ID: 1024295721

View in Genome Browser
Species Human (GRCh38)
Location 7:47840505-47840527
Sequence CTCTGGACAGGAGAGCTCCT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 220}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024295718_1024295721 -5 Left 1024295718 7:47840487-47840509 CCTTTCAAACAGGGGCTTCTCTG 0: 1
1: 0
2: 0
3: 18
4: 166
Right 1024295721 7:47840505-47840527 CTCTGGACAGGAGAGCTCCTTGG 0: 1
1: 0
2: 1
3: 16
4: 220
1024295713_1024295721 22 Left 1024295713 7:47840460-47840482 CCTCAGGATAAAGGTGTGTCTGG 0: 1
1: 0
2: 0
3: 11
4: 152
Right 1024295721 7:47840505-47840527 CTCTGGACAGGAGAGCTCCTTGG 0: 1
1: 0
2: 1
3: 16
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024295721 Original CRISPR CTCTGGACAGGAGAGCTCCT TGG Exonic
900348429 1:2223063-2223085 CTCTGGCCAGGGCAGCCCCTGGG + Intergenic
900435676 1:2629493-2629515 CTCTGGACGGGAGAGCACCGCGG + Exonic
900482516 1:2905944-2905966 CTCTGCAGAGGAGCTCTCCTGGG + Intergenic
902546935 1:17195979-17196001 CTCTGTCCAGGAGGGCTGCTGGG + Intergenic
903488523 1:23709581-23709603 CCCTTGACAGCAGAACTCCTTGG - Intergenic
904364469 1:30001687-30001709 CTCTGCAGAGAAGAGCCCCTGGG - Intergenic
905380272 1:37556952-37556974 CACTGGACAGGGCAGCTGCTGGG + Exonic
906008165 1:42496937-42496959 CTCTGTGCAGGAGAGCCACTAGG - Intronic
906280088 1:44547092-44547114 CTGTGGACACGAGAGCCCCCAGG + Intronic
906614918 1:47227450-47227472 CTCTGGACAGGAGTCATCCTAGG + Intronic
907222443 1:52916864-52916886 ATCTGGACAGAAGTGATCCTAGG - Intronic
907284083 1:53369236-53369258 CTCGGGACAACAGAGCCCCTGGG + Intergenic
908092451 1:60700355-60700377 CTCTGGATGGGGGAGCTCCCAGG + Intergenic
909132193 1:71751619-71751641 CTCTGGGCTGAATAGCTCCTGGG - Intronic
911969095 1:104407781-104407803 CTCTGCAAAGGACAGCTACTCGG - Intergenic
913088255 1:115458707-115458729 TTCTGGACAGGATAGCTTCTGGG - Intergenic
914432835 1:147635059-147635081 TTAAGGACTGGAGAGCTCCTTGG - Intronic
914445798 1:147749640-147749662 GTCTGGAGAGGAGAGCTCTTTGG + Intergenic
915040344 1:152963104-152963126 CTCTGGCCAGGAAACCTTCTGGG - Intergenic
915622215 1:157092736-157092758 CTCTGGGCAGAAGACCTCCCTGG + Exonic
915894575 1:159801948-159801970 CTCTGGAGACAGGAGCTCCTTGG + Intronic
919818103 1:201454665-201454687 CACTGGAGAAGAGAGCTCCGTGG - Intergenic
920967059 1:210709815-210709837 CACTGTATGGGAGAGCTCCTGGG - Intronic
1063953095 10:11242493-11242515 CTCTGGAGAGTATAGCTGCTGGG + Intronic
1064586316 10:16842857-16842879 CTGTGGACAGGAGTCCTCCTGGG - Intronic
1066641943 10:37562708-37562730 CTCTGGCCAACAGAGCTGCTTGG + Intergenic
1067026880 10:42850334-42850356 CGCTGAAAAGGAGAGCTCCTAGG - Intergenic
1067065614 10:43102489-43102511 CTCTGGGAAGCAGAGCTCCCGGG - Exonic
1067421805 10:46158692-46158714 CTCTGGCCTGGGGAGCTCCCAGG + Intergenic
1067507111 10:46864781-46864803 CTCTGGCCTGGGGAGCTCCCAGG + Intergenic
1067534904 10:47101900-47101922 TTCAAGACAGGAGATCTCCTGGG + Intergenic
