ID: 1024295989

View in Genome Browser
Species Human (GRCh38)
Location 7:47842721-47842743
Sequence CAGTGGAGACAGAAGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 998
Summary {0: 1, 1: 2, 2: 4, 3: 85, 4: 906}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024295979_1024295989 17 Left 1024295979 7:47842681-47842703 CCACTCAGAGACAGAACATATCT 0: 1
1: 0
2: 1
3: 10
4: 165
Right 1024295989 7:47842721-47842743 CAGTGGAGACAGAAGGAGAAGGG 0: 1
1: 2
2: 4
3: 85
4: 906
1024295985_1024295989 -8 Left 1024295985 7:47842706-47842728 CCGGGCTGCTTTCCACAGTGGAG 0: 1
1: 0
2: 12
3: 226
4: 1732
Right 1024295989 7:47842721-47842743 CAGTGGAGACAGAAGGAGAAGGG 0: 1
1: 2
2: 4
3: 85
4: 906
1024295984_1024295989 -7 Left 1024295984 7:47842705-47842727 CCCGGGCTGCTTTCCACAGTGGA 0: 1
1: 0
2: 1
3: 24
4: 287
Right 1024295989 7:47842721-47842743 CAGTGGAGACAGAAGGAGAAGGG 0: 1
1: 2
2: 4
3: 85
4: 906
1024295982_1024295989 -6 Left 1024295982 7:47842704-47842726 CCCCGGGCTGCTTTCCACAGTGG 0: 1
1: 0
2: 7
3: 55
4: 238
Right 1024295989 7:47842721-47842743 CAGTGGAGACAGAAGGAGAAGGG 0: 1
1: 2
2: 4
3: 85
4: 906

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024295989 Original CRISPR CAGTGGAGACAGAAGGAGAA GGG Intronic
900394232 1:2446567-2446589 CATTGGAGGCAGAGGGAGGAAGG + Intronic
900648364 1:3719073-3719095 CAGGGGCGGCAAAAGGAGAAGGG - Intronic
900666577 1:3819606-3819628 GACTGGAGATGGAAGGAGAAAGG + Intronic
900713144 1:4127708-4127730 CAGTAGAGACAAACGGTGAAAGG - Intergenic
900849967 1:5135034-5135056 CAGTAGATAAAGACGGAGAAAGG - Intergenic
900967863 1:5971840-5971862 CACTGGAGACAGAGGGAGACGGG + Intronic
901625617 1:10623189-10623211 GAGTGGAGACAGAGGGAGAGGGG - Intronic
901639914 1:10687967-10687989 TAGTGGGGGCAGAAGGAGGAAGG - Intronic
901755976 1:11441841-11441863 GAGAGGAGACAGGAGGAGAGAGG + Intergenic
901783931 1:11612178-11612200 CAGAGGAGAGAGAAGAAGACAGG + Intergenic
901798962 1:11696215-11696237 AAGGGGAGACAGAGGGAGTAAGG - Intronic
902113182 1:14099959-14099981 CAGGAGAGAGAGAAAGAGAAGGG - Intergenic
902645181 1:17792897-17792919 GAGTGGAGACAGGAGGACATAGG + Intronic
902959560 1:19953380-19953402 CAGTGGAGACAGAGAAGGAATGG + Intergenic
903139804 1:21332666-21332688 CGGAGGAGACAGGAGGAGAGGGG + Intronic
903632851 1:24789971-24789993 CTGTGGAGGGAAAAGGAGAAGGG + Intronic
903850351 1:26301926-26301948 CAGTGGAGAAGGATGGGGAAGGG + Intronic
904083266 1:27885476-27885498 GAGGGGAGACACAAGGACAAGGG - Intronic
904318708 1:29682661-29682683 CAGTGGGGTCAGAGGGAGCAGGG - Intergenic
904361313 1:29974103-29974125 TAGTGGGGACAGGAGAAGAAAGG + Intergenic
904596610 1:31650292-31650314 AAATGAAGACAGAAGGATAATGG + Intergenic
904644878 1:31958185-31958207 CAGTGGAGACAGAGGGGAGAGGG - Intergenic
904851463 1:33462798-33462820 GGATGGAGACAGAAAGAGAAAGG + Intergenic
905024159 1:34838361-34838383 CACTGGACACAGATGGAGTAAGG + Intronic
905420969 1:37843839-37843861 GAGGGGAGACAGGAGGAGTAGGG - Intronic
906550077 1:46657810-46657832 GAGTGGAAAAAAAAGGAGAAGGG + Intronic
906592171 1:47035597-47035619 CAGCGGAGTGAGAAGGAGCATGG - Intronic
907422570 1:54357133-54357155 GAGAGGAGACAGAAGGCCAAAGG + Intronic
907629848 1:56069526-56069548 CAGTGGAAAGAGCAGGAGCAAGG + Intergenic
907710449 1:56875933-56875955 CAGTGAGAACAGAAAGAGAATGG + Intronic
907749382 1:57247386-57247408 CAGTCATGGCAGAAGGAGAAGGG - Intronic
907809250 1:57852076-57852098 CAGGGGAGAAAGAAGAGGAAGGG - Intronic
907888926 1:58619768-58619790 AAGTGGAGACAGGAGAAGAAGGG + Intergenic
908068849 1:60436351-60436373 CAGGCGAGAAAGAAGGAAAATGG - Intergenic
908382122 1:63606544-63606566 CAGGGGAGAAAGATGGAGGAAGG + Intronic
908606440 1:65802248-65802270 CAGTGGAGTCAAAAGCAGGAAGG - Intronic
909364382 1:74802252-74802274 TATTGGAGAAAGAAGGAGAAAGG - Intergenic
909438792 1:75674361-75674383 CAGAGGAGACAAAAGAAAAAAGG + Intergenic
909700386 1:78514862-78514884 GAGGGGAGCAAGAAGGAGAAGGG - Intronic
910028828 1:82690507-82690529 CAGTGGGGAGAGAGAGAGAAAGG - Intergenic
910135607 1:83965369-83965391 CAGAAGAGACAGAAGAACAAAGG - Intronic
910278846 1:85476194-85476216 CAGAGGAGAAAGTAGGTGAAGGG - Intronic
910668994 1:89754132-89754154 TAGAGGACAGAGAAGGAGAATGG - Intronic
911314275 1:96337502-96337524 CAGAAGAGAAAGAAGGTGAAGGG + Intergenic
912452990 1:109778787-109778809 CAGAGGAGACAAATGGAGACTGG - Intergenic
913163114 1:116163219-116163241 CAGTGGAGGGAGATGGAGAGAGG + Intergenic
913255639 1:116950695-116950717 CAGTGGAGACAGAGGGGGCAGGG + Intronic
913334879 1:117700329-117700351 CAGTGGAGGAAGAATGAGAGGGG - Intergenic
914239907 1:145846401-145846423 CAGTGGGGCCAGTAGGTGAATGG - Intronic
915128953 1:153683975-153683997 CAGAGGAGAAAGAAAGAGAAGGG + Intronic
915301964 1:154956818-154956840 CAGTGGAGACACAGGGGGATGGG + Intergenic
915498090 1:156295185-156295207 CAGTGGGGACAGGATGAAAAGGG + Intronic
915548313 1:156616386-156616408 CAGTGAGGACAGAATGAGAAAGG - Intergenic
915594628 1:156889063-156889085 CATTGAAGACAGAAGCATAATGG - Intergenic
915624607 1:157106971-157106993 CAGTGGAGACAAGAGGAGAAGGG - Intergenic
915652901 1:157332211-157332233 CAGGGGAGGCAGAGGGAGACAGG - Intergenic
915656514 1:157365359-157365381 GAGAGGACAGAGAAGGAGAAAGG + Intergenic
915672772 1:157504212-157504234 GAGAGGACAGAGAAGGAGAAAGG - Intergenic
915685615 1:157629868-157629890 TATTGGAGACAGAAAGAGGAGGG - Intergenic
915730448 1:158050073-158050095 AAGTGGAGACTGGAGGAGAGAGG + Intronic
916058549 1:161083993-161084015 CAGGGGATACTGATGGAGAAAGG - Intronic
916069505 1:161161648-161161670 AATTGGAGCCAGCAGGAGAAGGG + Intronic
916763197 1:167835280-167835302 CAGAGGACACAGAAGGGTAAAGG - Intronic
916820543 1:168393978-168394000 CAGGGGAGAAAAAAGGAGAATGG + Intergenic
916824383 1:168430042-168430064 CAGGTGAGACAGATGGAAAAGGG + Intergenic
917659090 1:177160251-177160273 CAGTGGAGAAAACAGAAGAATGG - Intronic
917826365 1:178825409-178825431 CACTGGATTCAGAATGAGAAAGG + Intronic
917880137 1:179326995-179327017 CAGATGAGCCAGTAGGAGAAGGG + Intronic
918146941 1:181765326-181765348 GAGTGGAGACAGTAGAATAAGGG + Intronic
918149132 1:181783012-181783034 CGGAGGAGACAGAACGAGGAAGG - Intronic
918227344 1:182496122-182496144 CAGTCATGACAGAAGGTGAAGGG + Intronic
919275452 1:195409314-195409336 CAGAGGAGGCAGAAAGGGAAGGG + Intergenic
919518187 1:198553686-198553708 AATTGGAGACAGAAGAATAAGGG - Intergenic
920040153 1:203090283-203090305 TAGAGGAGCAAGAAGGAGAAGGG + Intergenic
920830150 1:209457222-209457244 CAGTGTGGAAAGAAAGAGAAAGG - Intergenic
921307961 1:213816012-213816034 CAGAGGAGAGAGAAAGAGACAGG + Intergenic
921308922 1:213824043-213824065 CAGGGGGGACAGTAGGAGACTGG - Intergenic
922331274 1:224578801-224578823 AAGAGGAGAAAGACGGAGAAGGG - Intronic
922353009 1:224750286-224750308 CATGGGAGACAGAAGGAAGAGGG - Intergenic
923523953 1:234758299-234758321 CACACGAGACAGAAAGAGAATGG + Intergenic
923600416 1:235397996-235398018 CAAAGCAGACAGAAGGAGCAAGG - Intronic
924250150 1:242124421-242124443 CTTTGGAGGAAGAAGGAGAAGGG + Intronic
924368682 1:243323500-243323522 CAGTGGAGAGAAAAGGATAAAGG - Intronic
1063180771 10:3597703-3597725 GAGAGAAGACAGAAGGAAAAGGG + Intergenic
1063938079 10:11099560-11099582 AAGTGGAAACAGAAGGAAATCGG - Intronic
1064322382 10:14317708-14317730 GAGGGGAGAGGGAAGGAGAAAGG + Intronic
1064360621 10:14661088-14661110 CAGTTGTGGCAGAAGGTGAAGGG - Intronic
1064755778 10:18570849-18570871 CAGTGGAGAATGGAAGAGAATGG - Intronic
1064926875 10:20579161-20579183 AAGTGGAGATGGAAGCAGAATGG - Intergenic
1065736560 10:28758296-28758318 AAGTAGAGACAGAAGGAGGAAGG - Intergenic
1065761576 10:28987780-28987802 AAGAGGAGAAGGAAGGAGAAAGG - Intergenic
1066592986 10:37016117-37016139 AAGTGAAGACAGAGAGAGAAAGG - Intergenic
1067133040 10:43583576-43583598 CAGAAGAGAAAGCAGGAGAATGG + Intergenic
1067687508 10:48476038-48476060 CAGTGGGGACAGAAGAGGCAGGG - Intronic
1067908608 10:50320757-50320779 AAGTGGAGATAGAGGGAGGAAGG - Intronic
1068086637 10:52381696-52381718 CAGTGGAGAAAGAAGGACAGAGG + Intergenic
1068658390 10:59597336-59597358 CAGTAGAGACAGAAAGAGCTAGG + Intergenic
1068846425 10:61680868-61680890 CAGGGAAGAAAGAAGGGGAAGGG + Intronic
1068858885 10:61826509-61826531 CTCTGGAGACAGATGGAGACTGG + Intergenic
1069726107 10:70580152-70580174 GATGGGAGACAGAAGGAGGAAGG - Intergenic
1070505255 10:77107227-77107249 CATTTGAAACAGAACGAGAAGGG + Intronic
1070518083 10:77226420-77226442 CAGTGAAGACAGAAAGAGACAGG - Intronic
1070629831 10:78076642-78076664 CCGTGGAGAGAGAGGGAGAGGGG + Intergenic
1070782378 10:79145205-79145227 CAGTGGAGAAAGACACAGAAAGG - Intronic
1071038763 10:81280949-81280971 CAGGGGAGACAGTAGGGGGATGG + Intergenic
1071114410 10:82200724-82200746 CAGAGGATAAAGAAAGAGAAAGG - Intronic
1071877757 10:89861295-89861317 AAGGAGAGAGAGAAGGAGAAGGG - Intergenic
1072231040 10:93414211-93414233 GGGAGGACACAGAAGGAGAAAGG - Intronic
1072957152 10:99897334-99897356 CAGTGAAGACAGGACAAGAAAGG + Intronic
1073320986 10:102616168-102616190 CACTGTGGACAGAAGCAGAAGGG - Intronic
