ID: 1024282587

View in Genome Browser
Species Human (GRCh38)
Location 7:47731716-47731738
Sequence CAGCAGAAGCATGATGAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 232}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024282587_1024282595 22 Left 1024282587 7:47731716-47731738 CCTAGCTCATCATGCTTCTGCTG 0: 1
1: 0
2: 0
3: 15
4: 232
Right 1024282595 7:47731761-47731783 TGGATAATGGCTGGGTGTGATGG No data
1024282587_1024282593 13 Left 1024282587 7:47731716-47731738 CCTAGCTCATCATGCTTCTGCTG 0: 1
1: 0
2: 0
3: 15
4: 232
Right 1024282593 7:47731752-47731774 TAGATTAGTTGGATAATGGCTGG No data
1024282587_1024282594 14 Left 1024282587 7:47731716-47731738 CCTAGCTCATCATGCTTCTGCTG 0: 1
1: 0
2: 0
3: 15
4: 232
Right 1024282594 7:47731753-47731775 AGATTAGTTGGATAATGGCTGGG 0: 1
1: 0
2: 0
3: 10
4: 107
1024282587_1024282592 9 Left 1024282587 7:47731716-47731738 CCTAGCTCATCATGCTTCTGCTG 0: 1
1: 0
2: 0
3: 15
4: 232
Right 1024282592 7:47731748-47731770 TCATTAGATTAGTTGGATAATGG 0: 1
1: 0
2: 0
3: 11
4: 150
1024282587_1024282588 2 Left 1024282587 7:47731716-47731738 CCTAGCTCATCATGCTTCTGCTG 0: 1
1: 0
2: 0
3: 15
4: 232
Right 1024282588 7:47731741-47731763 AGACCCCTCATTAGATTAGTTGG 0: 1
1: 0
2: 0
3: 4
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024282587 Original CRISPR CAGCAGAAGCATGATGAGCT AGG (reversed) Intronic
900893763 1:5468685-5468707 CAGCAGAGGCTGGATGAGCAAGG + Intergenic
901795119 1:11675430-11675452 CAGAAGAGCCAGGATGAGCTGGG + Intronic
902680284 1:18038931-18038953 CAGCAGAAACACAATGACCTTGG + Intergenic
903377344 1:22875277-22875299 CAGCTGTCCCATGATGAGCTGGG + Intronic
904115790 1:28160834-28160856 CAGCAGAAGTAGGAAGAGCCAGG - Intronic
904400804 1:30255094-30255116 CAGTCCAAGCATGATGACCTTGG + Intergenic
905817736 1:40965137-40965159 CAGGACAGGCCTGATGAGCTAGG - Intergenic
905873855 1:41419709-41419731 CAGCAGAAGGAGCAGGAGCTGGG - Intergenic
906581835 1:46941344-46941366 CAGCAGAAGCAGAATGAGCAGGG + Exonic
906601882 1:47137553-47137575 CAGCAGAAGCAGAATGAGCAGGG - Exonic
910713176 1:90202902-90202924 CAGCAGAAGAATGATGGGGAAGG + Intergenic
910903479 1:92148258-92148280 CGGCAGAAACATTATGAGCAAGG - Intergenic
910920395 1:92339963-92339985 CAGAAGAAACATGATTAGCTGGG + Intronic
911072744 1:93845766-93845788 CAGAAGAGGAATGCTGAGCTTGG - Intronic
912127512 1:106557033-106557055 CAGCAGAAACCTCATGGGCTAGG + Intergenic
912597547 1:110894322-110894344 CAGCAGCAGGATGAAGAACTGGG - Exonic
913500954 1:119472173-119472195 CAGCAGAAGGATGCAGAGTTTGG - Intergenic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
915934847 1:160084428-160084450 CAGCAGCAGCACGATGCCCTCGG - Exonic