1067654776 10:48183067-48183089 TTCTGGACAGGGGAGCTGCATGG + Intronic
1067739156 10:48881685-48881707 CTCTAGACTGGAGAGCTCTGTGG + Intronic
1069709426 10:70479161-70479183 CTTTGGAGAGGTGAGGTCCTGGG + Intronic
1069796133 10:71053128-71053150 CTCTGGGTAGGAGAGGCCCTGGG + Intergenic
1070672120 10:78385252-78385274 TGCTGGACAGGAGAGCTACATGG + Intergenic
1071398192 10:85243774-85243796 CTGTGGGCATGAGAGGTCCTGGG - Intergenic
1072036626 10:91568865-91568887 CCTTGGACATTAGAGCTCCTGGG - Intergenic
1072620700 10:97077283-97077305 CACAGGACAGGATAGATCCTGGG + Intronic
1073068846 10:100780861-100780883 CTCTAGAGAGCACAGCTCCTTGG - Intronic
1073681398 10:105708000-105708022 CTTTGGACAGCAGAGCTCCTGGG + Intergenic
1075340628 10:121644590-121644612 CTCAGGACTGAGGAGCTCCTGGG - Intergenic
1080401070 11:31935886-31935908 CCCTGGACAGGTAAGTTCCTTGG - Intronic
1082212038 11:49517230-49517252 CTCTCCACAGGAAAGTTCCTTGG + Intergenic
1083310614 11:61781763-61781785 CGCTGGACTGGAGGGCCCCTCGG - Exonic
1084415760 11:69032183-69032205 CTATGGTCAGGAAAGCTGCTAGG - Intergenic
1084437781 11:69154420-69154442 CTCTCCACAGGTGAGCTCCGTGG - Intergenic
1084700858 11:70785386-70785408 CCCTGGACAGGAGAGCTTTGGGG - Intronic
1085196130 11:74672914-74672936 CTCTGGGCAGCACAGGTCCTTGG - Intergenic
1085403564 11:76248535-76248557 CACTGGATGGCAGAGCTCCTAGG + Intergenic
1085994489 11:81893982-81894004 CTAGCCACAGGAGAGCTCCTTGG - Intergenic
1086637548 11:89107283-89107305 CTCTCCACAGGAAAGTTCCTTGG - Intergenic
1087338845 11:96877701-96877723 CTCTGGCTTGGGGAGCTCCTAGG + Intergenic
1087612094 11:100446985-100447007 CTCTTGACAGTAGAGCCCCCCGG + Intergenic
1088597017 11:111448487-111448509 CTCCGGACAGGAAAGTTCCCGGG - Intronic
1088608672 11:111556326-111556348 CTCTGGACACGAAAGCTCTGTGG - Intronic
1088719805 11:112582205-112582227 CTCTGGACAGGGGAGGGCCAAGG + Intergenic
1088909701 11:114181487-114181509 CTGTGGATAGCAGAGGTCCTTGG - Intronic
1089496651 11:118911435-118911457 CTCTGGGGAGGAAGGCTCCTGGG + Intronic
1090003261 11:122979847-122979869 CTGGGGACAGGACTGCTCCTGGG - Intronic
1091685036 12:2555507-2555529 CGCTGGAGAAGAGAGCACCTAGG + Intronic
1091958038 12:4664643-4664665 CTCTGCCCAGGAGAGCTATTGGG + Intronic
1096024476 12:48349664-48349686 CTCTGAAAAGGAAACCTCCTAGG - Intronic
1099683257 12:85855706-85855728 CTCTGGCTTGGGGAGCTCCTAGG + Intergenic
1104612458 12:130240933-130240955 CCCTGCTCAGGAAAGCTCCTGGG + Intergenic
1107627083 13:42299460-42299482 CTCTGGACAGCAGAAGTCATTGG + Exonic
1107631121 13:42343754-42343776 CTCTGGACAGGACACCTACCTGG + Intergenic
1112221789 13:97498453-97498475 CTCTTGACAGGAGTCCTCCCTGG + Intergenic
1114415296 14:22538873-22538895 CTGGGGACTGGAGAGCTCTTTGG - Intergenic
1114846021 14:26323117-26323139 CTCTGGACAGGATGTTTCCTCGG - Intergenic
1115775862 14:36714434-36714456 CTCCAGAGAGGAAAGCTCCTGGG - Intronic
1116013798 14:39382239-39382261 CTCTGGAAGGGAGAGCTCACAGG + Intronic