1073597737 10:104817443-104817465 GAGAGGAGGAAGAAGGAGAAGGG - Intronic
1073627873 10:105118314-105118336 CAATCATGACAGAAGGAGAAGGG - Intronic
1074278742 10:112029956-112029978 CAGTGAGGAAAGAAAGAGAATGG - Intergenic
1074296374 10:112193148-112193170 CAGAGAAGACAAAAGTAGAAGGG + Intronic
1074403427 10:113161104-113161126 GAGTCGAGACACATGGAGAAGGG + Intronic
1074800379 10:116994498-116994520 CTGTAGAGACAGAGAGAGAAGGG + Intronic
1074984058 10:118641882-118641904 CAGTGGGGAGGGAAAGAGAAGGG - Intergenic
1075076303 10:119352935-119352957 CAGGGGAGAGAGAGGGAGGACGG - Intronic
1075217658 10:120552478-120552500 CAATGGTGATAGAATGAGAATGG - Intronic
1075489247 10:122852496-122852518 CAGTGGAGACTAAAACAGAAAGG - Intronic
1075667671 10:124242674-124242696 CAGGGGAAACAGAGGGGGAAGGG + Intergenic
1075717554 10:124565857-124565879 CAGTGGGGACAGGAGGGGGAAGG + Intronic
1076470220 10:130713555-130713577 CTGTGTGGACAGAAGGACAAGGG + Intergenic
1076686219 10:132199602-132199624 CAGTGCGGACAGCAGGAGGAGGG - Intronic
1077303998 11:1859765-1859787 CACTGCTGACAGCAGGAGAATGG - Intronic
1077358047 11:2127682-2127704 CAGTGGGGACAGGAGCAGGAGGG + Intergenic
1077388592 11:2288222-2288244 CAGTGGAGGCAGGTGCAGAAAGG + Intergenic
1077554895 11:3221159-3221181 GAGGGGAGGGAGAAGGAGAATGG + Intergenic
1077617214 11:3685381-3685403 CAGTGGACACAGAAAAAGCAGGG + Intronic
1078068454 11:8093262-8093284 CAGTGCAGGCAGCAGGAGCAAGG + Intronic
1078084415 11:8225100-8225122 GTGGGGAGACAGATGGAGAAAGG + Intronic
1078096788 11:8302440-8302462 GAGGGGAGAGAGAAGAAGAAAGG + Intergenic
1078255224 11:9653127-9653149 CAGTGGAGAATTAAGAAGAAAGG - Intergenic
1078378599 11:10818701-10818723 CAGTGGAGAAAGAAGAGGAGGGG - Intronic
1078714740 11:13829104-13829126 GTGGGGAGACAGAGGGAGAAGGG - Intergenic
1078831113 11:14978019-14978041 CAGAAGAGACAGGAGAAGAAGGG + Intronic
1078917046 11:15788087-15788109 CAGTGAAGACAGAAAAAGTAAGG + Intergenic
1078958858 11:16239312-16239334 CATTGGAGAGAGAGGGAGAGGGG - Intronic
1079098005 11:17523268-17523290 CTGTGGGGACAGAAGGACAGTGG + Intronic
1079338040 11:19588651-19588673 CACTGGAGGCAGAATGAAAAAGG + Intronic
1079407545 11:20159306-20159328 GAGGGGGGACAGAAGGAGAGAGG + Intronic
1079601377 11:22316158-22316180 CAGGGGAGACAGAGGCAGGAGGG - Intergenic
1079688999 11:23399383-23399405 CAGTGGTGGCAGAGTGAGAATGG + Intergenic
1079698835 11:23518946-23518968 CTGCTGAGAGAGAAGGAGAAAGG + Intergenic
1080352488 11:31401448-31401470 AAGAGGAGACAGCGGGAGAAGGG - Intronic
1080504558 11:32899784-32899806 CAGTGGAGAGAAAAGAAAAAAGG - Intronic
1080515730 11:33017697-33017719 CAGAGCACACAGAAAGAGAATGG - Intronic
1080695937 11:34603043-34603065 CAGGGAAGACAAGAGGAGAAGGG - Intergenic
1080885785 11:36366874-36366896 AAGGGGAGAAAGAAGGAGAGAGG - Intronic
1081698095 11:45132619-45132641 GAATGGAAACAGAAGTAGAAAGG - Intronic
1081912366 11:46707973-46707995 AAGTGTAGACAGCAGGAGCAGGG + Intergenic
1082288211 11:50339407-50339429 CAGTCGTGGCAGAAGGTGAAGGG + Intergenic
1082655431 11:55850481-55850503 CAGTGAAGTCAGAAGGTGAACGG + Intergenic
1082680406 11:56161634-56161656 GAGTGGAAACTGAAGGAGAGGGG - Intergenic
1082708650 11:56525752-56525774 CTGTCGTGGCAGAAGGAGAAAGG + Intergenic
1082718673 11:56646561-56646583 CAGGGGAGACAGAAGAAGGATGG - Intergenic
1082919631 11:58479179-58479201 TAGTTGAGACAAAAAGAGAAAGG + Intergenic
1083142523 11:60733703-60733725 AAGTGGAGGAAGAAGGAGCATGG + Intronic
1083887495 11:65580050-65580072 CAGGGGAGAGACCAGGAGAAGGG - Intronic
1083893345 11:65607833-65607855 CAGCGGGGACAGAATAAGAAGGG + Intronic
1083914625 11:65733186-65733208 GAGTGGAGACAAAAACAGAATGG + Intergenic
1084245746 11:67855931-67855953 GAGTAGAGACACAAAGAGAAGGG + Intergenic
1084346090 11:68549923-68549945 CTGTGGAGACAGCAGGAGTCTGG + Intronic
1084425774 11:69083898-69083920 CAGTGGGGCCAGGAGGAGTAAGG + Intronic
1084572718 11:69969216-69969238 CTTTGGGGACAGCAGGAGAAGGG - Intergenic
1084826939 11:71738647-71738669 GAGTAGAGACACAAAGAGAAGGG - Intergenic
1085056740 11:73409005-73409027 GAGTGGAGACAGGATTAGAAGGG - Intronic
1085262905 11:75218507-75218529 GAGTGAATGCAGAAGGAGAAAGG + Intergenic
1085454584 11:76658545-76658567 CCCTGGAGACAGAAGGATGAAGG + Exonic
1085751702 11:79167816-79167838 CTGTGGACACAGAAGGAGCCTGG - Intronic
1086141236 11:83502836-83502858 CAATGGAAACAGAAAAAGAATGG - Intronic
1086354469 11:85980234-85980256 CAGAGGATAGAGAAGGAGGATGG + Intronic
1086457102 11:86969774-86969796 AAATGGAGACAGCAAGAGAAAGG + Intergenic
1087679364 11:101202346-101202368 GAGTGGAGGCAGAAGGAGCCAGG - Intergenic
1087897023 11:103597520-103597542 CAGAGTAGACAGAAGGAAACAGG - Intergenic
1088026627 11:105192725-105192747 CAGTGAAGAGTGAAAGAGAAAGG - Intergenic
1088257748 11:107916796-107916818 ATGTGGAGCCAGAAGGAGGATGG - Intronic
1088940593 11:114451360-114451382 TAGTGGACTGAGAAGGAGAAAGG - Intergenic
1089330239 11:117684273-117684295 GTGGGGAGAAAGAAGGAGAAGGG - Intronic
1089558868 11:119333414-119333436 CAGGGCAGACTGAAGGAGGACGG + Intergenic
1089667558 11:120030065-120030087 CAGTCATGGCAGAAGGAGAAGGG + Intergenic
1090081241 11:123614216-123614238 CAGGGGAGGCAGAAGAAGAGGGG + Intronic
1090380311 11:126322173-126322195 CATTGGAGACAGAAGAAAACAGG + Intronic
1090710186 11:129376627-129376649 CAGTGGAGACAGTAGGAGGCTGG - Intronic
1090754791 11:129780316-129780338 CAGAGGAGACAGAAAGGGATGGG - Intergenic
1090766462 11:129880331-129880353 CTGTGGGGAATGAAGGAGAATGG - Intronic
1091178631 11:133583221-133583243 CAGTGGAGACAGAGATACAAAGG + Intergenic
1091217052 11:133908521-133908543 CAGTGGAGGCAGGAGGAGGAGGG - Intergenic
1091691994 12:2603620-2603642 CAATGGAGACAGCAGGAGACAGG - Intronic
1092026415 12:5244634-5244656 CAGTGTAAACAGCAGAAGAAAGG - Intergenic
1092195882 12:6549536-6549558 CAGAGGAGAGAGAGGGGGAAGGG + Intronic
1092387912 12:8050410-8050432 CAGGGAAGAGAGAAGGAGGATGG + Intronic
1093903802 12:24665564-24665586 CTGGGGAAACAGAAGCAGAAAGG + Intergenic
1093993273 12:25613959-25613981 GAGAGGAGACAGAAGGACAAAGG + Intronic
1094094499 12:26688539-26688561 CAGAGGAAGAAGAAGGAGAAGGG + Intronic
1094156086 12:27338221-27338243 AAGTGGATAAAGCAGGAGAAGGG + Intronic
1094303064 12:28987874-28987896 CGGTGGAGAAAGAGAGAGAATGG - Intergenic
1094451449 12:30586819-30586841 CACTGGAAACAGAATGAGAATGG - Intergenic
1095435404 12:42181402-42181424 CAGTGGAGACACAGGATGAAAGG - Intronic
1095529436 12:43168798-43168820 CCGTGAAGACAGTATGAGAAAGG - Intergenic
1095955345 12:47802703-47802725 CTGGGGGGACAGGAGGAGAAAGG + Intronic
1096602092 12:52736576-52736598 CACCGGAGACAGGAGGAGCATGG - Intergenic
1096673151 12:53211867-53211889 CAATGGAGAGAGAAAGAGAGAGG + Intronic
1096696947 12:53355331-53355353 CAGTGGGGAGGGAGGGAGAAAGG + Intergenic
1096836671 12:54355649-54355671 AAGGGGAGATACAAGGAGAATGG - Intergenic
1096841626 12:54383408-54383430 GAGTGGAGAGAAAGGGAGAATGG - Intronic
1097224291 12:57467959-57467981 GAGTGGAGACAGAAGGCAAACGG - Intronic
1097841364 12:64324839-64324861 CAGTGGAGATAGAAGTTGATGGG + Intronic
1098756789 12:74373982-74374004 CAGTGGACACCGAAGGAAAGCGG - Intergenic
1099639017 12:85260606-85260628 CGGTGGAGGTAGAGGGAGAAGGG - Intronic
1099740160 12:86624646-86624668 CAGTGGAGGAAGAAGGGGAAGGG + Intronic
1099876219 12:88409301-88409323 GAGTATAGAAAGAAGGAGAATGG + Intergenic
1099915700 12:88890301-88890323 TAGTGTAGTCAGAATGAGAAAGG - Intergenic
1100275818 12:93070937-93070959 CAGTAGAGACAGAGGCAGATGGG + Intergenic
1100679535 12:96903715-96903737 AAGAGGAGAAAGGAGGAGAAGGG - Intergenic
1102143648 12:110637646-110637668 AAGAGGAGAGAGAAGGAGACTGG - Intronic
1102193468 12:111007020-111007042 CTCTGGAGACAGATGGAGAGAGG + Intergenic
1102798911 12:115714528-115714550 CAGAGGAGGCAGGAAGAGAAAGG + Intergenic
1102990704 12:117313809-117313831 TAGGGGAGCCAAAAGGAGAAAGG - Intronic
1103081402 12:118026866-118026888 CTGTGTAGACAGAGGGGGAAAGG - Intronic
1103622920 12:122199980-122200002 CAGAGGAGACAGCAAAAGAAAGG - Intronic
1104165080 12:126219937-126219959 CAGTGGATACTGATGGAGACAGG + Intergenic
1105870846 13:24505155-24505177 CAGAGGAGAAAGAAAGAGAGAGG + Intronic
1105923371 13:24985071-24985093 CAGAAGATACAGCAGGAGAAGGG + Intergenic
1106086666 13:26548799-26548821 AAGTAGAGACAGCTGGAGAAGGG - Intergenic
1106355833 13:28982169-28982191 CAGTGAAGACAGATGGAAAAAGG + Intronic
1107413153 13:40176290-40176312 CAGTGGAGAGGCAGGGAGAAAGG - Intergenic
1107788789 13:43980116-43980138 TCATGGTGACAGAAGGAGAAAGG + Intergenic
1108087131 13:46805128-46805150 CAGGAGAGACAGAGAGAGAAGGG - Intergenic
1108148094 13:47500976-47500998 AAGGGCAGACAGAATGAGAAGGG - Intergenic
1108928915 13:55790020-55790042 AAATGGAGAAAGAAAGAGAAAGG - Intergenic
1109341363 13:61064672-61064694 CAGTTATGGCAGAAGGAGAAGGG + Intergenic
1109448986 13:62483784-62483806 GAGTGGAGAAAGAGGAAGAAGGG - Intergenic
1109576478 13:64265229-64265251 CAGTCAAGACAGAAGCAGTATGG + Intergenic
1109628067 13:65004741-65004763 CAGTGGAGACACAAATAAAATGG + Intergenic
