ID: 1024298840

View in Genome Browser
Species Human (GRCh38)
Location 7:47869391-47869413
Sequence AAAATTAGGTTGTAAGTAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 722
Summary {0: 1, 1: 0, 2: 5, 3: 86, 4: 630}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024298835_1024298840 28 Left 1024298835 7:47869340-47869362 CCAAGATTCAACTATATGCTGTC 0: 2
1: 4
2: 17
3: 65
4: 254
Right 1024298840 7:47869391-47869413 AAAATTAGGTTGTAAGTAAAAGG 0: 1
1: 0
2: 5
3: 86
4: 630

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024298840 Original CRISPR AAAATTAGGTTGTAAGTAAA AGG Intronic
900153506 1:1192904-1192926 AAAAATAGGTGGAAAGTAAAGGG - Intronic
900904632 1:5545384-5545406 ACAAATAGGTAGAAAGTAAAAGG + Intergenic
902756809 1:18554272-18554294 CAAATTAAGTTGTAACTGAACGG - Intergenic
905564247 1:38950792-38950814 AAAATCAAGTTGTAAATCAAAGG - Intergenic
905661094 1:39726057-39726079 AGAAGTAGGTTGAAAGTAAAAGG - Intronic
906031490 1:42723828-42723850 AAAAATAGGTTGAAAGTGAAAGG + Intergenic
906122463 1:43403575-43403597 AAAATTAGGATGGAAAGAAAAGG - Intronic
906230667 1:44160573-44160595 ACAAATAGGTTGAAAGTAAAAGG - Intergenic
906681758 1:47731484-47731506 AAAAGGTGGTTGTAATTAAAAGG - Intergenic
907209401 1:52806675-52806697 AAATATAGGTTAAAAGTAAAAGG - Intronic
907600928 1:55768520-55768542 AAAATAAGTTTGTAAGAACAAGG + Intergenic
908799436 1:67864322-67864344 AAAACCAGGTTGTGAGTACATGG - Intergenic
908805963 1:67932701-67932723 ACAAATAGGTTGAAAGCAAAAGG - Intergenic
909170536 1:72287473-72287495 AAAATAAAAGTGTAAGTAAATGG + Intergenic
910083096 1:83365272-83365294 AAAATTAGGAGGAAGGTAAAAGG + Intergenic
910776302 1:90879149-90879171 ACAAATAGGTTGAGAGTAAAAGG - Intergenic
911087681 1:93992671-93992693 AACACTAGGTTGGAAGTGAATGG - Intergenic
911716693 1:101141437-101141459 CAAAATAGGATGTAATTAAAAGG - Intergenic
912572153 1:110632591-110632613 GAAATTAGGTGGTAGGTGAAGGG + Intergenic
912870855 1:113304137-113304159 AAAATAAGGTTATGGGTAAAGGG - Intergenic
913979255 1:143494103-143494125 AATATTAGGTAGAAAGTGAAGGG + Intergenic
914073658 1:144319753-144319775 AATATTAGGTAGAAAGTGAAGGG + Intergenic
914105497 1:144646607-144646629 AATATTAGGTAGAAAGTGAAGGG - Intergenic
914219147 1:145662449-145662471 ACAAATAGGTTAAAAGTAAAAGG - Intronic
914471730 1:147985320-147985342 ACAAATAGGTTAAAAGTAAAAGG - Intronic
914837579 1:151220454-151220476 AAAGCTAGGTGGTAAGTATATGG - Intronic
914961149 1:152208908-152208930 TAAATTATTTTGTAAGAAAAAGG - Intergenic
914966937 1:152268365-152268387 AACATTTGCTTGTCAGTAAAGGG + Intergenic
915468124 1:156109609-156109631 AAAACTAGGCCGTAAGTAACAGG - Intronic
915672365 1:157500555-157500577 AAAATTTGTTTTTTAGTAAAAGG + Intergenic
915856464 1:159392844-159392866 ATAAACAGGTTATAAGTAAAAGG + Intergenic
916325424 1:163553473-163553495 ATAAATAGGTTAAAAGTAAAAGG - Intergenic
916782107 1:168044870-168044892 AAAATAAAGTTGTATGTAACAGG - Intronic
916782242 1:168047042-168047064 AAACTTAGGTGCTAAGCAAAGGG + Intronic
916859584 1:168788620-168788642 AAAACTAGTTTGTAGGTAAAAGG - Intergenic
916859699 1:168789875-168789897 AAAAATAGATTGTAAATAAAAGG + Intergenic
917008501 1:170444097-170444119 AAAATAAGATTGGAAGCAAAGGG + Intergenic
917768988 1:178255960-178255982 GCAAATAGGTTGTAAGTAAAAGG + Intronic
917818857 1:178740117-178740139 AAAATTTGGTTGTTACTAAGGGG - Intronic