1117078078 14:52124096-52124118 ATCTGGACACAAGGGCTCCTTGG + Intergenic
1119122319 14:72090890-72090912 CCCTGGAAATGAGAGCTACTGGG - Intronic
1120968967 14:90191749-90191771 CTGAGGACAGGATTGCTCCTGGG - Intergenic
1121194307 14:92056177-92056199 CTCTGGGCACAAGAGCTCCTTGG + Exonic
1121437569 14:93929219-93929241 CTCCTCACAGGAGAGCGCCTCGG - Exonic
1121549397 14:94787470-94787492 CTCTGGAGAGGAGAGCTAATGGG - Intergenic
1122329858 14:100904784-100904806 CACCGGACAGGACAGCTCCCGGG - Intergenic
1122597371 14:102902762-102902784 ATCTGAACAGGAGAGCTGGTGGG + Intronic
1123180585 14:106466658-106466680 CCCTGGACAAGAGAGCTCAGCGG - Intergenic
1128091046 15:64919121-64919143 CTCTGGCCTGGACAGTTCCTAGG + Intronic
1130067152 15:80614233-80614255 CCCTGGAAATTAGAGCTCCTTGG + Intergenic
1130869996 15:87962942-87962964 CTCTGGCCAGAAGAGCCCTTTGG + Intronic
1132407483 15:101552574-101552596 CCCTGGGCAGGAGAACCCCTGGG - Intergenic
1133115574 16:3576319-3576341 CTGTGGGCAGGAGAGGCCCTGGG + Intronic
1139463561 16:67141832-67141854 CTCTGGCTCGGGGAGCTCCTAGG + Intronic
1141400737 16:83744845-83744867 CTCTGGAGAGGAAAGGACCTGGG - Intronic
1141746599 16:85930475-85930497 CTGTGGACAGGGGACTTCCTTGG - Intergenic
1142312405 16:89321513-89321535 CTCTGGCAAGGAGTGCTCCTGGG - Intronic
1142381193 16:89733118-89733140 CTCTGGACAGGAGGCCTCAGGGG - Intronic
1142882353 17:2891559-2891581 CTCTGGAAGTGAGATCTCCTGGG - Intronic
1144676794 17:17167206-17167228 CTCTGAGCAGGAGGGCTCCCGGG - Intronic
1148514827 17:48206777-48206799 CTCTGGAAAGCAGAACTCCAGGG + Intronic
1151475829 17:74343957-74343979 GTCTGGAAAGGGGTGCTCCTTGG + Intronic
1151823780 17:76512421-76512443 CTTGGGAGAGAAGAGCTCCTTGG - Intergenic
1152582570 17:81173055-81173077 CCGTGGCCAGGGGAGCTCCTCGG + Intergenic
1152603383 17:81276789-81276811 CTCAGGTCAGGAGAGCTTCCTGG + Intronic
1153801867 18:8678191-8678213 CTCTGGAGAGGAGAGTCACTAGG - Intergenic
1154508023 18:15061523-15061545 CCCTGGTTAGGAGAGCTCCCAGG - Intergenic
1155394902 18:25376918-25376940 CTCTGGACAGTTAAGCTCCAGGG + Intergenic
1156456799 18:37299394-37299416 CTCTGGGCAGGGATGCTCCTGGG + Intronic
1156534684 18:37850990-37851012 CTCTGGCCTGGAGACCTACTGGG - Intergenic
1159565778 18:70046890-70046912 CTCTCCACAGGACAGCTCCTGGG + Intronic
1160210391 18:76873670-76873692 CTTTGGACAGGAGCCCTGCTGGG - Intronic
1160262523 18:77308209-77308231 GTCTGCACAGAAGAGCTCCATGG + Intergenic
1160272323 18:77398259-77398281 AGCAGGACAGGAGAGCTTCTTGG + Intergenic
1163822684 19:19505289-19505311 CCCTCGTCAGGAGGGCTCCTGGG - Intronic
1163830045 19:19543265-19543287 TGCTGGACAGGCGAGCTCATGGG + Exonic
1163948799 19:20565395-20565417 CTCTGGCCTGGAGCGCTCCGTGG - Intronic
1165365976 19:35365214-35365236 CTCTGCACTGGAGAGCACTTGGG + Intergenic
1166045329 19:40226553-40226575 CTCTGCAAAGGAGAGGGCCTGGG + Exonic
1166376152 19:42328281-42328303 CTCCAGACAGGGGAGGTCCTGGG + Intronic
