ID: 1024298227

View in Genome Browser
Species Human (GRCh38)
Location 7:47863270-47863292
Sequence GAAACTGCACAGACCCAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 214}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024298227_1024298233 23 Left 1024298227 7:47863270-47863292 CCATGCTGGGTCTGTGCAGTTTC 0: 1
1: 0
2: 0
3: 24
4: 214
Right 1024298233 7:47863316-47863338 GTAGTTATACGTGCGTGTCTGGG 0: 1
1: 0
2: 0
3: 0
4: 28
1024298227_1024298234 24 Left 1024298227 7:47863270-47863292 CCATGCTGGGTCTGTGCAGTTTC 0: 1
1: 0
2: 0
3: 24
4: 214
Right 1024298234 7:47863317-47863339 TAGTTATACGTGCGTGTCTGGGG 0: 1
1: 0
2: 0
3: 1
4: 50
1024298227_1024298232 22 Left 1024298227 7:47863270-47863292 CCATGCTGGGTCTGTGCAGTTTC 0: 1
1: 0
2: 0
3: 24
4: 214
Right 1024298232 7:47863315-47863337 TGTAGTTATACGTGCGTGTCTGG 0: 1
1: 0
2: 0
3: 2
4: 22

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024298227 Original CRISPR GAAACTGCACAGACCCAGCA TGG (reversed) Intronic
900559981 1:3299592-3299614 GAAACATCACAGCCACAGCACGG - Intronic
900560020 1:3299897-3299919 GAAACATCACAGCCACAGCACGG - Intronic
900606937 1:3527929-3527951 GAAAATGCACAGGCCCAGGTCGG + Intronic
901175071 1:7293060-7293082 GAAGCTCCAGTGACCCAGCAGGG - Intronic
901678852 1:10901763-10901785 GACACCTCACAGACCCGGCAGGG - Intergenic
903840241 1:26233893-26233915 CAACCTGCACAGGCCCAGCAGGG + Intergenic
904093096 1:27958807-27958829 GAGCGTGCACAGGCCCAGCAGGG - Exonic
905550070 1:38830463-38830485 GAATCTGGACAGACCTTGCAGGG + Intergenic
907346164 1:53782566-53782588 GAAACTGTACAGAAGCAGCAAGG + Intronic
907733664 1:57091130-57091152 GACACAGCAGACACCCAGCATGG - Intronic
909085691 1:71167702-71167724 GAAGCTGCACAGATCCTGCTTGG + Intergenic
909626186 1:77718718-77718740 GAAAATGCAGAGATCCAGCCTGG + Intronic
910803819 1:91170839-91170861 GAAAGCCCACAGACCCAGGAAGG - Intergenic
914851659 1:151318885-151318907 GAAACGGCACAGCTTCAGCAGGG - Intronic
915228620 1:154429413-154429435 GCAAGTGCACAGTCCCAGCTGGG - Exonic
915533875 1:156522198-156522220 ATAAGTGCACATACCCAGCAAGG - Intergenic
916832227 1:168504779-168504801 AAAACTCTACAGAGCCAGCATGG - Intergenic
917661811 1:177184245-177184267 TAAACTGAACAGAGTCAGCAGGG + Intronic
917921487 1:179754504-179754526 ATAACTGCCCAGACCAAGCAGGG + Intronic
919557866 1:199083310-199083332 GGAACTGCACAGCCACAGCATGG - Intergenic
919801148 1:201355280-201355302 GAGCCAGCCCAGACCCAGCATGG + Intergenic
920442212 1:205988879-205988901 TACTCTGCACAGACCTAGCAAGG - Intronic
921267126 1:213430252-213430274 GAAACTGCCCATTTCCAGCATGG + Intergenic
921934759 1:220786499-220786521 GACACTGCACAGGCCAGGCAGGG + Intergenic
923165524 1:231357539-231357561 GACACTGCACGCACCCAGAAAGG - Intergenic
923502448 1:234577286-234577308 AAGACTGCACAGACCCAGGAAGG - Intergenic
1063880531 10:10527153-10527175 GCCACTGCACAGAGCCAGCATGG - Intergenic
1065812106 10:29451761-29451783 GGAACTGCAAAGATCCAGCAGGG - Intergenic