916269597 1:162926473-162926495 CATCAGAAGGGTGCTGAGCTTGG - Intergenic
917284143 1:173407015-173407037 CAGCAGCAGCAGGATGAGAAGGG + Intergenic
918162615 1:181915352-181915374 CAGGAGAAACATGCTCAGCTAGG - Intergenic
919410367 1:197234766-197234788 CAGCAGTAGCTAGATAAGCTTGG - Intergenic
920385962 1:205570057-205570079 CAGCAGGAGTAGGATGAGGTGGG - Intronic
921636328 1:217499002-217499024 CAGCTGAAGCAAAATGGGCTGGG - Intronic
921785892 1:219229355-219229377 CAGCAGAACCACGCAGAGCTTGG + Intergenic
921921236 1:220672569-220672591 CAGCAGTAGCATGACCAGTTTGG - Intergenic
922178493 1:223215468-223215490 CAGCAGATGCATGGAGAGGTGGG - Intergenic
922576080 1:226661476-226661498 CAGCAGAGTGATGAAGAGCTTGG - Intronic
924646437 1:245881814-245881836 CTGAAGAATGATGATGAGCTAGG + Intronic
1063460427 10:6212021-6212043 CAGCATAAGCCTGCTCAGCTCGG + Intronic
1064876510 10:20000994-20001016 CTGGAGTAGCAGGATGAGCTGGG + Intronic
1065328461 10:24570440-24570462 GAGCAGAAGCTTGATGGGCAGGG + Intergenic
1066481281 10:35798101-35798123 CAGCAGGAGCCTGATGAGGAGGG + Intergenic
1066801580 10:39198436-39198458 CTGCAGAAAAATGATCAGCTAGG - Intergenic
1067716995 10:48697518-48697540 CATCAGATGCCTGGTGAGCTTGG - Intronic
1068176908 10:53472590-53472612 CATCATAGGCATGATGAGGTAGG + Intergenic
1068363671 10:56014301-56014323 CAGCAGAAACCTTATGGGCTAGG + Intergenic
1072708040 10:97696308-97696330 CTGCAGAAGCATAATGGGCAAGG - Intergenic
1073119181 10:101111210-101111232 CATCAGAAGCAGCAAGAGCTGGG - Intronic
1073788585 10:106917098-106917120 CAGCTGAAGTATGATGTTCTTGG + Intronic
1073826060 10:107322894-107322916 CAGCAGAAGCATTCTCACCTTGG + Intergenic
1075180040 10:120202947-120202969 CAGCAGAAACCTTATGAGCCAGG - Intergenic
1075621414 10:123930610-123930632 CAGAAGCAGGTTGATGAGCTAGG + Intronic
1075952630 10:126495073-126495095 TAGCAGAAGCACCATGGGCTTGG - Intronic
1076673086 10:132133787-132133809 CAGCAGAAGGGTGATGAGGCCGG - Intronic
1078355643 11:10629712-10629734 CTGCAGAAGGAGGATGAGCTGGG + Intronic
1079258589 11:18854508-18854530 CAGCAGAAATATTATAAGCTAGG + Intergenic
1080686093 11:34516034-34516056 CACCAGAAGCAGGATAGGCTGGG - Intergenic
1082015424 11:47482632-47482654 CAGCAGAAGAAGGAACAGCTGGG + Intronic
1083607256 11:63986478-63986500 CAGCAGAAGCAGGAGCCGCTGGG + Exonic
1083796987 11:65022631-65022653 CAGGACAGGCATGATGAGCAAGG + Intronic
1085387557 11:76165610-76165632 CAGCAGAAGGATGAAGAGAGAGG - Intergenic
1085687331 11:78635397-78635419 CAGCAGAAACCTTATGAGCCAGG + Intergenic
1086432754 11:86751284-86751306 CAGCAGCAGCCATATGAGCTTGG - Intergenic
1086586014 11:88452043-88452065 CAGCAGAAGCAAAATAAGCATGG - Intergenic
1090214774 11:124952245-124952267 GAGCAAAAGCCTGATGGGCTAGG - Intergenic