918934410 1:190901617-190901639 AAAATTATCTTGCATGTAAATGG + Intergenic
919186020 1:194151376-194151398 AGTATTAGGTGGTAAATAAATGG - Intergenic
919713066 1:200747472-200747494 ATGACTAGGTTGAAAGTAAATGG + Intronic
919783762 1:201242542-201242564 AAAATTAGGGTGTAAAAAACAGG - Intergenic
920520519 1:206621412-206621434 AAAAGAAGGCTGTAATTAAAGGG + Intergenic
921108183 1:212004587-212004609 AAGATTAGTTTGTAAGAAATTGG - Intronic
921654331 1:217716939-217716961 AAATTCAGGGTTTAAGTAAAGGG + Intronic
921674084 1:217958222-217958244 AATATTAGATTAAAAGTAAATGG + Intergenic
921784209 1:219208068-219208090 GAAATTCCTTTGTAAGTAAATGG + Intronic
921784848 1:219217951-219217973 CACATTAGGATGTGAGTAAAGGG + Intergenic
922017215 1:221661915-221661937 ACAAATAGGTTGAAAGTAAAAGG - Intergenic
922651757 1:227346291-227346313 AAAATTAGATTGAGTGTAAAAGG + Intergenic
922820855 1:228484468-228484490 AAAATTGGGTTGTAAAAAATTGG - Intergenic
923185318 1:231567295-231567317 ACAAGTAGATTGAAAGTAAAAGG + Intronic
923953735 1:238991163-238991185 ACAATTAGGCTGGAAATAAAAGG + Intergenic
924478146 1:244399868-244399890 ACAAATAGGTTGAAAGTGAAAGG - Intergenic
924683553 1:246263206-246263228 AAAATAAGGTAGCTAGTAAATGG - Intronic
924755058 1:246932824-246932846 AATACTAAGTAGTAAGTAAAAGG + Intergenic
924842198 1:247724203-247724225 ACAATGAAGTTTTAAGTAAATGG - Intergenic
1063130745 10:3174197-3174219 AAAATTAAATGGTAAGTAGATGG + Intergenic
1063241164 10:4170645-4170667 AGAATTAGTTCGTAAGCAAAAGG + Intergenic
1063482998 10:6393061-6393083 AAAAACAGGTTTGAAGTAAATGG - Intergenic
1063540455 10:6928320-6928342 AAAATTAGTTTGTCTCTAAAAGG - Intergenic
1063959957 10:11298988-11299010 AAAATTAGGATGTAAATACAGGG + Intronic
1064158930 10:12926700-12926722 ACAAATAGGTTGAAAGCAAAAGG + Intronic
1064701413 10:18024948-18024970 AAATATAGATTGTAAGTAAAGGG - Intronic
1065057959 10:21866950-21866972 AGAAATATGTTTTAAGTAAATGG + Intronic
1065238456 10:23680115-23680137 CAAAATAGGTTAAAAGTAAAAGG + Intergenic
1066956062 10:42174078-42174100 AATATTAGGTAGAAAATAAAGGG + Intergenic
1067454323 10:46405686-46405708 ACAAATAGGTTGAAAGTAATAGG - Intergenic
1067632880 10:47978946-47978968 ACAAATAGGTTGAAAGTAATAGG + Intergenic
1067664349 10:48262233-48262255 ACAAATAGGTTAAAAGTAAAGGG + Intronic
1067835607 10:49638300-49638322 ATAGTTTGGTTATAAGTAAAAGG - Intronic
1068005487 10:51388549-51388571 AATATTAGCTTTTCAGTAAAAGG + Intronic
1068031050 10:51705439-51705461 AAAAGTATTTTGTAAGCAAAAGG - Intronic
1068499556 10:57826318-57826340 ACAAATAGGTAGAAAGTAAATGG + Intergenic
1069169296 10:65204968-65204990 AAAATTAGTCTGTATATAAAGGG - Intergenic
1070089012 10:73265697-73265719 AAACTTAGGTTTTGAGTAGATGG - Intronic
1070271287 10:74958037-74958059 CAAATTAAGCTGAAAGTAAAGGG + Intronic
1070372672 10:75799415-75799437 CAAATTAGGTTGAAAGTAATAGG - Intronic
1070372737 10:75800337-75800359 CAAATTAGGTTGAAAGTAATAGG - Intronic
1071380507 10:85054536-85054558 AGAATTAGGTTTTAAGTCATAGG + Intergenic
1071404337 10:85315619-85315641 ACAATTAGCTTCCAAGTAAAAGG + Intergenic
1071781341 10:88849042-88849064 ATTATAAGGCTGTAAGTAAAAGG - Intronic
1072004043 10:91225167-91225189 ACAATTAGCTTATAAGCAAAGGG + Intronic
1072836650 10:98722014-98722036 AAAATTAGTTTGAAAATGAATGG - Intronic
1073203590 10:101756022-101756044 ATAAGTAGGCTGAAAGTAAAAGG - Intergenic
1073675326 10:105640240-105640262 AAAAATAAGTAGTAAGTACAAGG - Intergenic