1110583469 13:77159650-77159672 CAGGAGAGAGAGAAGGGGAAAGG - Intronic
1110901963 13:80835327-80835349 CAGTCATGACAGAAGGTGAAGGG + Intergenic
1111080660 13:83302428-83302450 CAGAAGAGACAGAAGGGTAAAGG - Intergenic
1111186884 13:84749219-84749241 AAGTGGAGATATTAGGAGAATGG - Intergenic
1111714482 13:91862967-91862989 AAGGGGAAAGAGAAGGAGAAAGG - Intronic
1111999841 13:95199891-95199913 TAGTGGAGAGAGATGGGGAAGGG - Intronic
1112730978 13:102361943-102361965 CAATGAAGACTGAAGGAGACTGG - Intronic
1113433318 13:110268834-110268856 CAGGTGAGACACAAGGAGGAGGG + Intronic
1113504225 13:110802439-110802461 CACTGAAGACAGAAGGAAATAGG + Intergenic
1113585249 13:111460185-111460207 GAGTGAAGAGAGAAGGGGAAAGG + Intergenic
1114080774 14:19200273-19200295 CAGAGGACACAGAAGGAGGGAGG + Intergenic
1114517396 14:23308774-23308796 CAGGAGAGAAAGAAGGAGAAAGG - Intronic
1114530966 14:23396264-23396286 CAGGTGAGACAGGAGGAAAAGGG - Exonic
1115494061 14:33985073-33985095 CCGTGGAGAGAGAGGGAGAGGGG + Intronic
1115752428 14:36505895-36505917 CAGTGTGGAGAGAAGGAGAGGGG - Intronic
1116288287 14:43001431-43001453 CAATTGAGACAGAAGGAAGAAGG + Intergenic
1116444358 14:44991327-44991349 CAGTGCTGACAGAAGGAGACTGG - Intronic
1116725000 14:48552571-48552593 CAGAGGAGACAAAAGAAAAAAGG - Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117026546 14:51626217-51626239 CAGTAAAGAGAAAAGGAGAATGG - Intronic
1117083366 14:52174726-52174748 CCATGAAGACAGAAGGAAAATGG - Intergenic
1117286546 14:54291258-54291280 GAGTGGAGGAAGAAAGAGAAGGG + Intergenic
1117874817 14:60241102-60241124 ACGTGGAGAGAGCAGGAGAATGG + Intergenic
1118140826 14:63080164-63080186 CAGTTATGACAGAAGGTGAAAGG - Intronic
1118294575 14:64557408-64557430 AAGGGGAAAGAGAAGGAGAAGGG + Intronic
1118915660 14:70101344-70101366 CAGTGGATAAAGAAAGAGAATGG + Intronic
1119012604 14:71010966-71010988 CAATGGAAACAGTAGGAGGAGGG + Intronic
1119476773 14:74934977-74934999 CAGAGAAGAGAGAAGGAGAAGGG + Intergenic
1121003090 14:90465976-90465998 CAGGGGAGAGAGAGGGAGACTGG + Intergenic
1121018979 14:90567401-90567423 TAGTGGAGAGCGAAAGAGAAAGG + Intronic
1121059302 14:90889862-90889884 CAGTACAGAAAGAAGGAGCAAGG - Intronic
1121317925 14:92973326-92973348 CACTGGAAACAAAAGGAGGAGGG + Intronic
1122289791 14:100674388-100674410 CAATGGAGACTGAGGGGGAAAGG + Intergenic
1122302108 14:100737092-100737114 TGGTGGAGACAGGAGGGGAAGGG - Exonic
1122392789 14:101401803-101401825 AAGAGGAAAGAGAAGGAGAAGGG - Intergenic
1122879453 14:104683495-104683517 GAGGGGAGAGTGAAGGAGAAGGG + Intergenic
1123856551 15:24417595-24417617 CAATCATGACAGAAGGAGAAGGG + Intergenic
1123861198 15:24468392-24468414 CAATCATGACAGAAGGAGAAGGG + Intergenic
1123954205 15:25316984-25317006 CAGTGGAGAAAACAGGACAAAGG - Intergenic
1124805729 15:32880519-32880541 CAGTGGAGAAGGAAGGTGAATGG - Intronic
1125303496 15:38283145-38283167 CAGTCATGACAGAAGGCGAAGGG + Intronic
1125317991 15:38452955-38452977 CAGTTGTGGCAGAAGGGGAAGGG - Intergenic
1125730005 15:41887798-41887820 AAGTGGACACAGATGTAGAAAGG - Intronic
1127105884 15:55614538-55614560 CACTGAAGAGAAAAGGAGAAAGG + Exonic
1127137753 15:55942563-55942585 CAATTGTGACAGAAGGTGAAGGG - Intronic
1128396198 15:67228979-67229001 GAGGGGAGACAGTAGGAGGAGGG + Intronic
1128405716 15:67335736-67335758 CAGGTGAGTCAGAAGGGGAAAGG - Intronic
1128583825 15:68829841-68829863 CAGGAGAGCCAGAAGGATAAAGG - Intronic
1128679409 15:69637081-69637103 CAATGAAGGCAGAATGAGAAAGG - Intergenic
1128705752 15:69836549-69836571 CAGTGGAAACAGAAACAGAAAGG - Intergenic
1128744159 15:70101993-70102015 CAGTGGAGGCAGTAGAGGAAGGG - Intergenic
1128877210 15:71212150-71212172 GAGTAGAAACAGAAAGAGAAAGG - Intronic
1129039173 15:72670884-72670906 CAGTGCAGACAGGAGAAGGAGGG - Intergenic
1129976982 15:79830874-79830896 AAGAAGAGACAGAAGGATAAAGG + Intergenic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1130271687 15:82454170-82454192 CAATGGAAAGAGCAGGAGAAGGG + Intergenic
1130464035 15:84181557-84181579 CAATGGAAAGAGCAGGAGAAGGG + Intronic
1130474836 15:84255487-84255509 CAATGGAAAGAGCAGGAGAAGGG + Intergenic
1130482252 15:84369543-84369565 CAATGGAAAGAGCAGGAGAAGGG + Intergenic
1130488649 15:84413276-84413298 CAATGGAAAGAGCAGGAGAAGGG - Intergenic
1130500232 15:84491984-84492006 CAATGGAAAGAGCAGGAGAAGGG - Intergenic
1130507787 15:84562463-84562485 CAATGGAAAGAGCAGGAGAAGGG - Intergenic
1130586331 15:85186189-85186211 CAATGGAAAGAGCAGGAGAAGGG + Intergenic
1130941302 15:88511561-88511583 CAGTGGAGACAGATGAAGGAAGG - Intronic
1131003447 15:88956519-88956541 CAGTCATGACAGAAGGCGAAGGG - Intergenic
1131489127 15:92847192-92847214 TAGTAGAGAGAGAAAGAGAATGG - Intergenic
1131522483 15:93126900-93126922 CAGTGGACACAGCTGGAGCAGGG + Intergenic
1131569206 15:93516599-93516621 CAGCGGGGACAGCAGGAGCAGGG - Intergenic
1131723298 15:95195319-95195341 CAGTTGTTAAAGAAGGAGAAGGG + Intergenic
1131761202 15:95624410-95624432 CAGTTGAGACAGAAGAAGTAAGG + Intergenic
1132428119 15:101737776-101737798 CAATGGAAAGAGCAGGAGAAGGG - Intronic
1132839811 16:1973536-1973558 CAGTGGAGAAGGAAGGAGAAGGG + Intronic
1132997912 16:2832896-2832918 AAGTGGAGACAAAGGGAGGAGGG + Intronic
1133620602 16:7522490-7522512 TAGTGGAGAGAGATGCAGAAGGG + Intronic
1133678629 16:8099453-8099475 GTGTGGAGCCAGAAGCAGAAAGG + Intergenic
1133841769 16:9416548-9416570 CATTGCAGAGAGAGGGAGAATGG + Intergenic
1133885355 16:9822423-9822445 AACTGGAGAGAGAACGAGAAAGG + Exonic
1134074699 16:11282432-11282454 CCGTGGAGACAGAAAGTGATCGG + Intronic
1134365485 16:13573772-13573794 CTGTGGAGACAGTGGGATAATGG + Intergenic
1134507561 16:14820708-14820730 ATGTGGAAACAGGAGGAGAAAGG + Intronic
1134563327 16:15229498-15229520 TGGTGGAGAGAGAAGAAGAAGGG + Intergenic
1134682381 16:16135311-16135333 AAGTGGGGACAGATGGAGGAGGG - Intronic
1134695259 16:16219470-16219492 ATGTGGAAACAGGAGGAGAAAGG + Intronic
1134718963 16:16370596-16370618 AAGGGGAGAGAGATGGAGAAAGG - Intergenic
1134923854 16:18141126-18141148 TGGTGGAGAGAGAAGAAGAAGGG + Intergenic
1134976573 16:18575216-18575238 ATGTGGAAACAGGAGGAGAAAGG - Intergenic
1135107259 16:19661033-19661055 AAATGGAGAGTGAAGGAGAAAGG - Intronic
1135481004 16:22820499-22820521 CAATCATGACAGAAGGAGAAAGG + Intronic
1136238882 16:28932323-28932345 CTGTGGAGAGAGAGGGAGAGAGG - Intronic
1136987878 16:35128298-35128320 CAATTGTGACAGAAGGTGAAGGG + Intergenic
1137611875 16:49823672-49823694 CAGAGGAGACAGTAAGAGGAAGG + Intronic
1138150895 16:54655793-54655815 AAGTGGAGAAGGAAGGAGAGGGG + Intergenic
1138518609 16:57555955-57555977 CAGGGGAGAGAGAGAGAGAAGGG - Intronic
1139299876 16:65935781-65935803 GATTAGAGACAGAGGGAGAAGGG - Intergenic
1139358784 16:66383631-66383653 CAGTGGAGACTCAAAGAGAAGGG - Intronic
1139782360 16:69362337-69362359 CACTGCAGGCAGGAGGAGAAAGG - Intronic
1140566250 16:76046286-76046308 CACTGGAGACAGAAAGAGTGAGG + Intergenic
1140665687 16:77225132-77225154 CAGGAGAGACAGAAGGAAAATGG - Intergenic
1140805962 16:78532661-78532683 CAGTGATGGCAGAAGGTGAAAGG + Intronic
1141159216 16:81617916-81617938 CAGTGGACACAGAAGAGGGAGGG + Intronic
1141381027 16:83577232-83577254 CAGTGGACACAGTAGGACAGGGG - Intronic
1141710318 16:85695213-85695235 CAGTGAAGACACGAGGAGATGGG + Intronic
1141799726 16:86298573-86298595 CATTGCAGAAAGAGGGAGAAAGG + Intergenic
1141921483 16:87138560-87138582 CAGAGGAGACAGAAGGGCAAAGG + Intronic
1203142496 16_KI270728v1_random:1777482-1777504 AAGAGGAGGCAGAAAGAGAAGGG - Intergenic
1143158860 17:4856092-4856114 CTATGGCGAGAGAAGGAGAAGGG - Intronic
1143364381 17:6396317-6396339 CAGAGAAGGAAGAAGGAGAAAGG + Intronic
1143465348 17:7132765-7132787 CAGTGGAGACGGAGGGACAGTGG - Intergenic
1144235648 17:13258019-13258041 CAGTGGAGGGGGAAGGGGAAGGG - Intergenic
1145010556 17:19365322-19365344 CTGTGGAGAGAGGAGGTGAAGGG + Intronic
1145978872 17:28999716-28999738 CAGTGGAGGCTGAAGGGGAGAGG + Intronic
1145990382 17:29075761-29075783 CAGTGGAGGCAGGAGGAGTACGG - Exonic
1146554770 17:33813923-33813945 CAGTGGAGGGAGAATGAGGAAGG + Intronic
1146846535 17:36184617-36184639 ATGTGGAGAAAGAAGCAGAATGG - Intronic
1147569465 17:41559625-41559647 GAGTGGAGAGAGAAGTAGAGGGG - Intergenic
1147692091 17:42322373-42322395 CAGTGGAGACACCAGGATATTGG + Exonic
1148062733 17:44847882-44847904 CAGTGAAGACAGAATGAGCTGGG + Exonic
1148673781 17:49433059-49433081 CAGTGGAGGGAGTAGTAGAATGG - Intronic
1148694223 17:49549421-49549443 CAGGGCAGGCAGAGGGAGAAAGG + Intergenic
1149016017 17:51909151-51909173 CAGGTGAGATAGAAGGTGAAAGG + Intronic
1149023537 17:51998092-51998114 CAGTGCAGACAGACAGAGGAAGG + Intronic
1149576692 17:57718726-57718748 CAGGAGAGAAAGAAGGAGAAAGG + Intergenic
1150118050 17:62572254-62572276 CAGTAGAGGAAGAAGGAGAAGGG + Intronic
1150563213 17:66313070-66313092 CAGAGGAAACAGAAGTAGAGAGG - Intronic
1150915745 17:69435209-69435231 CAATGGAGATAGAGGAAGAATGG + Intronic
1151193737 17:72416919-72416941 AAGTGGACCTAGAAGGAGAAAGG - Intergenic
1151228710 17:72666377-72666399 CAGTGGAGGCCAAATGAGAAAGG + Intronic