1090500178 11:127253572-127253594 CAGCAGCAAAATGATGAGATGGG - Intergenic
1092180484 12:6443440-6443462 CAGAAGAATCATGAGGAACTGGG - Intergenic
1092655763 12:10683405-10683427 CAGCAAAAGCAAAATTAGCTGGG - Intergenic
1094501977 12:31029697-31029719 CAGCAGCAGCAGGATCACCTGGG - Intergenic
1094628768 12:32151699-32151721 CAGCAGAAGGAAGAGGAGCAGGG + Intronic
1095596373 12:43963530-43963552 CAGCAGAAAAGAGATGAGCTAGG + Intronic
1096617425 12:52841749-52841771 CTGCACAAACATGATGAACTGGG - Intronic
1097289620 12:57903647-57903669 CAGCGGGAGCATCAGGAGCTTGG + Intergenic
1101939229 12:109087379-109087401 CAGCAGAAGAGTGATCACCTGGG - Exonic
1103401249 12:120644496-120644518 CGGCAGAGGCATGATGACATGGG + Intronic
1104407675 12:128531863-128531885 CAGCAGCAGCTTTATGGGCTGGG - Intronic
1106637688 13:31546809-31546831 CAGCAGAAGCAAGAAGTTCTAGG - Intergenic
1107012235 13:35680583-35680605 CAGCAGAAGCGTGATGCCCCCGG - Intergenic
1109956903 13:69580657-69580679 CAGCAGCTGCAGGATGTGCTGGG + Intergenic
1110503928 13:76262229-76262251 GAGCAGCAGCAGGATGTGCTTGG + Intergenic
1112706918 13:102080727-102080749 CAGCAGAATGAGGATTAGCTGGG + Intronic
1113665325 13:112137050-112137072 CAGCTCCAGCATGCTGAGCTAGG + Intergenic
1115944846 14:38648455-38648477 CAGCAGCAGCAAAATGAGTTAGG + Intergenic
1117579375 14:57136878-57136900 CAGCAGCAGGATGCTGTGCTGGG - Intergenic
1119433085 14:74581065-74581087 GAGCAGAAGCAGGATGAACACGG + Intronic
1119667543 14:76496154-76496176 CAACAGAAACACAATGAGCTAGG - Intronic
1123109412 14:105858694-105858716 GAGCTGAACCAGGATGAGCTGGG - Intergenic
1125349643 15:38753572-38753594 AAGCAGAACCATGGTGAGCCAGG + Intergenic
1131024877 15:89131893-89131915 CAGCATAAGCAGGATAAGCATGG + Intronic
1132320438 15:100920870-100920892 CAGCAGAGGCTGGATCAGCTGGG - Intronic
1135875518 16:26196480-26196502 AAGCAGAAGCCTCATGAGGTTGG - Intergenic
1136231374 16:28887542-28887564 CAGCAGAAGCTGGATGAGTTTGG + Exonic
1137393088 16:48097679-48097701 TAGCAGAAGGAAGATGACCTTGG + Intronic
1137625918 16:49908509-49908531 AAGCAGGACCATGATGATCTGGG + Intergenic
1137736250 16:50726017-50726039 CCCCAGAAGCATGTTCAGCTGGG - Intronic
1142058720 16:88016232-88016254 CAGGAGAAGCATGTGGCGCTGGG + Intronic
1145901262 17:28491792-28491814 CAGCAGCAGCAAGATGACCATGG - Exonic
1146889074 17:36493276-36493298 CAGCAGCAGCGAGATGATCTAGG - Intronic
1147584175 17:41643582-41643604 CAGGAGAAGCAGGTGGAGCTAGG + Intergenic
1148655771 17:49282264-49282286 CAGCAGAAACACTGTGAGCTTGG - Intergenic
1149492865 17:57097651-57097673 CAGCAGGAACTTAATGAGCTGGG + Intronic
1149982399 17:61321756-61321778 CAGCAGAAGCATGGCCAGATTGG - Intronic
1150876651 17:68977934-68977956 AAGCAGAAGCATGTTGATTTGGG + Intronic