1166530846 19:43542675-43542697 CACTGGACAGCAGAGCTGCAAGG + Intergenic
1168416230 19:56170594-56170616 CTCTGCACAGAAATGCTCCTGGG + Intergenic
925318342 2:2941762-2941784 CTTTGGACAGGAGCACCCCTTGG - Intergenic
926171627 2:10556349-10556371 CTCTGGCTAGGACAGTTCCTTGG + Intergenic
926360197 2:12079579-12079601 CTCTTGTCTGGAGGGCTCCTCGG + Intergenic
927448987 2:23190207-23190229 CTTTGGAGAGGAGAGCTGATTGG - Intergenic
930971110 2:57397098-57397120 CTCTGGCTTGGGGAGCTCCTAGG + Intergenic
932284092 2:70518183-70518205 CTCGGGACAGGAAGGCTTCTAGG + Intronic
934507644 2:94906779-94906801 CTCTGGATGGCAAAGCTCCTGGG + Intergenic
935417886 2:102837812-102837834 CTCTGGGCAGGAGACTTCCAGGG + Intronic
937056516 2:118941898-118941920 CTGTGGGCTGGAGAGGTCCTGGG + Intergenic
937154256 2:119707592-119707614 CTCTGGACAGCAGGGCCCTTGGG - Intergenic
937423925 2:121781665-121781687 CTGGGGAGAGGACAGCTCCTGGG + Intergenic
938249484 2:129803046-129803068 AGCTGGACAGGAGCCCTCCTAGG + Intergenic
938490873 2:131760403-131760425 CTGTGGTCAGAAGTGCTCCTGGG + Intronic
940306083 2:152228132-152228154 TTCTGTCCAGGAGAGCTCTTTGG + Intergenic
940671545 2:156675678-156675700 CTCTAGAAAGGTGAGCTCTTTGG - Intergenic
941916830 2:170818557-170818579 CTCTGGACAGTAGAGGCCCCGGG + Exonic
943105739 2:183544008-183544030 CTCTGGGCAGGAGATCTCCAGGG + Intergenic
944215859 2:197255042-197255064 CTCTGGACAGGGAATCTCCTTGG - Intronic
946021142 2:216640949-216640971 CTCTTGAGAGAAGAGCTGCTGGG + Intronic
946140766 2:217688686-217688708 CCCTGAACAGTAGAGCTCCCAGG + Intronic
948900960 2:240956690-240956712 CTCTGGAGAGGAGGGCTCTGGGG + Intronic
1168734043 20:115192-115214 CTGTGCACAGGAGAACCCCTTGG + Intergenic
1170075592 20:12415456-12415478 GGCTGGCCAGGAGAGCTCCAAGG - Intergenic
1170526227 20:17240534-17240556 CTCTGTACAGGTGACCTCCAGGG + Intronic
1172055328 20:32150656-32150678 CTGTGGTCATGAGAGCTCCCCGG - Exonic
1172507267 20:35472708-35472730 CTCTGGTCATGAGAACTCTTTGG + Exonic
1173809160 20:45945931-45945953 CTCTGCTCAGGAAAGATCCTAGG - Intronic
1174183297 20:48688542-48688564 CTCTGCCCAGGATGGCTCCTGGG + Intronic
1175312798 20:58023688-58023710 CCCTGGCCCGGGGAGCTCCTAGG + Intergenic
1176003677 20:62847520-62847542 CTCTGGCCACCTGAGCTCCTTGG - Intronic
1176235277 20:64050905-64050927 CTCAGGGCAGGAGTGCCCCTGGG - Intronic
1176708009 21:10129273-10129295 CTGTGGTCAGAAGTGCTCCTGGG + Intergenic
1178265997 21:31143041-31143063 CTCTGGGCTGGTGAGCACCTGGG + Intronic
1178410728 21:32361806-32361828 CTCTGGATAGGAGCTATCCTAGG + Intronic
1179729878 21:43361780-43361802 CTCTGTTCAGGAGAGCTGCCTGG + Intergenic
1180023393 21:45143605-45143627 CTCTGCACATGGGACCTCCTGGG - Intronic
1180162578 21:46004845-46004867 GACTGGACATGAGAGCCCCTTGG + Exonic
1181423107 22:22815455-22815477 GTCAGGACAGGAAGGCTCCTGGG - Intronic
1181809502 22:25394847-25394869 CTCTGGACAGATGAGCCCTTGGG + Intronic
949922293 3:9012615-9012637 GTCTGGAAAAGAGAACTCCTAGG + Intronic