1073876191 10:107924059-107924081 AGAAATAGATTGAAAGTAAAAGG + Intergenic
1073900104 10:108210750-108210772 AAGATTATGTTGTCTGTAAATGG - Intergenic
1074140730 10:110670059-110670081 AAAATAAGGTGGAAACTAAAAGG - Intronic
1074248614 10:111720049-111720071 AAATGTAGGTTGAAGGTAAAAGG + Intergenic
1075827009 10:125366367-125366389 ACAAATAGGTTGAAAGTGAAGGG + Intergenic
1076039666 10:127234296-127234318 AAAAATAGTTTGGAAGTAATAGG + Intronic
1076084490 10:127614092-127614114 ACAAGTAGGTTGAAAGTAATAGG + Intergenic
1076285891 10:129296079-129296101 AAAATTAGGTTGTAAACGAATGG - Intergenic
1076632883 10:131862555-131862577 TAGAGTAGGTTGAAAGTAAAAGG + Intergenic
1076857661 10:133125134-133125156 ACAAGTAGGTTGAAAGTAACTGG - Intronic
1076940311 10:133601859-133601881 ATATGTAGGTTGAAAGTAAAAGG - Intergenic
1078661773 11:13293241-13293263 GACATTAGGTTGTCAGTAAAAGG + Intronic
1080132972 11:28818154-28818176 TAAAGTAGGTGGTAAGAAAAGGG - Intergenic
1080891545 11:36412882-36412904 AACATTATGTTTTCAGTAAATGG + Intronic
1081364200 11:42214651-42214673 AAAATTAGGCAGAAAGGAAAGGG - Intergenic
1081712120 11:45224185-45224207 AAAACCAGGGTGTAAGGAAATGG - Intronic
1082104118 11:48201542-48201564 ATAATGATGTTGAAAGTAAATGG + Intergenic
1084397273 11:68920440-68920462 ACAAATAGGTTCTAAGAAAAAGG - Intronic
1084602121 11:70152014-70152036 AGAATTAGGATGAAGGTAAATGG - Intronic
1085219036 11:74857275-74857297 ATAAATAGGTTGCAAGTAAATGG + Intronic
1085435648 11:76498865-76498887 AAAAGTAGGTTGAAAGTAACAGG - Intronic
1085860486 11:80227413-80227435 AAAATTAGGACCTAATTAAAAGG + Intergenic
1085955706 11:81391709-81391731 AAAATGAGGTTTTTAGTAACAGG - Intergenic
1086772677 11:90788293-90788315 ACAAATAGGTTGAAAGTGAAAGG - Intergenic
1087218970 11:95525294-95525316 AAAAATACCATGTAAGTAAATGG - Intergenic
1087252119 11:95914230-95914252 AAAATTATAATGTAAGTGAATGG - Intronic
1087386654 11:97479186-97479208 TATAATAGGTTGAAAGTAAAAGG + Intergenic
1087659362 11:100968156-100968178 ACAAACAGGTTGAAAGTAAAAGG - Intronic
1087748198 11:101973683-101973705 TAAATTAGGTTTTAATAAAAAGG + Intronic
1087894125 11:103568967-103568989 AAGATTAGTTTGTAAGTATTTGG - Intergenic
1088044249 11:105428360-105428382 AAAACTAGGTTGTAGGGAAGAGG + Intergenic
1088093273 11:106067901-106067923 ATAAGTAGGTTGAAAGTAAAAGG + Intronic
1088704519 11:112449770-112449792 AAAAATAGGTTGTTATAAAAAGG - Intergenic
1088873956 11:113918026-113918048 ACAAATAGGTTGGAAATAAAAGG - Intronic
1089687364 11:120163710-120163732 ACAAACAGGTTGAAAGTAAAAGG - Intronic
1089853454 11:121519659-121519681 ATAATTAGGTTGTAAGTACCTGG + Intronic
1089876365 11:121725546-121725568 CAAATGAGGTAGAAAGTAAAAGG - Intergenic
1090814254 11:130277002-130277024 AAAAATAGATTGAAAGTAAAAGG - Intronic
1091359673 11:134967307-134967329 CAAAATAGGTTGCAAGTAAAAGG + Intergenic
1091506718 12:1076772-1076794 GAAATTATGTTGAAAGTAAATGG - Intronic
1092464554 12:8718745-8718767 AAAATTAGGCAGAAAGTACAGGG + Intronic
1092528839 12:9327589-9327611 ATATTTAGGTTATAAGTCAAAGG - Intergenic
1092574237 12:9762023-9762045 AAAAATAGGATGGAAGCAAAGGG - Intergenic
1092608445 12:10146184-10146206 AAAAATAGGTTAAAAGTAAAAGG + Intergenic
1093258835 12:16908029-16908051 ACAAATAGATTGAAAGTAAAAGG + Intergenic
1093644955 12:21574709-21574731 AAAATAAGCTTATAAGTAAGTGG - Intronic
1093721995 12:22454311-22454333 CAAATTAGCTAGTAAGTAAATGG + Intronic