1065959678 10:30724400-30724422 GGAACTGCAAAGATCCGGCAGGG + Intergenic
1070732209 10:78838313-78838335 GCCACTGCCCAGAGCCAGCAGGG + Intergenic
1071399513 10:85255888-85255910 GACACTTCACACACCCATCATGG + Intergenic
1072023743 10:91432327-91432349 GAAACTGCAAAAACCCAGCGTGG + Intronic
1072627496 10:97122489-97122511 GAAACACCACTTACCCAGCAAGG - Intronic
1073564294 10:104522020-104522042 GAAACAGAACAGAGCCAGCTAGG - Intergenic
1073822048 10:107275122-107275144 CAAAATGCACAAACCAAGCAAGG + Intergenic
1073890535 10:108096340-108096362 GGAACTGCAGAGACCCAGGGAGG + Intergenic
1075139353 10:119817980-119818002 GGAAATGCGCAGTCCCAGCAGGG + Intronic
1077918442 11:6625868-6625890 GAAACTGGACAGGCCCAAGATGG + Intronic
1078745184 11:14106867-14106889 GAATATGCACAGACTCAGGAAGG - Intronic
1082280776 11:50268808-50268830 TAAACTGCATAAACCCAGAAAGG - Intergenic
1084395903 11:68909920-68909942 AAAAGTGCACAGACCGGGCACGG - Intronic
1089640396 11:119843993-119844015 GAAGCAGCACACACCAAGCAGGG + Intergenic
1089830045 11:121319401-121319423 GAAACTGCTCAGCCTCAGCCAGG - Intergenic
1091596509 12:1882453-1882475 GAAAATGCAGGGACCCAGGAAGG + Intronic
1091874940 12:3925863-3925885 CAGACTGCACAGACCCATTAGGG - Intergenic
1092090710 12:5801653-5801675 GAAACTACACAGGCCCTGAAAGG + Intronic
1092567094 12:9678016-9678038 GGAAATGCACAGATCCAGCAGGG - Intronic
1093437795 12:19156752-19156774 AAAACTGTACAGGTCCAGCACGG + Intronic
1093947367 12:25124980-25125002 GAAAATGTACATACCCACCATGG - Intronic
1094284064 12:28772629-28772651 CAAACTGCCATGACCCAGCACGG - Intergenic
1094800838 12:34033295-34033317 GAAACTGCAGAGAGCAAACATGG - Intergenic
1095113620 12:38327699-38327721 GAAACTGCAGAGAGCAAACATGG - Exonic
1097305884 12:58068409-58068431 GAAACTCTACAGAGCCTGCAGGG + Intergenic
1100426530 12:94492528-94492550 GAAAATGGACAAGCCCAGCATGG + Intergenic
1100597204 12:96081971-96081993 AAGACTGGACAGACCCACCAAGG - Intergenic
1102614551 12:114142045-114142067 CACAATGCTCAGACCCAGCATGG - Intergenic
1104653088 12:130551676-130551698 GAAAATGCACAGATAGAGCAAGG + Intronic
1106134164 13:26961908-26961930 GAAGGTGCACAGAGGCAGCATGG - Intergenic
1106246536 13:27954533-27954555 GCAGCGGCGCAGACCCAGCAAGG + Intergenic
1107331867 13:39310061-39310083 ATAACTTCACAGTCCCAGCAGGG - Intergenic
1107765590 13:43730774-43730796 GAAGCTGCACAGACATTGCAGGG - Intronic
1110324467 13:74198323-74198345 GAAACTGCAGAATCCCAGAATGG + Intergenic
1111464805 13:88594878-88594900 GAGTGTGCACAGACCCAGCCAGG + Intergenic
1112624339 13:101085962-101085984 AAAACTAGAAAGACCCAGCAGGG - Intronic
1112680983 13:101764583-101764605 GAAACTGCTCAGAATAAGCAGGG - Intronic
1117561900 14:56949109-56949131 GAACCAGCAGAGACCAAGCATGG + Intergenic
1117698541 14:58390872-58390894 AAACCTGCACACATCCAGCATGG + Intergenic
1118766159 14:68910658-68910680 GACACAGCACAAACCTAGCAGGG - Intronic
1119806173 14:77484049-77484071 CAAACAGCACCAACCCAGCAGGG - Intronic