950430551 3:12948440-12948462 CCCTGGACTGGGGAGCTCATGGG + Intronic
952150485 3:30583923-30583945 CTAAGCAAAGGAGAGCTCCTTGG - Intergenic
953624167 3:44557084-44557106 TTCTGGAAAGCAGTGCTCCTGGG - Exonic
954614771 3:51964050-51964072 CTCTGGTCAGCAGGGCTCCCTGG + Intronic
954673572 3:52303565-52303587 CATTGGGCAGGAGACCTCCTTGG - Intergenic
955434033 3:58881238-58881260 CTGTGGACAGGAGGGCACTTGGG + Intronic
956136877 3:66108009-66108031 CTCTGTAGTGGAGGGCTCCTGGG + Intergenic
957005934 3:74946809-74946831 CTGTGGACAGGCAGGCTCCTTGG - Intergenic
961319769 3:126064498-126064520 CTCTGGACAGGTGAGGACCACGG - Intronic
961386241 3:126524784-126524806 CCCTGGACATGAGCGCTGCTGGG + Intronic
961546690 3:127639235-127639257 GTCTGCACAGGAGCGTTCCTGGG + Exonic
964111800 3:153095791-153095813 CTCTGGAGAGGAGAGAGGCTGGG - Intergenic
965289990 3:166865966-166865988 CCCTGGGTAGGGGAGCTCCTAGG - Intergenic
966477021 3:180360866-180360888 ATGTGGAAAGGAGAGCTCCAAGG - Intergenic
967503243 3:190223610-190223632 CTCTGGTCAGGAGATCCCCTTGG - Intergenic
968061805 3:195731531-195731553 GTCTGGACCTCAGAGCTCCTGGG - Intronic
968986903 4:3880527-3880549 ATCTGGGCAGAACAGCTCCTTGG - Intergenic
969225883 4:5798049-5798071 CTCTATCCAGGAGAGCTCCGAGG + Intronic
969675826 4:8613847-8613869 CTCTGGTCAGGACAGCGTCTGGG + Intronic
972356610 4:38285077-38285099 GTCTGGACAGACCAGCTCCTTGG + Intergenic
974329851 4:60464082-60464104 CTCTGCCCAGGAGAGTTCCACGG + Intergenic
975726128 4:77293431-77293453 CTCTGGTCATTAGAGCTCTTGGG + Intronic
980490711 4:133524455-133524477 CTGTGGGCAGGTGAGCCCCTCGG + Intergenic
981719533 4:147787530-147787552 CTCTGGGCAGGAGAGGTGGTTGG + Intronic
982240107 4:153291412-153291434 CTCTGGGTGGGAGAGTTCCTGGG + Intronic
982918828 4:161249299-161249321 CCCTGGGTTGGAGAGCTCCTAGG + Intergenic
985727971 5:1525529-1525551 CTCTGGAGAGGAGGGGCCCTAGG + Intergenic
991560274 5:67943850-67943872 TTCTGGTTAGGAGACCTCCTGGG - Intergenic
991678547 5:69114047-69114069 CACTGGACAGGAGTGGTCCAGGG + Intronic
991983484 5:72258204-72258226 CTCTGCCCAGGAAAGCTGCTGGG + Intronic
992693039 5:79258776-79258798 CTCTGGCTTGGGGAGCTCCTAGG + Intronic
994666248 5:102708943-102708965 ATCTTGACAGGAGAGATCATGGG + Intergenic
995332148 5:110957423-110957445 CTCTGGCTCGGGGAGCTCCTAGG - Intergenic
999451575 5:151682200-151682222 CTTAGGACTGGAGAGCTTCTGGG + Intronic
1001436014 5:171699934-171699956 CGCTGGAGAGGAGAGGGCCTAGG + Intergenic
1001958463 5:175864667-175864689 CTTTGCCTAGGAGAGCTCCTGGG + Intronic
1002541897 5:179911783-179911805 TTCTGGGCAGCACAGCTCCTTGG - Intronic
1002774690 6:318622-318644 TTCTGGACAGGAAAGGCCCTGGG - Intronic
1004810773 6:19259826-19259848 CTTTCAACAGGAGAGCTCCAGGG + Intergenic
1006182534 6:32162968-32162990 CTCTGGACCGAGGAGTTCCTGGG - Exonic
1008910348 6:56725495-56725517 CTCTGGAAAAGAGAGTGCCTCGG + Intronic
1012991567 6:105931536-105931558 CTCTGGACAGAACATCTTCTTGG + Intergenic