1093751124 12:22801328-22801350 ATAACTATGTTATAAGTAAAAGG + Intergenic
1094719192 12:33045333-33045355 AAAATTAGGTTGAAAGAAACAGG - Intergenic
1095136016 12:38604371-38604393 ACACATAGGTTGAAAGTAAAAGG + Intergenic
1095364992 12:41392598-41392620 ATAACTAGGATGTAAGTAAGGGG - Intronic
1095414742 12:41964154-41964176 AAATTCACATTGTAAGTAAATGG + Intergenic
1095545688 12:43366124-43366146 ATAAATAAGTTGAAAGTAAAGGG + Intronic
1095868474 12:46999532-46999554 AAAATAAAGATGTAAATAAATGG + Intergenic
1097370994 12:58780881-58780903 AGAATTAGATTGAAAGTAAAAGG + Intronic
1097373009 12:58807231-58807253 ATAATTAGGATGTTAGAAAAGGG + Intronic
1097406037 12:59191471-59191493 AAAATTAACTTGTCAGGAAAAGG + Intergenic
1097496501 12:60344792-60344814 AAAAATAGATTGAAAGTAAAAGG - Intergenic
1097520613 12:60665215-60665237 ATAAGTTGGTTGTAAATAAACGG + Intergenic
1098768443 12:74520365-74520387 AAAATGAACTTGTAAGGAAATGG - Intergenic
1098928550 12:76382041-76382063 ACAAATAGGCTGAAAGTAAATGG - Intronic
1099001711 12:77185795-77185817 AACATTAGGCAATAAGTAAAAGG - Intergenic
1100660389 12:96691746-96691768 AAAAATAGGTTCTAAGTATGAGG + Intronic
1100910038 12:99349455-99349477 ACAAATAGGTTGAAAGTTAAAGG + Intronic
1101655269 12:106714817-106714839 ATAATTAGGTTGGAGGAAAAGGG - Intronic
1101894106 12:108742059-108742081 ACAAGTGGGTTGAAAGTAAAAGG - Intergenic
1101933423 12:109034983-109035005 ACAAATAGGTTAAAAGTAAATGG - Intronic
1103121497 12:118383622-118383644 ACAATTAGATTGTAAGTTACAGG - Intronic
1103309305 12:119991131-119991153 AAAATTAGATTGCAAAAAAAAGG + Intronic
1103634905 12:122295963-122295985 ACAAATAGGTTGAAAGTAAAAGG - Intronic
1104101235 12:125612754-125612776 TAAATTAGATTGAAAGGAAAAGG - Intronic
1104222867 12:126802610-126802632 TAAGCTAGGTTGTAAGAAAACGG - Intergenic
1105240581 13:18605326-18605348 ATAATTATCTTGTATGTAAATGG + Intergenic
1105629942 13:22153402-22153424 AAAATTAAGTGCTAAGAAAAAGG + Intergenic
1105733146 13:23240090-23240112 ACAAATAGGTTGAAAGTAAAAGG + Intronic
1105787543 13:23764439-23764461 GAAAATAGATAGTAAGTAAATGG - Intronic
1106263114 13:28085788-28085810 ACAAATAGGTTAAAAGTAAATGG - Intronic
1106322778 13:28658084-28658106 GAGATGAGGTTGTAAGTAGATGG - Intergenic
1106371225 13:29135392-29135414 ACAAATAGGTTGAAAGTGAAAGG - Intronic
1106649229 13:31671313-31671335 ACAAATAGGTTGAAAGTAAAAGG - Intergenic
1106707711 13:32299610-32299632 AAAATTAGAGTGTAGGTAATGGG + Intergenic
1107044551 13:35980978-35981000 ACAAATAGGTTAAAAGTAAATGG + Intronic
1107071889 13:36278905-36278927 GAAATTAGGATGTTAGGAAATGG - Intronic
1108830299 13:54469418-54469440 AAAGTCAGGTTAAAAGTAAAAGG - Intergenic
1108864586 13:54907291-54907313 ACAAATAGGTTGAAAGTGAAAGG + Intergenic
1109020699 13:57088223-57088245 AAAAATATGTTCTAAGAAAAAGG - Intergenic
1109204873 13:59470729-59470751 ACAAATAGGCTGAAAGTAAAAGG + Intergenic
1109236510 13:59827826-59827848 AAAATTAGGTTTAAACTCAATGG + Intronic
1109319007 13:60786682-60786704 AAGATTAGGCTGGAAGTGAAAGG - Intergenic
1109510327 13:63363609-63363631 AAGATTAGGTAGTAAGAAATTGG - Intergenic
1109842062 13:67931608-67931630 AAAATAATGCCGTAAGTAAATGG - Intergenic
1110023031 13:70499730-70499752 ATAAGTAGGTTAAAAGTAAAAGG + Intergenic
1110350297 13:74499852-74499874 ACAAATAGGTTAAAAGTAAAAGG - Intergenic
1110494826 13:76155217-76155239 AAAATTATGGTATAAGTAATTGG + Intergenic