1152330268 17:79668756-79668778 CAGCAGGAGCAAGAGCAGCTTGG - Intergenic
1152411180 17:80124014-80124036 CAGCTGCAGCCTGCTGAGCTCGG - Intergenic
1152459202 17:80432465-80432487 CAGCACAAGCAGGCTGGGCTGGG + Intronic
1155531664 18:26773179-26773201 CAGCAGAAAAATGAAGAGCTTGG + Intergenic
1156658305 18:39313936-39313958 CAGCAGCAGCAAGATCATCTAGG - Intergenic
1158131793 18:54160319-54160341 AAGCAGAGGCGTGATAAGCTGGG + Intronic
1159449484 18:68582097-68582119 GAACTGAAGGATGATGAGCTTGG - Intergenic
1159464103 18:68758366-68758388 CAGCACAAGCATGTTTAACTTGG - Intronic
1161269732 19:3383209-3383231 CAGCAGAGGCCTGATGAGCCTGG + Intronic
1161384325 19:3982954-3982976 CAGCACAGGCTTGATGCGCTCGG + Exonic
1162306905 19:9880370-9880392 GAGCAGAAGCTTTATGAGGTTGG - Intronic
1164531293 19:29050209-29050231 CAGCAGAACCAAGTGGAGCTGGG + Intergenic
1165369720 19:35397260-35397282 CAGCACAATGATGATGAGCAAGG + Intergenic
1165377006 19:35449875-35449897 CAGCAGCAGCAGGAGGAGGTCGG - Exonic
1166665173 19:44675432-44675454 CAGCAGAAGGATGAGGTTCTGGG - Intronic
1166673940 19:44727822-44727844 TAGCTGGAGCAGGATGAGCTGGG - Intergenic
1167435362 19:49475692-49475714 CAGCAGCAGCAGGAGGAGATAGG - Exonic
1167690577 19:50982173-50982195 CAGCAGAAGCAGGAAGAGCGGGG + Intronic
1168156068 19:54473501-54473523 CAGCAGGAGGATGAAGAGCATGG + Intergenic
926801413 2:16664158-16664180 CAGCAGCAGCATCACGGGCTTGG - Intronic
928954437 2:36848475-36848497 CATCTGAAGCATGATTAGGTGGG + Exonic
930833546 2:55771086-55771108 CAGCAGAAGGAGGAAGAGCATGG + Intergenic
931084629 2:58815546-58815568 AGGCAGCAGCATGATGTGCTGGG + Intergenic
931308955 2:61060213-61060235 CAGTAGAAGCTTGATAGGCTTGG + Intergenic
931835315 2:66092878-66092900 CAGCAGCAGCAAGATCACCTGGG - Intergenic
932492971 2:72133230-72133252 CAGCAGCTGCATGATGAGTGAGG + Exonic
932596246 2:73095448-73095470 CAGCAGCAGCATGGGTAGCTGGG - Intronic
932599861 2:73116187-73116209 AAACAGAAGCAGGAAGAGCTTGG + Intronic
933304255 2:80577592-80577614 GAGCAGAAGCAAGATCAGTTAGG + Intronic
933667373 2:84974499-84974521 CAGAAGAAGCATGCTGAACCCGG - Intronic
933830801 2:86206693-86206715 CATCAGAAGCATGCTGTGTTTGG - Intronic
934127545 2:88913074-88913096 CAGGAGAAACATGAGAAGCTGGG + Intergenic
934161657 2:89255241-89255263 CAGCTGAAGCAGGATGAGCAGGG + Intergenic
934205627 2:89927174-89927196 CAGCTGAAGCAGGATGAGCAGGG - Intergenic
934694939 2:96392984-96393006 CAGGGGAAGGATGAAGAGCTGGG - Intergenic
935831568 2:107006123-107006145 CAGCGTAAGTGTGATGAGCTAGG - Intergenic
937251288 2:120525424-120525446 CAGCAGAGGGCTGATGAGCCGGG - Intergenic
938981861 2:136534687-136534709 CCCCAGAAGCATGAGGGGCTTGG - Intergenic