1151376355 17:73691497-73691519 CAGGGAAGACTGTAGGAGAAGGG - Intergenic
1151492244 17:74439724-74439746 CCCTAGAGACAGAAGGAAAAGGG - Exonic
1151596765 17:75082697-75082719 AAATGGACACAGAAGGAGACAGG - Intergenic
1152032365 17:77851824-77851846 AGGTGGAGACAGAAGAAGAGGGG - Intergenic
1152037436 17:77881817-77881839 CGGTGGAGACAGACAGAGACAGG + Intergenic
1153376366 18:4384931-4384953 GAGTGGAGAGAAAAGGAGCAGGG - Intronic
1155555863 18:27018831-27018853 CAGGAGAGAGAGCAGGAGAATGG + Intronic
1155728962 18:29127916-29127938 CAGGAGAGAGAGAAGGCGAAGGG + Intergenic
1156159121 18:34338566-34338588 AAGAGGAGACAGAAACAGAAGGG + Intergenic
1156236964 18:35215156-35215178 CACTTCAGCCAGAAGGAGAAAGG + Intergenic
1156622161 18:38865113-38865135 CAGTCATGACAGAAGGTGAAAGG - Intergenic
1156799581 18:41093363-41093385 CAATAGAGAGAGAACGAGAATGG - Intergenic
1157048284 18:44129547-44129569 CAGTTGAGAGAGTAGGAAAAGGG - Intergenic
1157146680 18:45170292-45170314 CATTAGAGACAGAAGCAGAAGGG + Intergenic
1157385547 18:47257092-47257114 GAGAGGAGAAAAAAGGAGAAGGG + Intergenic
1157619469 18:49007970-49007992 CTTTGGAGGCAGTAGGAGAATGG + Intergenic
1157630722 18:49092757-49092779 ATCTGGGGACAGAAGGAGAAGGG + Intronic
1157653615 18:49362596-49362618 CATTCCAGACAGCAGGAGAAAGG + Intronic
1157665891 18:49486786-49486808 TAGTGGAGACAGAGGGAGCGGGG + Intronic
1158203241 18:54962784-54962806 TAGTGGAGTGAGTAGGAGAACGG - Intergenic
1158748387 18:60227993-60228015 CAGTCGTGGCAGAAGGTGAAGGG + Intergenic
1158774000 18:60555196-60555218 CTGTGGAGCCAGAAGGAGCTGGG + Intergenic
1158894700 18:61901773-61901795 TTGTGGAGATAGAAGGAAAAGGG - Intergenic
1159058749 18:63492732-63492754 CAGAGGAGAATGAAGGAGCAGGG - Intronic
1159075781 18:63680264-63680286 AAGAGGAGACTGAAGGTGAAAGG + Intronic
1159375528 18:67587355-67587377 CACTGGAGACAGAATTGGAAAGG - Intergenic
1159532313 18:69670335-69670357 CAGTTGAGAGAGAAAGAGACAGG - Intronic
1160672812 19:374214-374236 CAGTGGGGACAGGAGGAGCCCGG + Intronic
1160975531 19:1790543-1790565 CAGTGGAGGGAGAAGGGGAGAGG - Intronic
1161009776 19:1954619-1954641 CAGTGGAGACAGTCAGAGAAGGG + Intronic
1161458340 19:4381278-4381300 CAGAGGGGACAGAGGGAGACGGG - Intronic
1161485525 19:4533723-4533745 ACGTGGAGACAGAAGGATACAGG + Intronic
1162424775 19:10588005-10588027 CAGAGGAGAAAGAAGGTGAATGG - Intergenic
1162459955 19:10808951-10808973 CATAGGAGATAGAAGGAGGAGGG - Intronic
1162777252 19:12987372-12987394 GAGGGGAGAGGGAAGGAGAAGGG + Intergenic
1162829493 19:13275652-13275674 CCATGGAGGAAGAAGGAGAAGGG - Intronic
1163050208 19:14677495-14677517 TAGAGGAGACAGGACGAGAATGG + Intronic
1163801443 19:19368155-19368177 CAGTGGGGGCAGAAGGATGATGG - Intergenic
1164037883 19:21469838-21469860 CATTGGTGACAGAAGAAAAAAGG + Intronic
1164207903 19:23073221-23073243 CATTGGTGACAGAAGAAAAAAGG + Intergenic
1164859421 19:31551163-31551185 AAGAGGGGAGAGAAGGAGAAGGG - Intergenic
1165080785 19:33304781-33304803 AGGAGGAGACAGAAGGAGTAGGG + Intergenic
1165376910 19:35449404-35449426 CTGTGAGGACAGGAGGAGAAAGG + Intronic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1165504212 19:36214614-36214636 CAGGGGAGGCAGAAGGTGAGGGG - Exonic
1165639173 19:37369873-37369895 CAGTGGGAACAGAAGGGGACTGG - Intergenic
1166274922 19:41746681-41746703 CACAGGAGAAAGAAGGAAAATGG + Intronic
1166424299 19:42662167-42662189 CAGTGGACACAGCAGGAGTTTGG + Intronic
1166800124 19:45451376-45451398 CAGGGGAGACAGACAGACAAGGG + Intronic
1167055598 19:47110055-47110077 CAGTGGAGACAGGCAGAGATGGG + Intronic
1168006707 19:53495832-53495854 GAGAGGAGACAGGAAGAGAAGGG - Exonic
1168296528 19:55379728-55379750 CAGTGAAGACAGAAGGAGGCCGG + Intronic
925319975 2:2957467-2957489 CAGTCATGGCAGAAGGAGAAGGG + Intergenic
925637112 2:5951165-5951187 CTGGGGAGAGAGAAGGAGGAAGG - Intergenic
926179473 2:10628498-10628520 CAATGGATAGAGTAGGAGAAGGG - Intronic
926603799 2:14876369-14876391 GAGTGGAGACATAAGGAAACTGG - Intergenic
927704443 2:25288324-25288346 CTGGGGAGGCAGCAGGAGAATGG + Intronic
927705851 2:25296210-25296232 CTTTGGAGACAGTTGGAGAAGGG + Intronic
928142021 2:28737943-28737965 CATTGGAGAGAGAAAGAGAGAGG + Intergenic
928305912 2:30170260-30170282 CAGAGGAGACAGACACAGAAAGG - Intergenic
928395937 2:30943373-30943395 CAGTGGATCCAGAGGGTGAAGGG + Intronic
928438004 2:31268419-31268441 CAATGGAGGCTGAGGGAGAAGGG + Exonic
928443497 2:31312799-31312821 TAGTGGAGAGAGAAGGAAAGAGG - Intergenic
928691247 2:33801433-33801455 CAGGGGAGACAGTAGGAGAGAGG + Intergenic
929052402 2:37849211-37849233 AAGTGGGGGAAGAAGGAGAAGGG - Intergenic
929083341 2:38143473-38143495 CAGTGGACACTGAAAAAGAAAGG - Intergenic
929262453 2:39880987-39881009 CTGTGGAGACAGAAGACTAATGG + Intergenic
929557120 2:42932384-42932406 CAGTGGGGACAGAGGGACGATGG - Intergenic
929911386 2:46092433-46092455 CAGAGGGGAGACAAGGAGAAAGG + Intronic
929936778 2:46298896-46298918 GGGTGGAGACAGGAGGAGAAAGG - Intronic
930037029 2:47092629-47092651 CAGAGGGGAGAGGAGGAGAAAGG + Intronic
930265980 2:49199542-49199564 CAGGGGACACAGAGGGACAATGG - Intergenic
930444571 2:51453509-51453531 CAGTGGAGACTCAATGAGGAAGG - Intergenic
930997443 2:57737503-57737525 CAGAGCAGAAAGAAGGAGACTGG + Intergenic
931147996 2:59541055-59541077 CAGTTGTGGCAGAAGGGGAAGGG - Intergenic
931170621 2:59799877-59799899 CTGTGGAGATAGATGGAGGACGG + Intergenic
931196198 2:60054225-60054247 CACTGCAGAGAGAAGGAGAAAGG - Intergenic
931212254 2:60208354-60208376 CAGTGGAGACAGAGGCAGGTTGG - Intergenic
931286209 2:60834086-60834108 CAGTGGAGAGGGTATGAGAATGG + Intergenic
931437177 2:62257742-62257764 CTGTGGAAACAGAAGAACAAAGG + Intergenic
932138448 2:69253403-69253425 GAGTGGAGAGAGAAATAGAAGGG + Intergenic
932722528 2:74148128-74148150 CTGGGGAGACTGAAGGAGAGCGG - Intergenic
933588270 2:84203246-84203268 CAGGAGAGACAGAAAGAAAATGG + Intergenic
934162473 2:89264839-89264861 CATTGGAGACAGAAGTGGAGAGG - Intergenic
934204801 2:89917877-89917899 CATTGGAGACAGAAGTGGAGAGG + Intergenic
934552812 2:95272514-95272536 AATTGGAGGGAGAAGGAGAAGGG + Intergenic
934818188 2:97348472-97348494 CAGTGCAGACAGGAGGAGGCAGG + Intergenic
935442736 2:103121394-103121416 CAGTGTGTAAAGAAGGAGAAAGG + Intergenic
935867577 2:107407590-107407612 CAGAGGTGACAGAGGAAGAAAGG - Intergenic
935879297 2:107544958-107544980 GAGTGGAGATGGAAGGAGACTGG + Intergenic
936060616 2:109293470-109293492 CAGTGGAGAGAGAAGGGGGCAGG - Intronic
936731666 2:115388502-115388524 CAGTGGAGATAGAAGAGGGATGG + Intronic
938337767 2:130514311-130514333 CAATGGAGACAAAGGGTGAAGGG - Intergenic
938352072 2:130606424-130606446 CAATGGAGACAAAGGGTGAAGGG + Intergenic
938554137 2:132408595-132408617 CAGTGGGGAGGGAGGGAGAAAGG + Intergenic
938886442 2:135654157-135654179 CATAGGAGACAGAAGCAGATTGG - Intronic
941010769 2:160297197-160297219 CAGGGGAGAAAGATGGAGGAGGG + Intronic
941036678 2:160576351-160576373 CAAAGGAGACAGAGGGAGACAGG + Intergenic
941242239 2:163053805-163053827 CCGTGGAGATAGAAAGTGAAAGG - Intergenic
941256187 2:163234252-163234274 CAAGAGAGACAGAAAGAGAAGGG + Intergenic
942415384 2:175753201-175753223 AAGAGGAGAAAGAAGAAGAAGGG - Intergenic
942692578 2:178601967-178601989 CAGTGGAAAAAAGAGGAGAATGG + Intronic
943011200 2:182451796-182451818 CCGTGGAGGCAGTAGGAGAGAGG - Intronic
943617356 2:190108692-190108714 TATTGGAATCAGAAGGAGAATGG + Intronic
944096879 2:195977446-195977468 CAGAGGAGACAAAAGAAAAAGGG + Intronic
944669652 2:201984341-201984363 AGGTGGAGACAGAAAGAGCAGGG + Intergenic
945264941 2:207881778-207881800 CACTGGAAAGAGTAGGAGAAAGG - Intronic
945752308 2:213803468-213803490 CAGAAGAGACAGAAAGACAATGG - Intronic
945792357 2:214320630-214320652 CAGTGCAGTAGGAAGGAGAAGGG + Intronic
945942668 2:215965470-215965492 CAGGGGATACAGAGGGAGGAAGG + Intronic
946237547 2:218333218-218333240 CAGTGGAGACAGCAGAAACAAGG - Intronic
946391201 2:219418057-219418079 CAGGGGAGACAGCAGAAGAGAGG - Intergenic
946391543 2:219419408-219419430 CAGTGTAGCCAGAGGGAGAAGGG + Intronic
946482887 2:220073811-220073833 AAGGGGAGGCAGAAGGAAAATGG + Intergenic
946541678 2:220690892-220690914 TAGTTGAGACTGAAGGAGAGTGG - Intergenic
946864917 2:224034335-224034357 CAATGAACACAGGAGGAGAAAGG + Intronic
947077041 2:226355916-226355938 GAGAGGAGAGAGAAAGAGAAAGG + Intergenic
947243476 2:228020961-228020983 CAGTGGGTACAGAAGGAGAAGGG + Intronic
947347534 2:229208775-229208797 CGGAGGAGGCAGGAGGAGAAAGG + Intronic
947544275 2:231000343-231000365 CTGTGGGGACAGAAGGAGAGAGG - Intronic
947685757 2:232082927-232082949 CAGTCGTGGCAGAAGGTGAAAGG + Intronic
947777152 2:232722287-232722309 CAGTCATGGCAGAAGGAGAAGGG + Intronic
948084202 2:235232784-235232806 CACTGGAGACATAAGGAAAGAGG - Intergenic
948589209 2:239038684-239038706 AAGAGGAGACACACGGAGAAGGG - Intergenic
948625701 2:239266669-239266691 ATGTGGAGACAGAGGGAGAGAGG - Intronic
948732569 2:239976402-239976424 CAGTTGAGGGAGAAGGAGGATGG - Intronic
948787747 2:240361764-240361786 CAGCAGAGACTGAAGGACAATGG + Intergenic