1119928467 14:78520232-78520254 TAACCTGCACAGACCCTGGATGG + Intronic
1119984267 14:79118073-79118095 GAAATGCCACAGTCCCAGCAGGG - Intronic
1121441714 14:93953834-93953856 GAAGCAGCACAGACCCCACACGG - Intronic
1123218206 14:106831635-106831657 GACACTGCTCAGAACCACCAAGG - Intergenic
1124384521 15:29195386-29195408 GAAACTGCAGAGAGCCACCTCGG - Intronic
1125976109 15:43953251-43953273 AAAACTGCACAGATTCTGCAAGG + Intronic
1127826638 15:62709482-62709504 GAGACTGCACAGGCTCAGCAGGG - Intronic
1128527507 15:68422468-68422490 GCTACTGCAGCGACCCAGCAAGG - Intronic
1129248143 15:74292542-74292564 CAAACAGCACAGATCCCGCAGGG - Intronic
1132429603 15:101749911-101749933 GAAAATGTATAGACCCAGCATGG + Intergenic
1132725496 16:1336595-1336617 GAACCCCCACAGACACAGCAGGG + Intronic
1137252197 16:46748522-46748544 GAATCTGCCCAGAGCCAGCAGGG + Intronic
1137621098 16:49876918-49876940 CAAACTGCGCAGGCCCAGTAGGG + Intergenic
1139483160 16:67241826-67241848 GAAGCAGCACAGACCCAGAAAGG + Intronic
1143330337 17:6130281-6130303 GAGAATGCAGAGACACAGCAAGG + Intergenic
1143585362 17:7847980-7848002 GAAAGGACACAGGCCCAGCAGGG - Exonic
1144874138 17:18388391-18388413 GACACAGCACAGAGGCAGCAGGG - Intronic
1145033382 17:19522444-19522466 GAAACCACACAGACCAGGCATGG - Intronic
1145888602 17:28399256-28399278 CAAACTGCACAGCCCCAACCAGG - Exonic
1146523620 17:33547194-33547216 GAGACAGCACAGACACAACATGG + Intronic
1146832919 17:36085374-36085396 GAAAGTGCACATCCCCAGCTGGG + Intergenic
1146988501 17:37245088-37245110 GCAACTGGACAACCCCAGCAAGG - Exonic
1147335632 17:39725532-39725554 GGAAGTGCACAGACCCTGCAAGG - Intronic
1148872555 17:50667400-50667422 GGCACAGCACAGGCCCAGCAAGG + Intronic
1149720631 17:58840576-58840598 GAAAATGTACAGAACCAGCCTGG + Intronic
1151971259 17:77458609-77458631 GAAACTGAAGAGGCTCAGCACGG + Intronic
1152034752 17:77865282-77865304 GACACTGCATTGACCCAGCCTGG - Intergenic
1152605080 17:81285576-81285598 GAAACGGCGCTGACTCAGCAGGG + Intronic
1155521270 18:26671420-26671442 GAACATGGATAGACCCAGCAAGG + Intergenic
1159704999 18:71675223-71675245 CACACTCCACAGAGCCAGCAGGG - Intergenic
1163333454 19:16656551-16656573 CACACTGCAGAGACCCAACATGG + Intronic
1165459981 19:35938675-35938697 GAAACGGCCCAAAGCCAGCAAGG - Intronic
1166103021 19:40582509-40582531 CAGACTGTACAGACCCAGGAAGG + Intronic
1166114581 19:40645785-40645807 GAAACTACAGAGAACTAGCAAGG + Intergenic
1167119159 19:47506551-47506573 GAAAAAGCACAGACCCTGGATGG + Intronic
925305277 2:2844008-2844030 GAAACTTCAGAGACCCGGTAAGG + Intergenic
926334468 2:11852983-11853005 GGAACTGCAGAGACCCAGGCAGG + Intergenic
926998588 2:18767977-18767999 AAAACTGCAAAGAACCAGGAAGG - Intergenic
928072858 2:28234955-28234977 GCAACTGCACAGAATCAGCAAGG - Intronic
928091731 2:28378673-28378695 GACACAAAACAGACCCAGCAAGG + Intergenic
928402067 2:30986209-30986231 GAAAACACACAGACCCAGCCAGG + Intronic
929294037 2:40226250-40226272 GAAGTTGCACAAATCCAGCAAGG - Intronic