1111131441 13:83982034-83982056 AAAAATAGGGTGTACGTAACAGG - Intergenic
1111253337 13:85634848-85634870 AAAATTTGGATGTTAGTTAAAGG - Intergenic
1112010376 13:95288814-95288836 CATATTAGGCTGTAGGTAAATGG - Intronic
1112207804 13:97342592-97342614 AAAATCAGGCTGTAATCAAAGGG + Intronic
1112270941 13:97969084-97969106 ACAAATAGGTTGAAAGTAAAAGG - Intronic
1112414995 13:99196762-99196784 TTAATTTGGTTGTAAATAAAAGG + Intergenic
1112534804 13:100242192-100242214 ACAAATAGGTTGAAAGTGAAAGG + Intronic
1112664224 13:101551251-101551273 AAAATCTGATTGTAAATAAAAGG + Intronic
1112772844 13:102810304-102810326 ACAAATAGGCTGAAAGTAAAAGG - Intronic
1112877145 13:104057235-104057257 ACAAATAAGTTGAAAGTAAAAGG - Intergenic
1113631504 13:111890069-111890091 ATAAGTAGGTTGAAAGTGAAGGG - Intergenic
1114369673 14:22072211-22072233 ACAAATAAGTTGAAAGTAAAAGG - Intergenic
1115018391 14:28644738-28644760 AAAATTAGGCTATAATTTAAGGG + Intergenic
1115022005 14:28693188-28693210 AAAATAAAGTTATGAGTAAATGG + Intergenic
1115254826 14:31388668-31388690 TAAACTAGGTTGCAAGTAAGAGG - Intronic
1116009751 14:39337159-39337181 ATAAGTAGGTGGAAAGTAAAAGG + Intronic
1116131294 14:40857756-40857778 CAAATTGGCTTATAAGTAAAGGG + Intergenic
1116905695 14:50401295-50401317 CCAATTATGTTGTAAGGAAAGGG + Intronic
1117455506 14:55893155-55893177 GAAATTGGGTTATAAGAAAATGG + Intergenic
1117922690 14:60741813-60741835 ACAAATTGGTTGAAAGTAAATGG - Intronic
1117991304 14:61436526-61436548 AAAAATAAGTTGAAAATAAATGG - Intronic
1118218623 14:63833712-63833734 AATATTAGGTTAAAAGTATAAGG - Intergenic
1119550411 14:75507216-75507238 ATAAATAGGTTGTATGTAAAAGG + Intergenic
1119671388 14:76521605-76521627 TTAAATAGGTTGAAAGTAAAAGG - Intergenic
1119733598 14:76966822-76966844 AAAATTATGCTGCAAGTAAGTGG + Intergenic
1120263702 14:82221730-82221752 AAAAAGAGATTGAAAGTAAAAGG + Intergenic
1120596499 14:86445235-86445257 AAAATGAGATTATAGGTAAAAGG + Intergenic
1121036800 14:90712031-90712053 ACAAATAGGTTGAAAATAAAAGG + Intronic
1121682523 14:95805535-95805557 AAAATGAGGTTGGAAGTCCAAGG + Intergenic
1121804506 14:96804751-96804773 AAAACAAAGTTGTAAGTCAAGGG - Intronic
1121964441 14:98291056-98291078 AAAATAAGATTGCTAGTAAATGG - Intergenic
1122311147 14:100795729-100795751 ACAAATAGGTTAAAAGTAAAAGG + Intergenic
1122510078 14:102259495-102259517 AAAATTAAGCTGTTAATAAATGG - Intronic
1123490693 15:20779043-20779065 ACAATTATCTTGTATGTAAATGG - Intergenic
1123547195 15:21348134-21348156 ATAATTATCTTGTATGTAAATGG - Intergenic
1123559446 15:21472582-21472604 ACAAATAGGTTGAAAGTGAAAGG + Intergenic
1124009662 15:25827926-25827948 ACAAATAGGTTGAAAGTAAAAGG + Intronic
1124062719 15:26308851-26308873 CAAATTGGCTTATAAGTAAAAGG + Intergenic
1124131265 15:26988501-26988523 AAACATAGGTTAAAAGTAAAAGG - Intronic
1124242309 15:28038953-28038975 ATAAATAGGTTGAAAGTGAAAGG + Intronic
1124257003 15:28152516-28152538 AAAAGTAGTTTGTTAGAAAAGGG + Intronic
1124418885 15:29499875-29499897 AAAAACAGGTTGAAAGTAAAAGG + Intronic
1124961415 15:34399076-34399098 TAAGTTAGGTTGTAAGTAGAAGG - Intronic
1124978041 15:34545299-34545321 TAAGTTAGGTTGTAAGTAGAAGG - Intronic
1125118451 15:36123388-36123410 AAAATCTGTTTGTAAGTAAAAGG + Intergenic
1125924851 15:43554549-43554571 ACAAATAGGTTGAAAGTAAAAGG - Intronic
1127010040 15:54615199-54615221 ATAACTGGATTGTAAGTAAAAGG - Intronic
1129073995 15:72975917-72975939 AAATTTAGGTGGTAGGTAAAAGG - Intergenic