948833960 2:240615310-240615332 CAGGGGAAACAGACGGAGAAGGG - Intronic
1168920585 20:1532171-1532193 CCATGGAGAAACAAGGAGAATGG - Intergenic
1169817585 20:9674133-9674155 CAGCAGAAACAGAATGAGAATGG + Intronic
1170004951 20:11657269-11657291 CCAAGGAGACACAAGGAGAAAGG + Intergenic
1170039570 20:12025735-12025757 AGGTAGAGACAGAAAGAGAAAGG - Intergenic
1170330347 20:15202811-15202833 CAGTGTAGACAGAAAGAAAAAGG + Intronic
1170489852 20:16861938-16861960 CAGTGGACAGAGGAGGAAAATGG + Intergenic
1170588950 20:17756583-17756605 CAGTGGGGACAGAGGCAGATTGG + Intergenic
1170804152 20:19615464-19615486 CAATGGTGACGGAAGGTGAAGGG + Intronic
1170872066 20:20214877-20214899 CAGGGCAGGCAGAAGGAGAGTGG + Intronic
1170919853 20:20667748-20667770 AAGGGGAAACAGATGGAGAAAGG + Intronic
1171118881 20:22550941-22550963 CAGTGGGGAGGGAAGGTGAAGGG - Intergenic
1171847899 20:30288847-30288869 AGGTGGAGACAGAAGGAGTCAGG - Intergenic
1172022967 20:31927544-31927566 TAGTGGATACAGAGGTAGAAAGG + Intronic
1172038690 20:32028773-32028795 TAGTAGAGGAAGAAGGAGAAGGG + Intronic
1172206202 20:33164527-33164549 ATGTGGAGAGAGAAGAAGAAAGG - Intronic
1172221285 20:33276749-33276771 AAGGAGAGACAGAAAGAGAAGGG + Intronic
1172232854 20:33348608-33348630 CTGAGGAGCCAGAAGGAGCAGGG + Intergenic
1172442865 20:34978099-34978121 AAGTGGAGACAGAGGGGGAGGGG + Intronic
1173363692 20:42366550-42366572 CAGATGGGACAGAAGAAGAACGG - Intronic
1173602571 20:44306592-44306614 GAGGGGGGACAGAAGGACAATGG - Exonic
1173751816 20:45482348-45482370 GAGTGGGGAGAGAAGTAGAAGGG - Intergenic
1173939995 20:46902581-46902603 CAGGGCAGACAGATGGAGAAAGG - Intronic
1173997925 20:47353698-47353720 CTGAGGAGGCAGAAGGAAAAAGG + Intronic
1174142048 20:48422035-48422057 CAGTGGTGACAGAATGGAAAAGG + Intergenic
1174666825 20:52265810-52265832 CAGTGAAGAGAGACGGGGAACGG - Intergenic
1175050155 20:56147912-56147934 CAGTGGGGACGGAAGGGGGACGG - Intergenic
1175127961 20:56766541-56766563 CAGGGGAGAGAGAGAGAGAAAGG - Intergenic
1176258245 20:64165012-64165034 CAGAGGAGACATTAGGGGAAGGG + Intronic
1176587390 21:8601326-8601348 CATGGGAGACAGATGTAGAATGG + Intergenic
1176693774 21:9949312-9949334 CAGAGGAGGAAAAAGGAGAAAGG + Intergenic
1177548940 21:22596334-22596356 CTTTGGAGACACAAAGAGAATGG + Intergenic
1178226347 21:30723773-30723795 CACTGGGGACAGAGGCAGAATGG - Intergenic
1178793473 21:35721993-35722015 CAGTGTAGCCACAAGGAGAGAGG - Intronic
1178816423 21:35934137-35934159 GAGTGGAGAGAGTGGGAGAAAGG + Intronic
1179376771 21:40856445-40856467 AGGTGGAGAGAGGAGGAGAAAGG + Intergenic
1179470945 21:41609964-41609986 GAGTGGAGAGAGAAGAGGAATGG - Intergenic
1179812003 21:43877829-43877851 CAGTGGAGACAGAAGATAGAGGG - Intronic
1180270221 22:10578323-10578345 CATGGGAGACAGATGTAGAATGG + Intergenic
1180499999 22:15922412-15922434 CAGAGGACACAGAAGGAGGGAGG - Intergenic
1181781650 22:25198081-25198103 CAGCTGGGACAGAAGGAGGAAGG - Intergenic
1182059689 22:27388136-27388158 CATAAGAGAAAGAAGGAGAAAGG + Intergenic
1182550927 22:31100398-31100420 AAGGGAAGACAGATGGAGAAGGG - Intronic
1183068334 22:35379185-35379207 CACTGGAGAGAGAAAGAGACTGG + Intergenic
1183347867 22:37317946-37317968 CAGTGGGGCCAGTAGGAGACAGG + Intergenic
1183592092 22:38785288-38785310 CACTGATGACAGAAGGAAAAGGG + Intronic
1183623547 22:38988348-38988370 CAGTGAAGACAGTTGGAGAGGGG + Intronic
1183650492 22:39150879-39150901 CAGTGGAGACAGCATGGGAGAGG - Intronic
1184161181 22:42698280-42698302 CAATGGAGACAGAAGGCCAAAGG + Intronic
1184354145 22:43967336-43967358 CAGAGCAGACAGATGGAAAAGGG - Intronic
1184889956 22:47373606-47373628 GCGTGGAGCCAGGAGGAGAAGGG + Intergenic
1185105968 22:48870055-48870077 CAGGGCAGAGAGAAGGGGAATGG - Intergenic
1185249223 22:49791011-49791033 CAGTGCAGTCAGGAGGAGCAGGG - Intronic
949872032 3:8597021-8597043 CAGTGGAGGGAGAAGGGGCAAGG - Intergenic
949906734 3:8864220-8864242 CTGTGGAGAGAGAGGGGGAAGGG - Intronic
950005606 3:9689206-9689228 CAGTAGAGACAGCAGGAGCACGG - Intronic
950100562 3:10354048-10354070 CAGAGGGGACAGAATGAGCAGGG - Intronic
950209878 3:11115133-11115155 TATTGGAGACTGCAGGAGAAAGG - Intergenic
950276118 3:11662563-11662585 TAGTGGAGGCAGTGGGAGAAGGG - Intronic
950342861 3:12263016-12263038 CAGAGGAGAGAGAAGGACAAAGG + Intergenic
951363766 3:21755484-21755506 CAGTAGAGAGAGCAGGTGAAAGG - Intronic
951417271 3:22440132-22440154 CAGCTGGGACAGAAAGAGAATGG + Intergenic
951872835 3:27384333-27384355 CATTAGAGACAGCAGGAAAAAGG - Intronic
952539797 3:34356017-34356039 AAATGGAAACAGATGGAGAATGG + Intergenic
953139353 3:40213099-40213121 GAGTGGAGAAAGAATTAGAAGGG - Intronic
953274233 3:41479204-41479226 CAGGGGAGGAAAAAGGAGAAGGG - Intronic
953295349 3:41710339-41710361 CATTGGAGATTCAAGGAGAAAGG + Intronic
953862925 3:46560798-46560820 ATGATGAGACAGAAGGAGAACGG + Intronic
953925570 3:46980770-46980792 CTGTGGGTACAGAAGGAAAATGG - Intronic
954189092 3:48943480-48943502 CACCGGAGACAGACAGAGAATGG + Intronic
954407407 3:50353115-50353137 CAGTGGGGAGAGAAAGAAAAAGG + Intronic
954443113 3:50532570-50532592 CAGCTGAGCCAGGAGGAGAAAGG + Intergenic
955592823 3:60556298-60556320 CAGAGGAGACAGAAAGGTAAAGG + Intronic
956365126 3:68493176-68493198 TCATGGAGACAGAAGTAGAATGG - Intronic
956490383 3:69765095-69765117 CCGTGGAAACAGAAATAGAAAGG + Intronic
956863698 3:73349132-73349154 CAGTGAAGAAAGAAGTAGGATGG + Intergenic
956882862 3:73528818-73528840 GAGTGGAGGAAGAAGGGGAATGG + Intronic
957174336 3:76786417-76786439 CAGTGATGGCAGAAGGTGAAGGG + Intronic
957212075 3:77272348-77272370 CAGTCGTGGCAGAAGGTGAAGGG + Intronic
957350049 3:79012900-79012922 AAGTGGAGGGAGAAGGGGAAAGG + Intronic
957397210 3:79657468-79657490 AATTGGAGAAAAAAGGAGAAAGG + Intronic
957512061 3:81201781-81201803 CAGTGAAGAGAGAAGGGGCAGGG + Intergenic
957541265 3:81572177-81572199 CAGTCAAGGCAGAAGGTGAAGGG - Intronic
957847123 3:85752442-85752464 CATATGAGACATAAGGAGAAGGG - Intronic
958921507 3:100111195-100111217 CAATGGAGGCAGAAAGAGGATGG + Intronic
959307589 3:104689010-104689032 GAGTAGAGACAGCAGAAGAAAGG - Intergenic
959993661 3:112656841-112656863 GAGTGGAGAGGGAGGGAGAAAGG - Intergenic
960165924 3:114401155-114401177 GGGAGGAGACAGAAGGAGAAAGG + Intronic
960236030 3:115283189-115283211 TAGTGGATAGAGCAGGAGAAGGG - Intergenic
960597245 3:119417424-119417446 CAGTAGAGAGGAAAGGAGAAAGG - Exonic
961352935 3:126315553-126315575 CAGGGGGGACAGGAGGAGAGCGG + Intergenic
961546649 3:127639013-127639035 AAGGGGAGACAGATGGAGACAGG - Intronic
961893871 3:130151660-130151682 GAGTAGAGACACAAAGAGAAGGG + Intergenic
961994383 3:131226096-131226118 GAGTGGGGAAAGAGGGAGAATGG + Intronic
962345651 3:134617427-134617449 CAGGGGAGGTAGAAGGAGAGAGG + Intronic
962494434 3:135924900-135924922 CAGTTAAGGCAGGAGGAGAAAGG - Intergenic
962505246 3:136040113-136040135 CAAAGGAGAGAGAAGGAGATAGG + Intronic
962727768 3:138250123-138250145 AAGTGTAGACAGAAGAAAAAAGG + Intronic
962828912 3:139122741-139122763 ACATGGAGGCAGAAGGAGAATGG - Intronic
963339043 3:144012210-144012232 CAGAGGAGATAGAAGGGAAAAGG + Intronic
963508491 3:146217959-146217981 GAGAGGAGAGAGAAGGAGATGGG + Intronic
964024705 3:152058324-152058346 CAGTGGGAACAGAAGGGCAAGGG - Intergenic
964590533 3:158358789-158358811 AAACGGAGACAGAGGGAGAATGG - Intronic
966321604 3:178707078-178707100 AAGTGGAGACAGAAGGAGAAAGG + Intronic
967277141 3:187787222-187787244 AAGTGGAGACTGAAGGAAAATGG - Intergenic
967461812 3:189756715-189756737 GGGAGGAGACAGAAGGAAAAGGG - Intronic
967467134 3:189820570-189820592 CAGAAGGGACAAAAGGAGAAAGG + Intronic
967501043 3:190197735-190197757 AAGGGGAGAAAGAAGGGGAAAGG + Intergenic
967521227 3:190435281-190435303 ATGTAGAGACACAAGGAGAAGGG - Intronic
967870310 3:194224079-194224101 CAGTGGAGACAGGGGTTGAAGGG - Intergenic
968038196 3:195566580-195566602 CAGAGGGGAGAGAAAGAGAAAGG - Intergenic
968937688 4:3621034-3621056 CAGTGGAGAGAAAGGGAGAGGGG - Intergenic
968983278 4:3862496-3862518 CAGTGGGGGCAGAAAGAGGAGGG - Intergenic
969229701 4:5821450-5821472 CAGTGGAGTTAGAAGTGGAAGGG + Exonic
969233914 4:5851818-5851840 AGGAGGAGAAAGAAGGAGAAGGG + Intronic
969282721 4:6181938-6181960 CTGTGCAGACAGGAGGAGGAGGG + Intronic
969292339 4:6248044-6248066 CAGTGGGGAAAAAAGGCGAAGGG - Intergenic
969397205 4:6929889-6929911 CACTGGAGACAGACTCAGAAAGG + Intronic
969450645 4:7271147-7271169 CAGAGGAGATAGAAGCAGCAGGG - Intronic
969484844 4:7466555-7466577 CACTGCAGCCAGAGGGAGAATGG - Intronic
969965631 4:10992403-10992425 CAGTGGGGAATGAAGGAGGAAGG + Intergenic
970302514 4:14696407-14696429 CAGAGAAGACCAAAGGAGAAAGG + Intergenic
970430363 4:15983512-15983534 AAGAGGAGAGAGAAAGAGAAAGG + Intronic
970658722 4:18260709-18260731 CAGTAGAGAAAGCAGCAGAAAGG - Intergenic
971266329 4:25099153-25099175 AAGAGGAGAAAGAAGGAAAAGGG + Intergenic
971417809 4:26449602-26449624 CATTGGAGACAGAAGCAGGGAGG + Intergenic
971637408 4:29079270-29079292 CATTGGAGACAGAATGAGTATGG + Intergenic
972127619 4:35789218-35789240 CAGGGGAGAGAGGAGGGGAAGGG + Intergenic
972332741 4:38078990-38079012 CAGTAGAAACAGAAGCAGAAAGG + Intronic