939041582 2:137195448-137195470 CAGAAAAAACAAGATGAGCTTGG + Intronic
939173410 2:138722360-138722382 CAGCAGAAGAAAGCTGGGCTTGG + Intronic
939673795 2:145046642-145046664 CAGCAGAAGGCTGAGGAGCAAGG + Intergenic
941955193 2:171196634-171196656 GTGCAGAAGAATGGTGAGCTTGG + Intronic
942122328 2:172790662-172790684 CAGCAGAAGCATTTTAAGCAGGG - Intronic
942799524 2:179860592-179860614 CAGCAGAACCCAGATGAGATGGG - Intronic
944350699 2:198723783-198723805 TAACAGAAGAATGATGATCTGGG - Intergenic
945295232 2:208163793-208163815 CAGCAGAGCCATTATGACCTTGG + Intergenic
946657487 2:221963982-221964004 CAGCTGAAAAATGATAAGCTAGG - Intergenic
947465039 2:230336154-230336176 CATCAGATGCATGATGGGATTGG + Intronic
1170006781 20:11678149-11678171 CAGCAGAAGCAAGCTGAGTTTGG + Intergenic
1172560565 20:35884348-35884370 CAGCAGGAGGAGGAGGAGCTGGG + Intronic
1172772603 20:37390354-37390376 CAGCTGATGCATGTTGTGCTGGG + Intronic
1173331778 20:42081297-42081319 CAGCAGCAGCATCATTATCTGGG - Intronic
1175040133 20:56041383-56041405 AATCAGAAGCCTGATGCGCTGGG + Intergenic
1175894993 20:62332228-62332250 CAGAAGAAACATGCTGGGCTGGG + Intronic
1176065364 20:63191462-63191484 CACCTGAAGCCTGATTAGCTTGG + Intergenic
1177994538 21:28080648-28080670 CAGCAGAATCATCATTACCTGGG + Intergenic
1178918511 21:36723018-36723040 AAGCAGGAGCAAGATGAGGTTGG - Intronic
1179016498 21:37598182-37598204 CAGCAGCAGTGGGATGAGCTGGG + Intergenic
1182125631 22:27813849-27813871 CCTCAGAAGCCTGATGACCTCGG + Intergenic
1182428689 22:30288109-30288131 CAGCAGCAGGAGGAGGAGCTAGG + Intronic
1182443063 22:30375363-30375385 CGGGAGAAGGAAGATGAGCTAGG + Intronic
1182897206 22:33868762-33868784 CAGTAAATGCATGATGAGTTGGG - Intronic
1184670392 22:46009283-46009305 GAGGAAAAGTATGATGAGCTTGG - Intergenic
1184726144 22:46347799-46347821 CAGCAGAAGCAGCAGGGGCTGGG - Intronic
951112800 3:18824413-18824435 CAGCAGAAACATTGTCAGCTTGG - Intergenic
951411519 3:22372504-22372526 CAGCAGGAGAATGAAGAGCTCGG - Intronic
951758614 3:26119737-26119759 CAGCAGAAACCTGAAGAGATTGG + Intergenic
952517797 3:34123498-34123520 CAGCAGAAGCATTATAGGCCAGG - Intergenic
954854312 3:53629675-53629697 CAGCAGCAGCATTGTGTGCTGGG - Intronic
958466968 3:94471294-94471316 CAGCAGATGCCTGATGAATTTGG - Intergenic
958722820 3:97866454-97866476 CAGCAGCAGCATCATCACCTGGG + Intronic
960309622 3:116105272-116105294 CAGTAGAAGCATGATGTGAGAGG + Intronic
962379496 3:134886136-134886158 CAGCAGAAGCAGGAGGATGTGGG + Intronic
962871277 3:139494891-139494913 AAGCAGGAGTATGATGAGTTGGG + Intergenic
964546831 3:157843566-157843588 CAGCAGCAGCAAAATGAGCAAGG + Intergenic
966763655 3:183439080-183439102 CAGCAGAAGCATTGTGTGCATGG - Intergenic