1129768227 15:78183737-78183759 AAAATAAAGTTATATGTAAAAGG + Intronic
1130038748 15:80385965-80385987 ACTCTTTGGTTGTAAGTAAAGGG + Intronic
1130055136 15:80516530-80516552 ACAGTTAAGTTGTAAGTAAAAGG - Intronic
1130142284 15:81237778-81237800 ACAAATAGGTTGAAAATAAAAGG - Intronic
1130735396 15:86542882-86542904 ACAGATAGGTTGAAAGTAAAAGG - Intronic
1131089415 15:89610561-89610583 ACACTAAGGTTGAAAGTAAAAGG - Intronic
1131690277 15:94820005-94820027 AAAATTAGTTTGTAAGAGCAAGG - Intergenic
1132140846 15:99393176-99393198 ACAAGTAGGCTGAAAGTAAAAGG + Intergenic
1132267858 15:100492568-100492590 ACAAATAGGTTGAATGTAAAAGG - Intronic
1132296967 15:100745047-100745069 AAAAATAGGTTAAAAGAAAATGG - Intergenic
1132303995 15:100795519-100795541 ACACATAGGTTGAAAGTAAATGG + Intergenic
1202955525 15_KI270727v1_random:75363-75385 ATAATTATCTTGTATGTAAATGG - Intergenic
1202967792 15_KI270727v1_random:199742-199764 ACAAATAGGTTGAAAGTGAAAGG + Intergenic
1133534698 16:6690506-6690528 AAAAATAGTATATAAGTAAAAGG + Intronic
1133646740 16:7771476-7771498 AAAAATAGTTTGGAAGTAACCGG - Intergenic
1133678878 16:8101478-8101500 AAAATTAGGATGAGATTAAAGGG + Intergenic
1135962237 16:27005318-27005340 ATAGGTAGGTTGAAAGTAAAAGG + Intergenic
1136528631 16:30850345-30850367 ATAAATAGTTTGTAAGTAAAAGG - Intronic
1136637052 16:31530980-31531002 GAAATAAGATTGTAAATAAATGG + Intergenic
1138176476 16:54902705-54902727 AAGATTAGGTTGTTAGTATCTGG - Intergenic
1138260102 16:55612910-55612932 ATAAATAGGTTGAAAGTAAATGG - Intergenic
1138624655 16:58240806-58240828 AAAGTTTGGTTGTTACTAAAAGG - Intronic
1138778959 16:59759218-59759240 AATATTAGTTTGTAAGTACTGGG + Intergenic
1139228766 16:65260079-65260101 CCAGTTAGGTTGAAAGTAAAAGG - Intergenic
1139682849 16:68578938-68578960 ACAAACAGGTTGAAAGTAAAAGG + Intergenic
1139724868 16:68889163-68889185 AAAATTAAGTGGAAAGTACAGGG + Intronic
1140180506 16:72712472-72712494 ATAAATAGGTTGAAAGTGAAAGG - Intergenic
1142277505 16:89129476-89129498 ACAGGTAGGTTGGAAGTAAAGGG - Intronic
1142615682 17:1133378-1133400 AAAATAAAGTTGTAAGTCACAGG + Intronic
1144801467 17:17931187-17931209 AAAAATAGGTAGTAACGAAAAGG - Intronic
1145854761 17:28144107-28144129 AAAATTATGTCGTATGTAGATGG - Intronic
1146222784 17:31039827-31039849 AAAGTTATGTATTAAGTAAAGGG - Intergenic
1146342215 17:32030183-32030205 AAAGTTATGTATTAAGTAAAGGG + Intronic
1146350593 17:32089409-32089431 AAAGTTATGTATTAAGTAAAGGG - Intergenic
1147481078 17:40763551-40763573 ACAGGTAGGTTGAAAGTAAAAGG - Intergenic
1147501922 17:40973676-40973698 ATAGGTAGGTTGAAAGTAAAAGG - Intergenic
1148179521 17:45594129-45594151 AAAATAAGGGAGTAAGTCAAAGG - Intergenic
1149198194 17:54149461-54149483 AAAAGTAAATTGTACGTAAATGG + Intergenic
1149633465 17:58146116-58146138 AAAAATAGGTTTAAAATAAAAGG + Intergenic
1149961969 17:61119725-61119747 AAAATTATATTGTCTGTAAATGG - Intronic
1150033787 17:61771052-61771074 ACAAATAGGTTGAAAGTAAAAGG + Intronic
1150545319 17:66151052-66151074 ATAAATAGCTTGAAAGTAAAAGG - Intronic
1153319223 18:3755411-3755433 ACAAATAGGTTGAAAGCAAAAGG + Intronic
1153558373 18:6342858-6342880 ACACTTAGGCTGAAAGTAAAAGG + Intronic
1153657608 18:7298225-7298247 ACAAACAGGTTGGAAGTAAAAGG - Intergenic
1154061692 18:11067395-11067417 AAAATTATCTTGAATGTAAATGG + Intronic
1154448295 18:14453742-14453764 ATAATTATCTTGTATGTAAATGG - Intergenic
