGAGGGACTGGAGGCTGGGG - Intronic
1052821717 9:33142715-33142737 TGCAGTCCCACGGGAGGCTGAGG - Intronic
1052897324 9:33759914-33759936 CCCACTGGCAGTGGATGCTGAGG + Intronic
1053137803 9:35662615-35662637 AGCAGGTGCAGTGGAGGCCGAGG + Exonic
1056112240 9:83407459-83407481 TAAAGTGGGAGTGGAGGCTGGGG - Intronic
1056331762 9:85526937-85526959 TGCACTGGCAGGGGACACTGGGG - Intergenic
1056581463 9:87890098-87890120 TGCAGGGGCTGTGGAGGCTGAGG + Intergenic
1056740055 9:89246614-89246636 TGGAGTGTCAGGGGAGACTGTGG - Intergenic
1056800366 9:89686763-89686785 TGCAGTGGCTGAGGAAGCTGAGG - Intergenic
1057208114 9:93185122-93185144 TGCAGGGGCTGCGGGGGCTGCGG - Exonic
1057727178 9:97575994-97576016 GGCAGTGGCAGGGGAGGGAGGGG - Intronic
1057865483 9:98677042-98677064 GGCAGGGGAAGTTGAGGCTGAGG - Intronic
1058410395 9:104725026-104725048 TGCAGCTGCTGTGGGGGCTGGGG - Intergenic
1059215672 9:112559541-112559563 GGCAGTTCCAGTGGAGTCTGGGG + Intronic
1059312263 9:113396704-113396726 TGCAGAGGCTGGGGAGGCTGCGG + Intronic
1059453653 9:114386668-114386690 AGCAGGGGCAGTGGCGGCTTGGG - Intronic
1060089894 9:120733335-120733357 TGCAAAGGCAGTTGAGGCGGGGG + Intergenic
1060157623 9:121331002-121331024 TGAAGGAGCAGTGGAGTCTGAGG + Intronic
1060409249 9:123389282-123389304 TGCAGTGGAGGTTGAGGCTCAGG + Intronic
1060410674 9:123398189-123398211 GGAAGTGGCAGTAGGGGCTGGGG - Intronic
1060523462 9:124307644-124307666 TGCCCTGGCAGAGGAGCCTGAGG + Intronic
1060765970 9:126295190-126295212 TGGAGTGGAAATGGAGGGTGTGG + Intergenic
1060876804 9:127089817-127089839 TGCAGGGGCAGTGCACTCTGTGG + Intronic
1060898568 9:127237260-127237282 TGAAGTAGCAGTGGTGGCTCTGG - Intronic
1061028627 9:128066752-128066774 GGCGGTGGCAGTGGTGGCGGTGG - Exonic
1061084948 9:128393192-128393214 TGCGGTGGCGGTGGCGGCGGTGG + Intergenic
1061103275 9:128509063-128509085 TGGTGTTGCAGGGGAGGCTGGGG - Exonic
1061189756 9:129075504-129075526 TGCCATTTCAGTGGAGGCTGTGG - Intergenic
1061209526 9:129182731-129182753 GGCAGTGGCAGGGAAGGCAGAGG + Intergenic
1061302236 9:129712013-129712035 TGGAGAGGCCGTGGAGGCTTCGG - Intronic
1061726092 9:132582727-132582749 GGCAGGGGCAGCGGCGGCTGGGG + Exonic
1061987210 9:134136524-134136546 TGAAGGGGCAGTGGAGGGAGAGG - Intronic
1062311195 9:135938343-135938365 TGCAGTGCGAGTGGCTGCTGGGG - Exonic
1062318944 9:135981162-135981184 AGCAGTGGCAGCGGAGTCTCAGG + Intergenic
1062360735 9:136186726-136186748 TGCAGTGGCAGCGGTGGCCAAGG - Intergenic
1062370038 9:136234002-136234024 TGCAGCGGCAGAGGAGGTGGAGG - Intronic
1062534312 9:137014812-137014834 TGCAGGGGCGGTGGAGGGGGAGG + Intronic
1062551625 9:137090069-137090091 GGCAGGGGGAGTGGAGACTGGGG + Intronic
1203377839 Un_KI270442v1:391395-391417 TGCAGTGGGTGTGGTGTCTGGGG - Intergenic