966863552 3:184243814-184243836 CAGCAGGAGCAGGGTGAGGTGGG + Exonic
968262120 3:197333974-197333996 CAGCAGCAGCAGCAGGAGCTAGG + Intergenic
971565933 4:28141608-28141630 CAGCAGAAGCAGCAAGAGTTAGG - Intergenic
971831516 4:31701641-31701663 CAGCAGATGGATGGGGAGCTGGG - Intergenic
974293879 4:59969067-59969089 CAACAGAAGCATGAGCAGCTAGG - Intergenic
979471889 4:121108705-121108727 CAGCAGCAGCAACATCAGCTGGG - Intergenic
979720575 4:123895293-123895315 CAGCAGAAGAAGGAAGAGCAAGG - Intergenic
980652460 4:135736412-135736434 GAGCAGAAGTATAATCAGCTTGG + Intergenic
981213232 4:142133433-142133455 AAGGTGAGGCATGATGAGCTTGG - Intronic
981221119 4:142236291-142236313 CAGTAGAAGCATAAGGAGTTTGG - Intronic
981504687 4:145486051-145486073 CAGCAGAACAATGATGATTTGGG - Intronic
981671094 4:147287773-147287795 CAGCAGCAGCAGCATGACCTGGG + Intergenic
982449403 4:155534062-155534084 CAGAGGAAACAGGATGAGCTGGG - Intergenic
984766118 4:183401756-183401778 GAGCAGCAGTATGATGTGCTGGG + Intergenic
985984782 5:3505599-3505621 CGGCTGAAGCAGGCTGAGCTGGG + Intergenic
986059739 5:4176683-4176705 CAGCAGAAACATGGACAGCTGGG - Intergenic
986298873 5:6462511-6462533 AAGCAGGAGCAGGAGGAGCTGGG - Intronic
993619860 5:90155458-90155480 CAGCATAATCATGATGAACAAGG - Intergenic
993990954 5:94658497-94658519 CAGCAGAAGCCTTATAAGCCAGG - Intronic
994229134 5:97293860-97293882 CAGCAGAAGCCTTACCAGCTAGG - Intergenic
994244995 5:97468520-97468542 CAACAGAAGCCTGATGAACATGG - Intergenic
995749545 5:115439810-115439832 CAGCAGAAACATTGTGGGCTAGG - Intergenic
996591608 5:125154284-125154306 CAGCTGAGACATGACGAGCTTGG - Intergenic
997060660 5:130498529-130498551 CAGCTGAAGAATAATGAGGTTGG - Intergenic
997154148 5:131533950-131533972 TAGCAGAAGCATGAAGAACAAGG - Intronic
999254266 5:150201114-150201136 CAGCATGAGCAGGATGAGGTAGG - Exonic
1001300478 5:170530042-170530064 CAGCAGTGGCATGGTGACCTTGG - Intronic
1002437385 5:179239925-179239947 ATGCAGCAGCATGATGACCTCGG + Intronic
1003505652 6:6738015-6738037 CTGCTGAAGGATGTTGAGCTGGG - Intergenic
1010253882 6:73736019-73736041 GAGCAGAATCAAGATGAACTTGG + Intronic
1010988943 6:82458070-82458092 CAGCAGAAACCTGATGATCCAGG - Intergenic
1015806831 6:137118462-137118484 AAACAGAAACACGATGAGCTAGG + Intergenic
1015817456 6:137225180-137225202 CAGCTGAAGCCTTGTGAGCTAGG - Intergenic
1019724113 7:2591515-2591537 CAGCAGCAGCAACAAGAGCTAGG + Intronic
1020365614 7:7377886-7377908 CAGAAGAAGAATGAGGGGCTTGG + Intronic
1023686917 7:42745579-42745601 CAGAAGCATCATCATGAGCTGGG - Intergenic
1024147371 7:46531274-46531296 AAGCAGACGAATCATGAGCTTGG + Intergenic
1024282587 7:47731716-47731738 CAGCAGAAGCATGATGAGCTAGG - Intronic
1026382953 7:69817673-69817695 TAGCAGAAGCGTGGAGAGCTGGG + Intronic