1155105279 18:22658610-22658632 AATATTAACTTGAAAGTAAATGG + Intergenic
1155136761 18:23003292-23003314 ATTATTTGGTTGGAAGTAAATGG - Intronic
1155181157 18:23348695-23348717 ACAAGTAGGCTGGAAGTAAAAGG - Intronic
1156248636 18:35329280-35329302 AAAAATAGATTAAAAGTAAATGG - Intergenic
1156958309 18:42993822-42993844 ACAATTAGGTTTTAATGAAATGG - Intronic
1157106972 18:44782907-44782929 AAAATTAATTTTTAAGAAAATGG - Intronic
1157633113 18:49120351-49120373 ATAGTTAGGTTGAAAGTAAAAGG + Intronic
1158020423 18:52835355-52835377 AAAATGAGTTTGAAAGTCAAGGG - Intronic
1158577812 18:58654684-58654706 AAAATGAGATTCCAAGTAAATGG - Intergenic
1158958860 18:62570703-62570725 ACAAATAGGTTTAAAGTAAAAGG - Intronic
1159000434 18:62969830-62969852 ACAAATAGGTTAAAAGTAAAAGG - Intronic
1159042061 18:63333671-63333693 AAAATTAGGTTTTATATAAAAGG - Intronic
1159155695 18:64578692-64578714 AAAAATATGGTGTAAGTAAGGGG + Intergenic
1159157589 18:64604513-64604535 AAAATAAGGTTGTCATAAAAGGG + Intergenic
1159492069 18:69149373-69149395 AAAAATAGCTTGTAAGTTAGAGG + Intergenic
1159875722 18:73808799-73808821 AATATTAGGTTGGAAGCAGAGGG + Intergenic
1160009549 18:75094884-75094906 ACAAATAGGTTAGAAGTAAATGG - Intergenic
1160398675 18:78591740-78591762 ACAAATAAGTTGAAAGTAAAAGG + Intergenic
1160519869 18:79499760-79499782 ACAAATAGGTTGAAAGTGAAAGG + Intronic
1163894257 19:20043843-20043865 AAATTTAAGTTGAATGTAAAGGG - Intergenic
1164387479 19:27787127-27787149 ACAACTAGGCTGAAAGTAAAAGG + Intergenic
1164482452 19:28623355-28623377 AAAATTAGTTTATATGTAAATGG + Intergenic
1165578923 19:36845553-36845575 AAAATGAGGATGGAGGTAAATGG + Intronic
1165883654 19:39061531-39061553 AAGATAAGGTTGTAAGTGAAAGG - Intergenic
1166208434 19:41288983-41289005 AAAGTTAGATTCTAAGTCAAAGG + Intronic
1166596484 19:44054692-44054714 AGAATGAGGTTCAAAGTAAATGG - Intronic
925278393 2:2666443-2666465 AATAATAGGTTTTAAGTAATAGG - Intergenic
926547250 2:14256881-14256903 AAAATTATCTTGTAAGAAATTGG + Intergenic
926879741 2:17531246-17531268 AAAATTACTTTGTTGGTAAATGG - Intergenic
927080385 2:19622900-19622922 ACAGGTAGGTTGAAAGTAAAAGG + Intergenic
927223169 2:20734170-20734192 ATAAGTAGGTTGAAAGCAAAAGG - Intronic
927388854 2:22569581-22569603 AAAATTAGGTTGAGACTAGATGG - Intergenic
927555213 2:24026122-24026144 AAAATTGGTGTGTAAGTAACAGG + Intronic
927743884 2:25598102-25598124 AAAATGAGCTTGTAAGCAGAAGG + Intronic
928657971 2:33472969-33472991 ACAAGTAGGTTGAGAGTAAATGG + Intronic
928863460 2:35888619-35888641 AATATTAGGTTGGAATTAACTGG + Intergenic
929979871 2:46668339-46668361 GAAATTATGTTGTAAGTGACAGG + Intergenic
929984525 2:46714489-46714511 ATAAATAGGTTAAAAGTAAAAGG - Intronic
929985269 2:46725225-46725247 ATAAGTAGGTTAGAAGTAAAAGG - Intronic
930324235 2:49894642-49894664 AAAATGAAGTTGTAAATAATAGG - Intergenic
930327904 2:49943423-49943445 AAAATTATGTTGTGAGCTAATGG + Intronic
930708227 2:54525233-54525255 AAAATTAAGATGTAAGTGTATGG - Intronic
930740652 2:54829604-54829626 AAAAGTATGTTAAAAGTAAATGG + Intronic
931227987 2:60350614-60350636 AAAATAATTTTGTAATTAAAAGG + Intergenic
931341744 2:61408588-61408610 AAAATCAGGTTTAAAGTAAGAGG + Intronic
931341838 2:61409239-61409261 AAAATCAGGTTCAAAGTAAGAGG + Intronic
931375539 2:61704593-61704615 AAGATCAGGTTGTCAGTAGAGGG + Intergenic
932050199 2:68390378-68390400 TAAATTAGCTTTTAAGAAAAAGG - Intronic