1014607315 6:123493071-123493093 CTCTGGAGAGGGGAGATCTTCGG + Intronic
1017824857 6:158074047-158074069 CTCAGCCCCGGAGAGCTCCTGGG - Intronic
1019165946 6:170097666-170097688 CACTGGCCAGCAGAGCTCCCAGG + Intergenic
1021978279 7:26030234-26030256 CTCAGGACATGAGACCTCATAGG - Intergenic
1024295721 7:47840505-47840527 CTCTGGACAGGAGAGCTCCTTGG + Exonic
1024874026 7:54000367-54000389 CCCTGGGGAGGAGAGCTCTTGGG + Intergenic
1025641371 7:63374587-63374609 GCCTGGACAGGAGAGCACCATGG - Intergenic
1027534300 7:79377368-79377390 CTCTGGCCATTAGGGCTCCTTGG - Intronic
1029986459 7:104927502-104927524 GGCTGGTTAGGAGAGCTCCTTGG + Intergenic
1031429163 7:121645068-121645090 TTCTGCAGAGAAGAGCTCCTTGG + Intergenic
1032001385 7:128267666-128267688 GTCTGGCCAGGAGGGCTGCTTGG + Intergenic
1032101052 7:128977941-128977963 CTAGGGAGAGGAGAGCACCTAGG - Intronic
1032888384 7:136166689-136166711 TTCCAGTCAGGAGAGCTCCTTGG + Intergenic
1033216932 7:139500068-139500090 GTCTGCGCAGGAGAGCTCCGCGG - Intergenic
1033550526 7:142443232-142443254 CTTTGGACAGAACAGCTCCAGGG + Intergenic
1035747005 8:1968330-1968352 CTCTGGACAGCAGTTCTCCTTGG + Intergenic
1040684588 8:49856700-49856722 CTATCCACAGGAGAGTTCCTGGG + Intergenic
1042123536 8:65513616-65513638 CCCTGGAAGGCAGAGCTCCTTGG + Intergenic
1044759950 8:95507390-95507412 CCCTGAAGAGAAGAGCTCCTGGG + Intergenic
1045326354 8:101120409-101120431 CTCGGGACCAGAGAGTTCCTGGG - Intergenic
1046677269 8:117124024-117124046 CTCTTGACAGGAGATGTCCCAGG + Intronic
1048262938 8:132961064-132961086 CTCTGGAAAGGTGAGCTCCGTGG + Exonic
1048821319 8:138383186-138383208 CCCTGGACATCAGAGCTCCTGGG - Intronic
1051200627 9:14618196-14618218 CACTGGTCAGGAGTTCTCCTGGG + Exonic
1052331296 9:27271652-27271674 CTCTGCACAGGGGAGCCCCATGG - Intergenic
1053644966 9:40114774-40114796 CTGTGGCCAGAAGTGCTCCTGGG + Intergenic
1053760754 9:41348754-41348776 CTGTGGCCAGAAGTGCTCCTGGG - Intergenic
1054325986 9:63712672-63712694 CTGTGGCCAGAAGTGCTCCTGGG + Intergenic
1054539609 9:66261195-66261217 CTGTGGCCAGAAGTGCTCCTGGG - Intergenic
1056790119 9:89619890-89619912 CTCTGGTCTGGAGAGCAGCTTGG - Intergenic
1058115417 9:101079202-101079224 GTCTGGTCTGGTGAGCTCCTAGG + Intronic
1062680503 9:137776713-137776735 CTGTGGGGAGGAGAGCTCCAAGG + Exonic
1202792772 9_KI270719v1_random:98242-98264 CTGTGGTCAGAAGTGCTCCTGGG + Intergenic
1203553954 Un_KI270743v1:190409-190431 CTCTGGATGGCAAAGCTCCTGGG - Intergenic
1186514546 X:10156825-10156847 CTCTGGACACGAATGCTCCGGGG + Intergenic
1188009044 X:25038827-25038849 CTGTGGAAATGAGAGCTCTTTGG - Intergenic
1188473004 X:30561304-30561326 CTATGGTCAGAAAAGCTCCTTGG - Intronic
1190470035 X:50769626-50769648 CTCTGGAAACAAGACCTCCTGGG + Intronic
1191617738 X:63187931-63187953 CTCTGGAAGGGGGAGCTCCCAGG + Intergenic
1195581060 X:106503065-106503087 CTCTGGAGTGGGGAGCTCCCAGG - Intergenic
1199904054 X:152206649-152206671 CGATGGCCAGGAGCGCTCCTGGG + Intronic