972363023 4:38346281-38346303 CAATTGTGGCAGAAGGAGAAAGG - Intergenic
972631801 4:40848552-40848574 CAATGGGGACAGAGAGAGAAAGG - Intronic
972664324 4:41149477-41149499 GGGGGGAGAAAGAAGGAGAAGGG + Intronic
972765667 4:42151225-42151247 AAATGGAGGAAGAAGGAGAAAGG + Intronic
974028162 4:56752246-56752268 GAATGGAGACAAAAGGAGAATGG + Intergenic
974122986 4:57662589-57662611 CAGGAGAGGGAGAAGGAGAAGGG + Intergenic
974144374 4:57928487-57928509 CAGTGCAGGCAGAATGGGAATGG + Intergenic
974269731 4:59634416-59634438 AATTGGAGGCAGAAGGTGAAAGG + Intergenic
974660976 4:64888452-64888474 CACTGGAGAGAGAACCAGAAGGG - Intergenic
974858897 4:67495939-67495961 CAGCAGAGATTGAAGGAGAAGGG - Intronic
975283680 4:72592734-72592756 AAGTAGAGAAATAAGGAGAAGGG - Intergenic
975615045 4:76237716-76237738 CAGTCATGACAGAAGGTGAAGGG + Intronic
976326133 4:83773772-83773794 CAGTGGAGTGACAAGGGGAAAGG - Intergenic
976607910 4:86999831-86999853 CAGTGATGGCAGAAGGAGACTGG + Intronic
976727576 4:88229657-88229679 AAGTGGGGAGAAAAGGAGAATGG - Intronic
976826976 4:89271756-89271778 CAGTAGAGAAAGAAAGACAAGGG + Intronic
976960024 4:90958882-90958904 AAGTAGAGACAGAAGAAGGATGG - Intronic
977459610 4:97308951-97308973 CAGGGGAGAGAGAAGGGGAAGGG - Intronic
977545352 4:98370476-98370498 GACTGGAGAAAAAAGGAGAAAGG - Intronic
977635590 4:99294064-99294086 CAGTGGAGGTAGCAGGAGAGTGG - Intergenic
977872753 4:102112650-102112672 CAGGGGAGAAGGAAGGATAAAGG + Intergenic
978031319 4:103942332-103942354 CAGTAGAGACATGAAGAGAAGGG - Intergenic
978059242 4:104316015-104316037 CTGTGGAGACAAAAGCAGAATGG + Intergenic
978150810 4:105432587-105432609 CAGTAGAGGCAGAAGGGGATAGG + Intronic
978410782 4:108423317-108423339 CAATCGTGACAGAAGGTGAAGGG + Intergenic
978462314 4:108969738-108969760 CAGTGGAGAGGTAAGCAGAACGG - Intronic
978695486 4:111571932-111571954 CAGTGGTAACAGAAAAAGAATGG + Intergenic
978738594 4:112112495-112112517 AAATGGAGAAAAAAGGAGAAGGG + Intergenic
979280944 4:118866787-118866809 CAGTCGTGGCTGAAGGAGAAGGG - Intronic
979362111 4:119776914-119776936 CAGTCATGACAGAAGGTGAAGGG + Intergenic
979673064 4:123381852-123381874 CAGTCATGACAGAAGGTGAAGGG - Intergenic
979961706 4:127028124-127028146 CAGTAGTGACAGGAGGGGAAAGG + Intergenic
979977649 4:127216938-127216960 CATAGGAGACAGAAAGAAAATGG - Intergenic
980337513 4:131495529-131495551 CAATTGTGACAGAAGGTGAAGGG + Intergenic
980732283 4:136838379-136838401 CAATCAAGGCAGAAGGAGAAGGG - Intergenic
980841715 4:138269444-138269466 CATTGAAAACAAAAGGAGAATGG + Intergenic
981076305 4:140595690-140595712 CCTTGGAGACTCAAGGAGAAGGG - Intergenic
981107966 4:140902968-140902990 CAGTGGTGCTAGAAGGAGAAAGG + Intronic
981353908 4:143765169-143765191 CAATGGTGGCAGAAGGGGAAAGG + Intergenic
981491915 4:145348679-145348701 CAGAGCCCACAGAAGGAGAATGG - Intergenic
981650454 4:147051538-147051560 CAGAGGAGACAGAACCAGAGAGG + Intergenic
981863579 4:149386252-149386274 CAGTGGAGAGAGAAGAATGAGGG + Intergenic
982064861 4:151645208-151645230 CCATGGAGACAGTAGGAGGAGGG + Intronic
982096317 4:151926673-151926695 CAATGCAGACAGAAAGAGCAGGG - Intergenic
982149367 4:152435493-152435515 CAGTGTAGAAAGATTGAGAAAGG - Intronic
982340005 4:154286657-154286679 CAGAGGAGACAAAAGAAAAAAGG + Intronic
983706446 4:170666070-170666092 CAGTTGCCACAGTAGGAGAATGG + Intergenic
984703495 4:182833193-182833215 GAGGGGAGAGAGAAGGAGGAGGG - Intergenic
984744744 4:183203482-183203504 GAGTGGATACAGAAGGACTATGG - Intronic
984955186 4:185037889-185037911 CCATGGAGACAGGAAGAGAATGG - Intergenic
985522906 5:387225-387247 CAGAGGAGAGAGCAGGAGACAGG - Intronic
985619245 5:945191-945213 CAGAGGAGGCAGGAGGAGCATGG - Intergenic
985842265 5:2317000-2317022 CAGTGGAGTCACAAAAAGAAAGG - Intergenic
985857147 5:2437709-2437731 CAGCAAAGACAGAAGGAGAAGGG + Intergenic
985985596 5:3513461-3513483 CGGGAGAGGCAGAAGGAGAAGGG + Intergenic
986039085 5:3969476-3969498 CAGGGGAGACAGTAGGAGGCAGG + Intergenic
986181638 5:5398555-5398577 AACTGGAGACAGATGGATAAAGG - Intergenic
986353882 5:6905464-6905486 CACTGGAGACAGGTGGAGAATGG - Intergenic
986790251 5:11152718-11152740 CAGTGGAGTGAGGAGGAGTAAGG - Intronic
987062409 5:14254930-14254952 CAGTTGAGACATAAATAGAAAGG + Intronic
987341387 5:16942560-16942582 CTTTGGAGGGAGAAGGAGAAGGG - Intergenic
987397988 5:17443576-17443598 CAGGGGAGACAGAAGGGAGATGG - Intergenic
987466162 5:18274754-18274776 CACTGGGGACAGAAGCTGAATGG + Intergenic
989503841 5:42202566-42202588 CAGTGAAGATAGAAGGTGAAAGG + Intergenic
989657550 5:43760681-43760703 CAGAGGAGACAAAAGAAAAAAGG - Intergenic
989698139 5:44228440-44228462 GAGTGGAGACAGTTGGAAAAGGG + Intergenic
989745205 5:44820822-44820844 CCCTGGATACAGGAGGAGAAAGG + Intergenic
990716206 5:58639957-58639979 CTGTGGATAAAGAAAGAGAATGG - Intronic
990849660 5:60188460-60188482 AGGAGGAGACAGATGGAGAAAGG - Intronic
990987009 5:61649890-61649912 CAGATGACACAGAAGGAGAGGGG - Intronic
991389396 5:66125993-66126015 AAGAGGAGACAGCTGGAGAAGGG + Intergenic
991414559 5:66379141-66379163 CATTGTAGGCAGAAGGAGAGGGG + Intergenic
991503691 5:67302961-67302983 CACTGGACAGAGAGGGAGAAGGG + Intergenic
991971697 5:72147684-72147706 CAGTACAGACAGAAGGTGAGTGG + Intronic
992037558 5:72795445-72795467 CAATGGAATCTGAAGGAGAAGGG - Intergenic
992162973 5:74020460-74020482 CAGTGGTGACAGAAAGAAAATGG + Intergenic
992843085 5:80715682-80715704 CAGTCGTGGCAGAAGGTGAAGGG + Intronic
993857348 5:93092951-93092973 CTGTGGAGACAGATAGAAAAGGG - Intergenic
994936598 5:106260772-106260794 AAGAGGAGACAGAAGAAGAAAGG - Intergenic
995138622 5:108707357-108707379 CAGTGAGGACAGAACAAGAAGGG - Intergenic
995523071 5:113029125-113029147 AAGTGGTGACAGAAAGAGGAAGG + Intronic
995749563 5:115440063-115440085 TAGTAGAGTCAGAGGGAGAAGGG - Intergenic
996215898 5:120865124-120865146 CTGTGAATACAGAAAGAGAATGG - Intergenic
996387512 5:122925017-122925039 ATGTGGGGAGAGAAGGAGAAGGG - Intronic
996578353 5:125001170-125001192 CAGAGGAGACGGGAGGAGAGGGG - Intergenic
996646713 5:125826395-125826417 AAGTGGATCCAGAAGGAGAATGG - Intergenic
997022239 5:130015168-130015190 CAGGAGAGACAGAAAGTGAAGGG - Intronic
997400349 5:133597190-133597212 CCATGGAGGCAGAAGGACAATGG + Intronic
997444893 5:133933751-133933773 AAGTGGATAGAGAAGGAGGAGGG - Intergenic
998667807 5:144318114-144318136 TTGAGGAGACTGAAGGAGAAGGG + Intronic
998723163 5:144976784-144976806 CAGAGTAGACAGCAGCAGAATGG - Intergenic
999066142 5:148687486-148687508 CAGCTGAGAGAGAAGGTGAATGG - Intergenic
999068544 5:148717497-148717519 CAGGAGAGGCAGAAGGTGAAGGG - Intergenic
999197688 5:149793609-149793631 CACTGGGGTCTGAAGGAGAATGG - Intronic
999658386 5:153832996-153833018 TAGTGGAGCCAGATGGTGAAAGG + Intergenic
999906407 5:156145283-156145305 CAATCATGACAGAAGGAGAAGGG - Intronic
1000128847 5:158275080-158275102 CAGTTGACAGATAAGGAGAATGG + Intergenic
1000801349 5:165730383-165730405 CTGAGGAGACAGAAGAGGAAGGG - Intergenic
1001043804 5:168355875-168355897 AAGTGGGGAGAGAAGGAGAGAGG + Intronic
1001141351 5:169146584-169146606 CAGTGGAGGCAGGAGGAGCCGGG - Intronic
1001270768 5:170309911-170309933 CAGTGGAGACACCAAAAGAAGGG + Intergenic
1001519983 5:172384542-172384564 CCCTAGAGACAGAAGTAGAATGG - Intronic
1001528273 5:172444658-172444680 CAGTGGAGATGGAGGGAGAGAGG - Intronic
1002463497 5:179389038-179389060 CATTGAAGGCAGAAGGACAAGGG - Intergenic
1002839484 6:893749-893771 CTGTGGGGACAGAGGAAGAAAGG - Intergenic
1002947627 6:1778404-1778426 CAGTGGAGACAGCAGACGAGTGG + Intronic
1003400300 6:5785150-5785172 CAGAGGATACAGCAGGAGAAGGG + Intergenic
1003491943 6:6630438-6630460 CAGAGGAGACAGAAGGACCAAGG - Intronic
1003674244 6:8188453-8188475 CAGAGGAGTGGGAAGGAGAATGG + Intergenic
1003754544 6:9102030-9102052 CACTCGAGGCAGAAGGGGAAGGG + Intergenic
1003921993 6:10841087-10841109 GAGTGGAGAAAGAAAGAGTAGGG + Intronic
1004082068 6:12404522-12404544 CAGACAAGACAGAAGGAGAGAGG - Intergenic
1004104180 6:12649574-12649596 CAGAGGAGAAAGAAAGAGACAGG - Intergenic
1004233243 6:13851487-13851509 CTGAGGAGGCAGAAGGACAAAGG - Intergenic
1004679009 6:17874223-17874245 CTGCAGAGACAGAAGGGGAAAGG - Intronic
1004764736 6:18713464-18713486 GAGGGGAGACACGAGGAGAAAGG + Intergenic
1004991022 6:21138898-21138920 AAGGGCACACAGAAGGAGAAAGG - Intronic
1005128993 6:22481719-22481741 AACAAGAGACAGAAGGAGAAAGG + Intergenic
1005205378 6:23397119-23397141 CATTGGAGACAAAATGAGGAGGG - Intergenic
1005527683 6:26667270-26667292 CAGTCAAGAAAGAAGGAAAATGG - Intergenic
1005543111 6:26834408-26834430 CAGTCAAGAAAGAAGGAAAATGG + Intergenic
1005709871 6:28493354-28493376 CAGTGGAGACACAAGTAGAAAGG - Intergenic
1006081937 6:31572839-31572861 CAGGTGAGGCAGCAGGAGAATGG + Exonic
1006895897 6:37470647-37470669 CAGTGAAGACTAAAGTAGAAAGG + Intronic
1007118459 6:39361248-39361270 GAGTAGAGACACAAGAAGAATGG + Intronic
1007207785 6:40166566-40166588 CAGTAGAGAGATAGGGAGAATGG + Intergenic
1007216960 6:40247871-40247893 CAGGTGAGACAGCAGGAGCAAGG - Intergenic