1029111239 7:98213979-98214001 CAGCAGAAGGAAGCTGGGCTTGG - Intergenic
1029455133 7:100666187-100666209 TAGCAGAAACTTGAAGAGCTGGG - Intergenic
1029489257 7:100861490-100861512 CAGCAGACCCATGAGGAGCAGGG - Exonic
1030058909 7:105607544-105607566 CAGTAGCAGCATCAGGAGCTAGG + Exonic
1031278164 7:119758938-119758960 CAGCAAAAGCCTGATCAGATAGG - Intergenic
1032090919 7:128911057-128911079 CAGAAGAAGCAGACTGAGCTGGG + Intergenic
1034514644 7:151565833-151565855 AAGCAGAACCTGGATGAGCTTGG - Exonic
1034860769 7:154592832-154592854 CAGAGGAAGCAAGATCAGCTGGG - Intronic
1035756640 8:2037724-2037746 CTGCAGAAGCATGATCAGGTGGG + Intergenic
1036825476 8:11972557-11972579 CAGCTGAAGCATGATACCCTCGG + Intergenic
1037760584 8:21739018-21739040 GAGAAGAATCCTGATGAGCTGGG - Intronic
1038227264 8:25669016-25669038 CAGAAGCAGCATGGTGAACTGGG + Intergenic
1040520334 8:48170991-48171013 CAGCAGCAGGAGGATGTGCTGGG - Intergenic
1042502317 8:69523073-69523095 GAGGAGAAGCATGATCATCTGGG + Intronic
1043134358 8:76502576-76502598 CAGCAGAAGCATGATGGAAATGG + Intergenic
1043533910 8:81179253-81179275 CAGCTGATTCATGTTGAGCTAGG + Intergenic
1044747893 8:95388993-95389015 GAGGAGAAGCATCATGTGCTTGG + Intergenic
1045248978 8:100467495-100467517 CAGCACAAGTAATATGAGCTGGG + Intergenic
1046292194 8:112177678-112177700 CAGCAGCAGTTTGATGTGCTAGG + Intergenic
1049066703 8:140321924-140321946 AAGCAGAGGCTTGCTGAGCTTGG + Intronic
1049664261 8:143836013-143836035 CACCAGAAGCAGAGTGAGCTGGG + Exonic
1050267105 9:3902679-3902701 CAGTAGAAGCATCATCACCTGGG - Intronic
1050686600 9:8177339-8177361 CACCAAAAGCATTATGAGCATGG + Intergenic
1053304811 9:36976891-36976913 CAGCAGATTCAAGGTGAGCTTGG + Intronic
1054776757 9:69130534-69130556 CAGCAGCAGCAGCATGACCTGGG - Intronic
1055384129 9:75742731-75742753 CCGCAGAGGAATGATGAGCTTGG + Intergenic
1056035396 9:82599755-82599777 CAACAGAAAGATGATGTGCTTGG + Intergenic
1058644995 9:107123143-107123165 AAGCAGAAGGAGTATGAGCTTGG + Intergenic
1060367632 9:123034418-123034440 GAGCAGCAGCATCAGGAGCTTGG + Intronic
1060828498 9:126699780-126699802 CAGCAGAAGCCTGTGGGGCTGGG + Exonic
1060900753 9:127255839-127255861 CAGCAGAATCACAATGACCTTGG + Intronic
1187450171 X:19389111-19389133 AAGCAGATGAGTGATGAGCTGGG + Intronic
1189921440 X:45906674-45906696 CAGCAGAAGCATGAGGATTCAGG - Intergenic
1190051900 X:47156778-47156800 CTGCAGCAGCATGATGGGCCAGG - Intronic
1191810553 X:65182465-65182487 GAGCAGGAGCATCATGACCTTGG - Intergenic
1193837601 X:86364584-86364606 GAGGAGAAGCATGATGTGATGGG + Intronic
1194922514 X:99783728-99783750 CAGTAGACCAATGATGAGCTGGG - Intergenic
1198283254 X:135163867-135163889 CAGCAGAAGCATAATAGGCCAGG + Intronic