1186398990 X:9239643-9239665 CGCAGTGGCTCAGGAGGCTGAGG - Intergenic
1186481635 X:9900842-9900864 GGCAGTGGGGGTGGGGGCTGGGG - Intronic
1186937948 X:14471932-14471954 TGGACTGGGAGTGGAGGTTGGGG + Intergenic
1187243176 X:17531567-17531589 AGCAGTGGCAGAGGAGGAGGGGG - Intronic
1187524024 X:20037915-20037937 TGCAATGACAGAGGTGGCTGGGG - Intronic
1187586086 X:20663402-20663424 AGCACTGGGAGTGGAGGATGGGG - Intergenic
1189077799 X:37936435-37936457 TCCAGAGGCTGAGGAGGCTGAGG + Intronic
1190154251 X:47974964-47974986 GGAAGGGGCAGTGGTGGCTGGGG - Exonic
1190789257 X:53683962-53683984 TGCAGTAGCCGCGGAGGCGGCGG - Exonic
1191133942 X:57043712-57043734 GGCAGTGACATTGGTGGCTGAGG + Intergenic
1191253176 X:58268881-58268903 CGCAGTGGCCGAGGAGGCTAAGG - Intergenic
1191729037 X:64314359-64314381 AGTAGTGGCGGTGGAGGCTCAGG + Intronic
1191902607 X:66055189-66055211 TGTAGTGGCCCGGGAGGCTGTGG - Intergenic
1191970952 X:66815611-66815633 TGCAGCTGCTGTGGAGGATGGGG + Intergenic
1192657056 X:73003255-73003277 TGCGGCGGCGGCGGAGGCTGCGG + Intergenic
1192665064 X:73079746-73079768 TGCGGCGGCGGCGGAGGCTGCGG - Intergenic
1193067576 X:77275741-77275763 TGCTGTGGCAGTGGTGGTGGTGG - Intergenic
1193406761 X:81109713-81109735 GGCAGTGGTGGTGGAGCCTGAGG + Intergenic
1194421080 X:93673480-93673502 GGCAGCGGCAGTGGAGGCTTGGG + Exonic
1195398193 X:104433919-104433941 TTCAGTGGCTGTGGGAGCTGGGG + Intergenic
1196845732 X:119895461-119895483 AGCCCAGGCAGTGGAGGCTGGGG + Intergenic
1197150563 X:123216183-123216205 TGCTGAGGTAGGGGAGGCTGGGG - Intronic
1197790472 X:130249044-130249066 TCTAGTGGCAGTGGTGGCTCAGG - Intronic
1198020102 X:132649227-132649249 TGCTCTGGGAGTGGAGGCTTTGG + Intronic
1198890680 X:141392287-141392309 TGCAGTGGTAGTGGTGGTGGCGG + Intergenic
1199408040 X:147485618-147485640 TGCAGTGGGGGTGGGGGGTGGGG + Intergenic
1200092271 X:153641617-153641639 TGTAGTGGCAGAGTAGGATGTGG - Intergenic
1200185199 X:154178067-154178089 TGGGGTGACTGTGGAGGCTGGGG + Intergenic
1200190852 X:154215205-154215227 TGGGGTGACTGTGGAGGCTGGGG + Intergenic
1200196603 X:154253007-154253029 TGGGGTGACTGTGGAGGCTGGGG + Intergenic
1200202258 X:154290125-154290147 TGGGGTGACTGTGGAGGCTGGGG + Intronic
1200227783 X:154428668-154428690 CGCTGAGGCAGTGGAGGCTGAGG + Exonic
1201307584 Y:12563931-12563953 GGGTGTGGGAGTGGAGGCTGAGG + Intergenic
1201781243 Y:17725030-17725052 TGCAGTTGCATTTGAGGTTGTGG - Intergenic
1201820310 Y:18180960-18180982 TGCAGTTGCATTTGAGGTTGTGG + Intergenic
1202172641 Y:22067124-22067146 TGCAGTTGCATTTGAGGTTGTGG - Intergenic
1202218721 Y:22519247-22519269 TGCAGTTGCATTTGAGGTTGTGG + Intergenic
1202324465 Y:23676808-23676830 TGCAGTTGCATTTGAGGTTGTGG - Intergenic
1202546306 Y:25993246-25993268 TGCAGTTGCATTTGAGGTTGTGG + Intergenic