1007899831 6:45400239-45400261 GAGGGGAGACAGAGGGAGGAAGG + Intronic
1008523568 6:52385241-52385263 CAGTAGAGAGAGAATGAGAGGGG - Intronic
1008728068 6:54445215-54445237 CCTTAGAGACAGAAGGATAAGGG - Intergenic
1009013929 6:57876578-57876600 CAGTCAAGAAAGAAGGAAAATGG + Intergenic
1009714916 6:67378945-67378967 AAGGGGAAACAGAAGGAAAAGGG - Intergenic
1009798969 6:68508681-68508703 CAGTGGAGACTCAGGGGGAAGGG - Intergenic
1010451659 6:76010835-76010857 CAGTAGAGACAGATGAAAAAAGG - Intronic
1010535113 6:77017227-77017249 CAGAGGAAACAGCAAGAGAAGGG + Intergenic
1010974406 6:82296238-82296260 CAGGAGAGAGAGAAAGAGAAGGG - Intergenic
1011082542 6:83505535-83505557 AAGTTGAGACAAAAGGGGAAGGG + Intergenic
1011121476 6:83958479-83958501 CAGTCAAGAGAGATGGAGAAGGG + Intronic
1011207604 6:84916894-84916916 CAGCGGAGTCAGAAGGTGAAAGG + Intergenic
1011344365 6:86352801-86352823 CAGTGGGGCCAAATGGAGAATGG - Intergenic
1011419488 6:87156060-87156082 GATTGGAGAGAGTAGGAGAATGG + Intronic
1011698315 6:89932896-89932918 CAGTAGAGAAAAAAAGAGAAGGG + Intronic
1011791797 6:90906966-90906988 CTGTGGAAAGAGAAAGAGAAAGG - Intergenic
1011967722 6:93180214-93180236 CAGCTGAAAGAGAAGGAGAAAGG - Intergenic
1012103299 6:95119981-95120003 CAGAGGAGACAGAAGGCATATGG - Intergenic
1012278572 6:97302046-97302068 GAGAGGAGACACAAAGAGAAAGG - Intergenic
1012460894 6:99458785-99458807 CAGAGGCTACAGGAGGAGAATGG + Intronic
1013236825 6:108204221-108204243 CAGGAGAGACAGAAAGAGATTGG - Intergenic
1014106605 6:117571446-117571468 TAGTAGAGACAGAAAGAGTAAGG - Intronic
1014348427 6:120307124-120307146 CAGTGAAGACATACAGAGAATGG - Intergenic
1014677234 6:124382265-124382287 GAGAGGAGAAAAAAGGAGAAAGG + Intronic
1015195266 6:130518615-130518637 CAGTGTAGCCAGGAGCAGAAAGG - Intergenic
1015223774 6:130833276-130833298 GAGTGGAGAGAGAACTAGAATGG - Intronic
1015491080 6:133826126-133826148 CAATTAAGACAGAAAGAGAAGGG - Intergenic
1015688561 6:135894558-135894580 AAATGGAGACAAAAGGAGAGAGG + Intronic
1015801618 6:137066192-137066214 CAGTAGAGACAGGGAGAGAAGGG + Intergenic
1015901465 6:138072405-138072427 TTGTGGAGACAGAGGGAAAATGG + Intergenic
1016220189 6:141659129-141659151 CATTTGAGACAGAAAGAAAAAGG + Intergenic
1016470970 6:144374315-144374337 CAGTAGAGACAAAAAGAGCATGG + Intronic
1016807394 6:148225556-148225578 CTTTGGAGACTGAAGGGGAAAGG + Intergenic
1017272747 6:152528113-152528135 GAGAGGAGAAAGAAAGAGAAAGG - Intronic
1017502415 6:155037850-155037872 CAGTGGACACAGAAGAAGTAAGG - Intronic
1017567364 6:155701722-155701744 GGGTGGAGAAAGGAGGAGAATGG + Intergenic
1017687152 6:156924978-156925000 CAGTGGGCTCAGAATGAGAAAGG - Intronic
1017890741 6:158636785-158636807 AACTAGAGACAAAAGGAGAAAGG + Exonic
1018419564 6:163630353-163630375 CAGTGGGCACTGAAGGAGAAAGG + Intergenic
1018454735 6:163941642-163941664 TCCTGGAGACAGAAGGAGGAGGG + Intergenic
1018549666 6:164981303-164981325 CAGAGCAGAGAGAAGGGGAAAGG + Intergenic
1018923958 6:168193979-168194001 CCGTGGGGACTGAAGGAAAATGG - Intergenic
1019546586 7:1580238-1580260 CATGGGAGACAGAAGGAGACAGG - Intergenic
1020011352 7:4807534-4807556 GAGGGGAGACAGAGGGAGAGAGG - Intronic
1020169495 7:5833969-5833991 CAGTGAAAACAGGAAGAGAATGG + Intergenic
1020550864 7:9602798-9602820 CTGTGGTGGCAGAAGGTGAAAGG - Intergenic
1021089138 7:16461404-16461426 GAGAGGAGACAGAGGGAGACAGG - Intergenic
1021096207 7:16538844-16538866 CAGTCATGACAGAAGGTGAAGGG - Intronic
1021396769 7:20159005-20159027 AAGTAAAGACAGAAGGAGAAAGG - Exonic
1021562511 7:21982525-21982547 CAGTGGAAACAGAAAGAGATTGG - Intergenic
1021626346 7:22596523-22596545 AAATAGAGACAGAAGTAGAAGGG - Intronic
1021802843 7:24325174-24325196 CCCTGGAGTCAGAAGGAGAGAGG - Intergenic
1021957752 7:25843177-25843199 CTGTGGAGACTGAAGATGAACGG - Intergenic
1022095337 7:27137246-27137268 CAGGGGAAAGAGCAGGAGAAAGG + Intronic
1022232116 7:28424066-28424088 CAGAGAAGACAGAAGAAGGAGGG - Intronic
1022495320 7:30849621-30849643 CAGCGGAGGCAGAGGAAGAAGGG - Intronic
1023139943 7:37091817-37091839 CAGGCAAGACAGAATGAGAACGG + Intronic
1023724797 7:43131878-43131900 AGGAGGAGACAGAAGGACAAAGG - Intronic
1023737625 7:43248766-43248788 GAGGGGAAACAGGAGGAGAACGG - Intronic
1024213329 7:47226130-47226152 TAGTGTAGAGAAAAGGAGAAGGG + Intergenic
1024254494 7:47530420-47530442 TAATGGAGACTGACGGAGAAGGG + Intronic
1024295989 7:47842721-47842743 CAGTGGAGACAGAAGGAGAAGGG + Intronic
1024991784 7:55240435-55240457 AAGAAGAGGCAGAAGGAGAAAGG - Intronic
1025199856 7:56955474-56955496 CTGGGGAGGCAGAAGGAGAGGGG + Intergenic
1025201910 7:56967395-56967417 CAGAGGAGACAGGAGCAGAGGGG - Intergenic
1025670036 7:63609533-63609555 CAGAGGAGACAGGAGCAGAGGGG + Intergenic
1025672090 7:63621458-63621480 CTGGGGAGGCAGAAGGAGAGGGG - Intergenic
1025854850 7:65267918-65267940 CATTGGTGACAAAAGGAAAAAGG + Intergenic
1026070291 7:67112796-67112818 CAGGGGAGCCAGATGCAGAACGG + Intronic
1026706619 7:72699473-72699495 CAGGGGAGCCAGATGCAGAACGG - Intronic
1027400001 7:77797771-77797793 CAGTGGCGAGAGAAGGGAAATGG - Intronic
1027941781 7:84691479-84691501 GAGTGGAGAAGGAGGGAGAATGG - Intergenic
1028006488 7:85575952-85575974 ATGTTGAGAGAGAAGGAGAAAGG + Intergenic
1028737807 7:94237166-94237188 GAGTTGACACAGCAGGAGAAGGG + Intergenic
1029368611 7:100132906-100132928 CAGAGGAGATAGGAGGGGAAAGG - Intergenic
1029403395 7:100358779-100358801 CAGGGGTAATAGAAGGAGAAGGG - Exonic
1029405973 7:100374133-100374155 CAGGGGTAATAGAAGGAGAAGGG - Exonic
1029478356 7:100798618-100798640 TAGGGGAGACAGAAGGAGCAGGG + Intergenic
1029940757 7:104478422-104478444 CGGTGGAGAGAAGAGGAGAAAGG - Intronic
1030002726 7:105082619-105082641 CAGGGGTGACAGAGGGAGAAGGG + Intronic
1030238726 7:107295555-107295577 CAGTGGAGAGAAAAAGAGATGGG - Intronic
1030797819 7:113810538-113810560 TAATGGAGACAGAATGAGCAGGG + Intergenic
1030960066 7:115907961-115907983 CACAGGAGAATGAAGGAGAAAGG + Intergenic
1031020287 7:116620451-116620473 AAGTGGAGACTGAAGAAGGAAGG + Intergenic
1031452136 7:121935394-121935416 CAGCTCAGACAGAAGAAGAAGGG - Intronic
1031738652 7:125399518-125399540 CACTGGAGAGAAAAGAAGAAGGG - Intergenic
1032191608 7:129769135-129769157 CTCTTGAGACAGAAAGAGAAGGG - Intergenic
1032840111 7:135706600-135706622 CCGTGGAGACAGAAAAACAATGG - Intronic
1033130281 7:138740124-138740146 GAGAGGGGACAGAAGGGGAAAGG + Intronic
1033166303 7:139041369-139041391 CAGTGAACACTGAAGGAAAAGGG + Intergenic
1033586910 7:142780807-142780829 AAGCGGAGACAGGAGGAGGATGG - Intergenic
1033790784 7:144790526-144790548 CAATCGTGGCAGAAGGAGAAGGG + Intronic
1033801715 7:144909406-144909428 CTCTGGAGCCTGAAGGAGAAAGG - Intergenic
1034231127 7:149529368-149529390 CAGAGGAGACAAAAGGAAAGAGG + Intergenic
1034263825 7:149772306-149772328 CTGGGGAGACAGAGGGGGAAGGG - Intronic
1034281818 7:149859847-149859869 CACTGGAGAAGGAGGGAGAAGGG - Intronic
1034316060 7:150134381-150134403 CAGTGGTGAAAGAGAGAGAAGGG - Intergenic
1034700933 7:153095128-153095150 CAGTCACGGCAGAAGGAGAAAGG + Intergenic
1034790828 7:153966400-153966422 CAGTGGTGAAAGAGAGAGAAGGG + Intronic
1035117130 7:156533839-156533861 CAGTGAAGGCAGAAGGAAGAGGG + Intergenic
1035237678 7:157509233-157509255 GAGGGGGGAGAGAAGGAGAAGGG + Intergenic
1036012166 8:4738393-4738415 AAATGGTGGCAGAAGGAGAAGGG + Intronic
1036499298 8:9298522-9298544 CAGAAGAGACAGAAAGTGAAGGG - Intergenic
1036966224 8:13301097-13301119 CTGTGGATACAGGAGGATAATGG + Intronic
1037693887 8:21207246-21207268 AAGAGGAGAAAGGAGGAGAATGG - Intergenic
1038327219 8:26580165-26580187 CTGTGGAGGCAGGAGGTGAAGGG + Intronic
1038544354 8:28413627-28413649 AAGAAGAGAGAGAAGGAGAAAGG - Intronic
1038659675 8:29486330-29486352 GAGTGGAGAAGGATGGAGAATGG + Intergenic
1038941085 8:32306710-32306732 TAATGGAGAAAGGAGGAGAAAGG + Intronic
1039391948 8:37188466-37188488 CATTGGAGAATGAAGGAGAGGGG + Intergenic
1039408329 8:37331374-37331396 CGGGGGAGACTGAAGGAGGAGGG + Intergenic
1040813859 8:51485610-51485632 CAGAGGAAACATTAGGAGAAAGG - Intronic
1041305054 8:56449019-56449041 CAGGGGAGAGAGAAACAGAAAGG + Intergenic
1041850957 8:62391923-62391945 CAGTTGAGACAGAATGAGCCAGG - Intronic
1042263339 8:66883052-66883074 CAGCCCAGAAAGAAGGAGAATGG + Intronic
1042420662 8:68584881-68584903 CTGTGGAGCCAGAGGGAGAAGGG - Intronic
1042648262 8:71011149-71011171 CAGACGAGAGAGAAGGAGAGGGG - Intergenic
1042857962 8:73286165-73286187 CAGTGGTGACACAAGGTGAGGGG + Intergenic
1043240566 8:77928870-77928892 CAATCATGACAGAAGGAGAAGGG + Intergenic
1043466198 8:80509730-80509752 CAGTGGAAAAAGAATGAGATGGG - Intronic
1043695076 8:83207894-83207916 CTGTGGAGTCAGAAGGAGCCAGG + Intergenic
1043978776 8:86614442-86614464 CAGTGGGGAGAGAGAGAGAATGG - Intronic
1044189454 8:89297611-89297633 CAGTGGTGGCAGAAGGCAAAGGG + Intergenic
1044265778 8:90179559-90179581 CAATGGATACAGTAGGAAAATGG - Intergenic
1044295287 8:90519806-90519828 CAGGAGAGACAGAGGGTGAAGGG - Intergenic
1044893925 8:96867873-96867895 CAGTGAAGACAAAGGGTGAAAGG - Intronic
1044938020 8:97311820-97311842 CAGTGTCTGCAGAAGGAGAAAGG - Intergenic