929828405 2:45328506-45328528 GAAACTGTCCACAACCAGCAAGG - Intergenic
930024808 2:47023590-47023612 GGAACTGCACACAGCAAGCAGGG + Intronic
930091021 2:47531546-47531568 GGCACTGCACTGTCCCAGCAGGG - Intronic
931229097 2:60358941-60358963 TTTCCTGCACAGACCCAGCAGGG + Intergenic
931904411 2:66826807-66826829 GATAATGCACAGAAACAGCATGG + Intergenic
932471174 2:71959856-71959878 AGAAATGCACAGATCCAGCAGGG - Intergenic
936041917 2:109156321-109156343 GAGAAAGCACAGTCCCAGCAGGG - Intronic
936243519 2:110807634-110807656 GACCCCGCACAGAGCCAGCAGGG + Intronic
938405384 2:131030031-131030053 CTGACTGCACACACCCAGCAGGG + Intronic
941052133 2:160746901-160746923 GCAAATGCAGAGACCCAGCAGGG - Intergenic
941514615 2:166457401-166457423 GAAACTGGACAGCCTCAACATGG + Intronic
943426910 2:187749361-187749383 GAAACTGCACAGCCCCAAAGAGG + Intergenic
944423612 2:199557009-199557031 GACACAGCAGAGACCCTGCAGGG - Intergenic
945245408 2:207712277-207712299 GAAACTGGCCAGACGCAGCAGGG - Intronic
945721419 2:213422215-213422237 GAAACTGCACAGCCCCAAAGAGG - Intronic
945744127 2:213699817-213699839 CAAACAGCACAGACAAAGCAGGG - Intronic
945816048 2:214606125-214606147 GAAGCTGGAAAGGCCCAGCAGGG + Intergenic
946445614 2:219737592-219737614 GACCCAGCACAGAACCAGCAGGG - Intergenic
947315795 2:228856609-228856631 GAAAAATCACAGACCCTGCAAGG - Intronic
947951368 2:234150382-234150404 GAAACTGCAGAGACCCTGCTGGG - Intergenic
948508339 2:238446396-238446418 CACACGGCACAGACACAGCAAGG - Exonic
948532274 2:238616896-238616918 GAACTTGCAAATACCCAGCAAGG - Intergenic
948572962 2:238928883-238928905 GAAACCAAACAGAACCAGCAGGG + Intergenic
948603341 2:239119855-239119877 GCGACTGCACAGAGGCAGCAGGG + Intronic
1171412933 20:24958718-24958740 GAAGGGGCACAAACCCAGCACGG + Intronic
1175215015 20:57387613-57387635 GAAACAGCACAGCCCCATCCAGG - Intergenic
1178244318 21:30936423-30936445 GAGCCTGCACATACCCAGCTGGG - Intergenic
1180105368 21:45614988-45615010 GAAAGTGAACAGACACACCACGG + Intergenic
1183902895 22:41019792-41019814 GAGACTGTGCATACCCAGCAGGG + Intergenic
1184549996 22:45199424-45199446 GAGGCTGCACAGAGCCAGGAGGG + Intronic
1184838241 22:47036704-47036726 GAAGCTCCACAGACCCAGGCTGG - Intronic
949784533 3:7725754-7725776 GAAAGTGGACAGCCCCAGCCAGG - Intronic
950656003 3:14436765-14436787 GAAACAGCACAGACTCAGGCAGG - Intronic
950712028 3:14819733-14819755 GTGCCAGCACAGACCCAGCAGGG + Exonic
952317756 3:32246350-32246372 CAACCAGCAGAGACCCAGCAGGG - Intronic
953545408 3:43860651-43860673 GAAACTGCACAGCCTCAGAGGGG - Intergenic
954773784 3:52998564-52998586 GAAACAGCAGAGACCCTGGAGGG - Intronic
955867609 3:63401567-63401589 AAAACTGCACAGACCTCCCAGGG - Intronic
957156586 3:76551658-76551680 GAAACTGCAAAGCCCCAAGAGGG - Intronic
958593476 3:96190372-96190394 GAAACTGCGGAGCCCCAGAACGG - Intergenic
959257211 3:104030924-104030946 GAAACTGCACAGAGCCCGGAAGG + Intergenic
959547586 3:107614836-107614858 GAAAGTGCAAAGGCCCTGCAGGG + Intronic