1045622377 8:103995461-103995483 CAGTGGAGACAGAGGGAGAATGG + Intronic
1046504090 8:115114901-115114923 AAGAAGAGAAAGAAGGAGAATGG - Intergenic
1046586213 8:116151170-116151192 CACTGGAGAAAGAAGTAGACTGG + Intergenic
1047346873 8:124037475-124037497 CAGTGGGGACAGAGGGACAGTGG + Intronic
1047544464 8:125802480-125802502 AGGGGGAGAGAGAAGGAGAAGGG + Intergenic
1047767772 8:128003306-128003328 CAGAGGAGACAGAAGGGGAGGGG - Intergenic
1048427550 8:134336820-134336842 CTGGGGAGACACAAGGAGCAAGG - Intergenic
1048773287 8:137918841-137918863 CAGGAGAGAGAGAAGGAGAAGGG - Intergenic
1048838900 8:138547461-138547483 GAGAGGAGACAGAGGGAGACAGG - Intergenic
1049181680 8:141226189-141226211 CAGAGGGGAAAGATGGAGAAAGG - Intronic
1049302631 8:141879707-141879729 CAGGAGGGACAGGAGGAGAAGGG - Intergenic
1049543853 8:143220603-143220625 CAGAGGGGAGAGAAGGGGAAGGG - Intergenic
1049630513 8:143652657-143652679 CAGTGGGGACAGGAGGAGGCAGG + Exonic
1050064630 9:1746148-1746170 CAATTGTGGCAGAAGGAGAAAGG - Intergenic
1050105450 9:2161521-2161543 CAGTGGAGGAAGAAGAAAAAAGG - Intronic
1050175841 9:2868629-2868651 CAGAGGAGAGAGAAGGTCAAAGG - Intergenic
1050444283 9:5702412-5702434 CAGTCATGACAGAAGGAGAAGGG + Intronic
1050929736 9:11308165-11308187 CAGAGGAGGAAGAAGGAGAAAGG - Intergenic
1051047347 9:12890269-12890291 CAGAGGAGACAAAAGAAAAAAGG + Intergenic
1051136438 9:13927029-13927051 GAGAGGAGACAGGAGGAGGAGGG - Intergenic
1051680990 9:19607793-19607815 CATTGGAGAAAGAAAGAGAGAGG + Intronic
1052037701 9:23701634-23701656 AAGAGGGAACAGAAGGAGAAGGG + Intronic
1052125419 9:24768740-24768762 CACTCATGACAGAAGGAGAAAGG + Intergenic
1052127937 9:24801744-24801766 CAGTCGTGGCAGAAGGTGAAGGG - Intergenic
1052200784 9:25777036-25777058 CAGAGGAGACAGACTGAGAGAGG + Intergenic
1052294103 9:26878603-26878625 AAGTGGAGGAAGATGGAGAATGG - Intronic
1052364806 9:27600204-27600226 AAGTGGTGACAGAATTAGAAGGG - Intergenic
1053317495 9:37064325-37064347 CAGAGGGGAAAGGAGGAGAATGG - Intergenic
1053412143 9:37922812-37922834 CTGTGGATGCAGCAGGAGAAGGG - Intronic
1053630739 9:39935406-39935428 CAGAGGAGGAAAAAGGAGAAAGG + Intergenic
1053775027 9:41528099-41528121 CAGAGGAGGAAAAAGGAGAAAGG - Intergenic
1053786034 9:41653497-41653519 AGGTGGAGACAGAAGGAGTCAGG - Intergenic
1054159016 9:61660699-61660721 AGGTGGAGACAGAAGGAGTCAGG + Intronic
1054174750 9:61867430-61867452 AGGTGGAGACAGAAGGAGTCAGG - Intergenic
1054213148 9:62315292-62315314 CAGAGGAGGAAAAAGGAGAAAGG - Intergenic
1054453472 9:65416665-65416687 CAGTGGAGATAAAGGGAGAGGGG + Intergenic
1054478790 9:65591704-65591726 AGGTGGAGACAGAAGGAGTCAGG + Intergenic
1054662788 9:67713363-67713385 AGGTGGAGACAGAAGGAGTCAGG + Intergenic
1055486878 9:76764810-76764832 CAGTGGAGGGAGAAGGATCATGG - Intronic
1055778232 9:79790070-79790092 CTGTGGAAACAGTAGGAGAGGGG - Intergenic
1056065971 9:82935038-82935060 CACTGGGGCCAGAAGAAGAATGG + Intergenic
1056121735 9:83495049-83495071 AATTGGAAACAGTAGGAGAATGG - Intronic
1057026341 9:91736615-91736637 GAGTAGAGACAGCAGGAGGAGGG + Intronic
1057035660 9:91810171-91810193 CGGTGGCGACAGAATCAGAATGG + Intronic
1057081790 9:92178995-92179017 GAGTGGAGACAAAAGGAAGAAGG + Intergenic
1057270974 9:93651367-93651389 CAGTGGAAACAGGAGGCAAAGGG - Intronic
1057783058 9:98065655-98065677 CCCTGGAGACAGAATGATAACGG + Intronic
1058061968 9:100507014-100507036 CAGTGGGGAGAGAGGGAGAAAGG - Intronic
1058480231 9:105385553-105385575 CAGTGAAGACAGAGAGAGAGAGG - Intronic
1058538975 9:105992454-105992476 CAGTGGAAACAGATGTACAATGG - Intergenic
1058782704 9:108354244-108354266 CAGTCATGGCAGAAGGAGAAGGG - Intergenic
1058945736 9:109854233-109854255 AAGAGGAGACATAAGAAGAAGGG + Intronic
1059489107 9:114652537-114652559 CAGGGGATACAGTATGAGAATGG + Intergenic
1060389527 9:123267363-123267385 AGGTGGGGACAGTAGGAGAAGGG - Intronic
1060518323 9:124279605-124279627 AAGTGAAGTCAGAAAGAGAAAGG - Intronic
1060522149 9:124300057-124300079 CTGAGGACACAGAGGGAGAAGGG + Intronic
1060555781 9:124506620-124506642 GATTGGAGATAGAGGGAGAAGGG - Intronic
1060992687 9:127857803-127857825 CAGAGGAGGCAGGAGGAGGAGGG + Intergenic
1061185820 9:129052597-129052619 CAGCGGAGGTAGAAGGAGGAGGG + Intronic
1061558838 9:131389569-131389591 TAGTGGTGACAGTAGGGGAAGGG + Intergenic
1061634843 9:131901006-131901028 GAGGGGAGACACAAGGAGAGGGG + Intronic
1061736662 9:132665385-132665407 CAGAGGAGACAAAAGTATAAAGG + Intronic
1062322102 9:135995106-135995128 CTGTGGAGACAGACGGTGGAGGG - Intergenic
1203617349 Un_KI270749v1:79508-79530 CATGGGAGACAGATGTAGAATGG + Intergenic
1185688279 X:1948314-1948336 GAGGGGAGACAGGAGGAGGAGGG + Intergenic
1185688580 X:2133890-2133912 GAGGGGAGACAGGAGGAGGAGGG + Intergenic
1185836158 X:3347021-3347043 CAGGAGAGAGAGAAGGAGCAGGG + Intergenic
1185970962 X:4663109-4663131 GAGAGGGGACAGAACGAGAATGG + Intergenic
1186031930 X:5377639-5377661 GAGTGGAGGGAGAGGGAGAAAGG + Intergenic
1186208345 X:7223978-7224000 TAGTTGAAAGAGAAGGAGAAAGG + Intronic
1186230155 X:7445077-7445099 CTGTGGTGACAGAAGGGGAAGGG - Intergenic
1186424839 X:9455700-9455722 AAGTAGAAAGAGAAGGAGAAAGG - Intergenic
1186576818 X:10775444-10775466 CATTGGAGAGAGGAGGGGAAAGG + Intronic
1186621570 X:11246404-11246426 CACTGGGGACAGTGGGAGAAAGG + Intronic
1186953969 X:14659681-14659703 CCTGGGAGAAAGAAGGAGAAAGG + Intronic
1187144693 X:16626767-16626789 CAGAGGTCACAGAAGGGGAAGGG - Intronic
1187892783 X:23952817-23952839 CTGTGAAGACAAAAGGAGAGTGG - Intergenic
1188079231 X:25815553-25815575 CAGGGGAGAGAGAGGGGGAAGGG - Intergenic
1189307887 X:40000832-40000854 CAGTGGGGTAAGAAGGAGAGGGG + Intergenic
1189368125 X:40405626-40405648 CAGTGAATCCAGAAGGAAAAAGG - Intergenic
1189494139 X:41493900-41493922 GAGTGGAGGCAGAAGAAGATTGG + Intergenic
1190051332 X:47151726-47151748 CAGTTGAGACAGTAGGAAGAAGG + Intronic
1190472924 X:50800721-50800743 GACTGGAGCCAGATGGAGAATGG + Intronic
1190776702 X:53558421-53558443 AACTGGAGCCAGAAGCAGAATGG - Intronic
1190925122 X:54896269-54896291 CAGGGGAGAGGGAAAGAGAAAGG - Intergenic
1191026056 X:55914674-55914696 AAGTTGAGAAAGAAGGAGCATGG + Intergenic
1191715372 X:64190467-64190489 AAGAGGAGGAAGAAGGAGAATGG - Exonic
1191715580 X:64191607-64191629 CAATGGAGACAGAGGAAGAACGG - Exonic
1191792004 X:64981007-64981029 TAGTGGAGACATAAGGAGTTGGG + Intronic
1191940433 X:66474485-66474507 CAGAGGAGAGAGAAAGAGAGAGG + Intergenic
1192012119 X:67285684-67285706 CAGAGGAGACAAAAGGAAAAGGG - Intergenic
1192102929 X:68284391-68284413 CAGTGGTGGCAGAAGAAGAAAGG - Intronic
1192546670 X:72019961-72019983 CAGAGGAAGCAGATGGAGAAGGG - Intergenic
1192546996 X:72022511-72022533 AAGTGAGGACACAAGGAGAAGGG - Intergenic
1194014304 X:88600235-88600257 CAGGAGAGACAGAGAGAGAATGG + Intergenic
1194431396 X:93811289-93811311 AAGGGGAAATAGAAGGAGAAAGG - Intergenic
1194631286 X:96288204-96288226 AAGTGGTGACTGAAGTAGAATGG - Intergenic
1194711175 X:97238068-97238090 CAGAAGAGACAGCAGGGGAAGGG + Intronic
1194895455 X:99433941-99433963 CAGGGGAGACAGAACGAGTGTGG + Intergenic
1195175232 X:102308350-102308372 CAGCGTAGAAAGAAGCAGAAAGG - Intronic
1195183633 X:102378743-102378765 CAGCGTAGAAAGAAGCAGAAAGG + Intronic
1196000248 X:110775800-110775822 CAGAGAAGACAGAAAAAGAAAGG - Intronic
1196038683 X:111176320-111176342 CACTGGGGCCAGAAGGGGAATGG + Intronic
1196058017 X:111377096-111377118 AAGTGGAGGCAGGAGGAGGAGGG - Intronic
1196518669 X:116646070-116646092 GGGTGGAGACAGAAAAAGAAAGG - Intergenic
1196650046 X:118159286-118159308 AAGGGGAGAGAGAAAGAGAAAGG + Intergenic
1197134086 X:123040899-123040921 CAGTGGAGGAAGAAGTACAAGGG + Intergenic
1197567416 X:128104605-128104627 CAGAGGGGGCAGAAAGAGAAAGG - Intergenic
1197766602 X:130063394-130063416 GAGTGGTGGCAGAAGGAGCAGGG + Intergenic
1197790770 X:130251816-130251838 CAGAGGTGACAGAAGGAGCCAGG + Intronic
1198276532 X:135099212-135099234 CAGGGGAGACCGTGGGAGAAGGG - Intergenic
1198309966 X:135421540-135421562 CAGGGGAGACCGTGGGAGAAGGG + Intergenic
1199783169 X:151081943-151081965 CAGGACACACAGAAGGAGAATGG + Intergenic
1200173335 X:154095364-154095386 CAGTGGAGCCATTAGGACAATGG + Intronic
1200326434 X:155245176-155245198 CATTGGATACATAAGGAGGAGGG - Intergenic
1200852833 Y:7903518-7903540 AATTGGAGACAGGAAGAGAATGG + Intergenic
1201458098 Y:14193378-14193400 CATTGAACAAAGAAGGAGAAAGG + Intergenic
1201471155 Y:14336290-14336312 CAGAGGACAAAGGAGGAGAAAGG - Intergenic
1202117596 Y:21486279-21486301 AAGTTGGGACAGAAGGAGAGGGG - Intergenic
1202269858 Y:23061116-23061138 AATTGGAGACAGGAAGAGAATGG - Intergenic
1202371177 Y:24197080-24197102 CAATGGAAAGAGCAGGAGAAGGG - Intergenic
1202376150 Y:24239389-24239411 CAATGGAAAGAGCAGGAGAAGGG - Intergenic
1202422852 Y:24694862-24694884 AATTGGAGACAGGAAGAGAATGG - Intergenic
1202447937 Y:24975224-24975246 AATTGGAGACAGGAAGAGAATGG + Intergenic
1202494630 Y:25430729-25430751 CAATGGAAAGAGCAGGAGAAGGG + Intergenic
1202499607 Y:25473037-25473059 CAATGGAAAGAGCAGGAGAAGGG + Intergenic