960242300 3:115359449-115359471 CAAAATGCTCAGGCCCAGCATGG - Intergenic
961401031 3:126643103-126643125 GAAGATGCAGGGACCCAGCAGGG + Intronic
962487610 3:135860438-135860460 GGAACTGCAAGGACCCAGGAGGG - Intergenic
963154295 3:142079091-142079113 GAAAATACACAGTCCCAGCCTGG + Intronic
965849750 3:173009774-173009796 GAAAATGCACACACAAAGCAAGG + Intronic
965902180 3:173655882-173655904 CAAAATGCACAGACAAAGCAAGG + Intronic
966175081 3:177129847-177129869 AAAAATGCACATATCCAGCAGGG + Intronic
968937578 4:3620268-3620290 CAAAATGCACAAACCAAGCAAGG + Intergenic
969358929 4:6648937-6648959 GAAACTGCAAAGCCCCTGGAGGG + Intergenic
969890205 4:10253117-10253139 GACACTGCCCTGACCCACCAAGG + Intergenic
971707210 4:30060539-30060561 GAAAATGCACAGCGACAGCAGGG + Intergenic
971876754 4:32318356-32318378 GGAACTGCACAGCCCCAGAAAGG + Intergenic
972075395 4:35080014-35080036 GAAACCACAGAGACCCAACAAGG - Intergenic
972784474 4:42314182-42314204 GACTCTGCACAGACCAAGGAAGG + Intergenic
973164958 4:47065384-47065406 GAAATTGCACAGCCTCAACAAGG - Intronic
976647513 4:87400994-87401016 GAAACTTCTGAGACCCAGTAAGG - Intergenic
978279486 4:106992996-106993018 GATACTGCAAAGAACCAGCATGG + Intronic
978852292 4:113353691-113353713 GAAACAGCACAAACCAAGCTTGG + Exonic
980267838 4:130543004-130543026 GAAAATGCACAAACAAAGCAAGG + Intergenic
980282391 4:130737861-130737883 GAAACTGCAGAGACCCAAAGAGG - Intergenic
983848260 4:172545668-172545690 GGACCTGCTCAGATCCAGCATGG + Intronic
984739800 4:183150036-183150058 GAAACTGAACATACCTAGAAAGG + Intronic
986945393 5:13012287-13012309 GAAACTGTACAGATACACCATGG - Intergenic
988042718 5:25909981-25910003 GGAACAGCACAAACTCAGCAAGG + Intergenic
989756729 5:44964118-44964140 GAAGCTGCTCAAACCCATCAAGG - Intergenic
992179665 5:74183888-74183910 GAAACTGCACAGAGGCAAGAGGG + Intergenic
993055522 5:82975361-82975383 GACTCTGCACAGACCAAGGAAGG - Intergenic
993187130 5:84635449-84635471 GAGCCTGCACACACCCAGCTGGG + Intergenic
997219144 5:132144818-132144840 GAAGCTAAACAAACCCAGCATGG + Intergenic
1000254857 5:159527785-159527807 GAAACTGCACAGAACACCCAGGG + Intergenic
1001068703 5:168564029-168564051 TAAACTGCATAAACCCAGAAAGG + Exonic
1001489561 5:172145862-172145884 GACACAGCACGGACACAGCATGG - Intronic
1001692638 5:173644285-173644307 GAGACTGCACAGACTAAGGAGGG - Intergenic
1003979927 6:11380048-11380070 GAAAGGGCACAGGCACAGCATGG - Intronic
1004727325 6:18323816-18323838 TAAAATGCACAGAACCACCAAGG - Intergenic
1006448113 6:34091140-34091162 GCAGCAGCACAGACCCAGCCAGG + Intronic
1012576217 6:100803163-100803185 GAAATTGCACTAAGCCAGCAAGG - Intronic
1012914426 6:105154375-105154397 TACACTGCTCAGACCCAGAAAGG - Intergenic
1015736459 6:136405496-136405518 GAAACAGCAAGGAACCAGCATGG + Intronic
1016190726 6:141261325-141261347 GAGCCTGCAAACACCCAGCAGGG - Intergenic
1016239423 6:141911656-141911678 AAAACTGCACAGTCTTAGCATGG - Intergenic
1016914193 6:149229594-149229616 GATCCTGCACAGAGTCAGCAGGG + Intronic
1017986170 6:159444942-159444964 GAAACAGCACAGCCCCTGGATGG + Intergenic
1019266388 7:119643-119665 GAAGCTGTACAGCCCCAGCACGG + Intergenic
1019927290 7:4201810-4201832 GCAACAGCAGACACCCAGCATGG + Intronic
1020698921 7:11452674-11452696 GAACAATCACAGACCCAGCACGG + Intronic
1022565034 7:31391117-31391139 GACCCTGCAGAGACCCTGCAGGG + Intergenic
1023069261 7:36412797-36412819 GAAACTGCAAATAGCCTGCATGG - Intronic
1023832632 7:44048780-44048802 GCAACTGAACATCCCCAGCAGGG - Intronic
1024298227 7:47863270-47863292 GAAACTGCACAGACCCAGCATGG - Intronic
1026815423 7:73507505-73507527 GAAACTGCACTATTCCAGCATGG + Intronic
1032373527 7:131385008-131385030 GAAACTTCATATACCCAGTAAGG + Intronic
1034390776 7:150785967-150785989 AAAACTGCACAGACACAGATGGG - Intergenic
1034484432 7:151349786-151349808 GAAAAACCACAGACCCAGTAGGG - Intronic
1035280461 7:157775349-157775371 GGGACTGCCCAGACCCAGCAGGG - Intronic
1036903486 8:12689101-12689123 GGAATTCCACAAACCCAGCAAGG + Intergenic
1038035929 8:23686860-23686882 TAAACTGCATAAACACAGCAAGG - Intergenic
1043019185 8:74980198-74980220 GAAACTGAAAAGACAAAGCAAGG + Intergenic
1047531859 8:125684215-125684237 GAAACTTCAGAGACTCAGCATGG - Intergenic
1047915659 8:129581519-129581541 GAATCTGCAGATCCCCAGCATGG - Intergenic
1048374441 8:133810699-133810721 GAAGCTACACAGATTCAGCAAGG + Intergenic
1049653373 8:143787039-143787061 GAAACTGCTCAGAAGCAGGATGG + Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053111214 9:35461367-35461389 GACTCTGCACAGACCAAGGAAGG - Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1054453578 9:65417424-65417446 CAAAATGCACAAACCAAGCAAGG - Intergenic
1054735064 9:68742740-68742762 GAAACAGCAAAGATCCAGCATGG - Intronic
1056296763 9:85201076-85201098 GAGAGGGCACACACCCAGCATGG - Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057353765 9:94319505-94319527 GAAGCTGAACATCCCCAGCAGGG + Intronic
1057653985 9:96938087-96938109 GAAGCTGAACATCCCCAGCAGGG - Intronic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1057808784 9:98241586-98241608 GAAAATGCAGAGACCAAGAAAGG - Intronic
1059418390 9:114175817-114175839 GAGAAGGCAAAGACCCAGCAGGG - Intronic
1062103905 9:134742317-134742339 GAAAAGGCACAGACCAGGCACGG + Intronic
1062554699 9:137108635-137108657 AAAATGCCACAGACCCAGCAAGG - Exonic
1187302006 X:18059752-18059774 GTAACTGCACAGACACTCCAAGG + Intergenic
1187962649 X:24581403-24581425 GACACTGAAGAAACCCAGCATGG - Intronic
1192554816 X:72081062-72081084 AAAACTCCAGAGACACAGCATGG - Intergenic
1194561518 X:95427748-95427770 GAAACAGCTCAGCCTCAGCAAGG + Intergenic
1194864209 X:99046191-99046213 AAAAATGGACAGATCCAGCAAGG - Intergenic
1195850116 X:109273697-109273719 GTAACTAAACAAACCCAGCAGGG - Intergenic
1197779820 X:130148483-130148505 GAAACTGCAAAGACTCAAAAGGG + Intronic
1199609467 X:149600559-149600581 TTAACTGGACAGACACAGCAAGG - Intronic
1199629650 X:149768795-149768817 TTAACTGGACAGACACAGCAAGG + Intergenic