932090202 2:68799624-68799646 ACAATTAGCTGCTAAGTAAAAGG + Intronic
932551824 2:72778266-72778288 AGAAATAGGTTGGAAGTGAAAGG + Intronic
932639964 2:73435104-73435126 ACAAATAGGTTGAAAGTAGAGGG - Intronic
932647149 2:73514084-73514106 ACAGATAGGTTGAAAGTAAAAGG - Intronic
933356806 2:81221355-81221377 GTAAATAGGTTGGAAGTAAAAGG - Intergenic
933551536 2:83783369-83783391 ACAAATAGGTTGAAAGTAAAAGG + Intergenic
933557966 2:83854611-83854633 AAATTAAAGTTCTAAGTAAATGG + Intergenic
935962576 2:108441704-108441726 AAAATAAGGTAGTAAAGAAATGG - Intergenic
935996701 2:108781449-108781471 AAAAATAAGTTATTAGTAAAAGG - Intronic
936990628 2:118361379-118361401 ATAAGTAGGTTGAAAGTGAAAGG - Intergenic
937055437 2:118931251-118931273 ACAAGTAGGTTGAAAGTGAAAGG - Intergenic
937351678 2:121168617-121168639 ACAAATAGGTTAAAAGTAAAAGG - Intergenic
937737645 2:125312104-125312126 AAAATCAGGTTGTTAATAATGGG - Intergenic
937946725 2:127345167-127345189 CAAAATAGGTTGACAGTAAAAGG + Intronic
938075755 2:128334612-128334634 AAAGACAGGTTGAAAGTAAAAGG + Intergenic
938172794 2:129096341-129096363 ACAAATTGGTTGAAAGTAAAAGG - Intergenic
938784917 2:134618188-134618210 ACAATTAGGTTTCATGTAAAAGG + Intronic
939068299 2:137509986-137510008 ATAAATAGGTTGAAAATAAAGGG - Intronic
939081469 2:137667387-137667409 AACATTAGGTTGTAACTTCATGG - Intronic
939157093 2:138538551-138538573 AAAAATAGGTTGAAAGTGAAAGG - Intronic
939633888 2:144557901-144557923 ACAATTTGATTGAAAGTAAAGGG - Intergenic
939675512 2:145067119-145067141 AAAATGAGGCTGTAAACAAATGG - Intergenic
940117810 2:150228502-150228524 AAACTAAGGTTGAAAATAAATGG - Intergenic
940349335 2:152664502-152664524 AAAATTAGGTTCTATCTTAAAGG - Intronic
941317684 2:164015104-164015126 AAAATTAACTTGTAAATTAAAGG - Intergenic
942700745 2:178706797-178706819 AAAATTAAATCATAAGTAAAAGG + Intronic
942821381 2:180119992-180120014 AGAATTAGGGTATAAATAAAAGG - Intergenic
943283013 2:185962453-185962475 ATAGTTAGCTTGGAAGTAAAAGG + Intergenic
943343420 2:186708854-186708876 ATACTTAGGTTGAAAGTAAAAGG + Intronic
943826274 2:192397644-192397666 AAAATAAGGTTTTATTTAAAAGG - Intergenic
943877320 2:193086843-193086865 AAAACTAGGCTGAAATTAAAGGG + Intergenic
945631208 2:212279484-212279506 ATAATTATGTGGTAAGTATATGG - Intronic
945704957 2:213218455-213218477 AAAAATGGGTTGAAGGTAAAAGG + Intergenic
947173235 2:227334087-227334109 AAAGTTATGTGGTTAGTAAATGG - Intronic
947223053 2:227812949-227812971 CCAAATAGGTTGAAAGTAAAAGG - Intergenic
947249984 2:228091133-228091155 ATAAATAGGTTGAAAGTAAAAGG + Intronic
947401838 2:229739028-229739050 ACAAATAGGTTCAAAGTAAAAGG + Intergenic
948012326 2:234659250-234659272 AAACTCAGGTTGAAAGTAAAGGG + Intergenic
948725739 2:239932913-239932935 AAAAATGGTTTGTAAATAAATGG - Intronic
1169008955 20:2233842-2233864 AAAAGTAGTTTTTAAGAAAAAGG - Intergenic
1169056947 20:2630488-2630510 AATAGTAGATTGAAAGTAAAAGG - Intronic
1170178880 20:13505813-13505835 AAAATTAGGTTGTTTGTTTAAGG - Intronic
1170229663 20:14030715-14030737 AAAAAAAGGTTTTAAGGAAATGG + Intronic
1170246684 20:14228301-14228323 AAAATAATGTTTTAAGGAAATGG + Intronic
1171240015 20:23559606-23559628 ATGAATAGGTTGAAAGTAAAGGG - Intergenic
1171357346 20:24558410-24558432 AAAAATCAATTGTAAGTAAAAGG - Intronic
1172284025 20:33728329-33728351 AAATTCAGTTTGTCAGTAAAGGG + Intergenic
1173196717 20:40920046-40920068 AAAATGAGGTGCTGAGTAAATGG - Intergenic
1173230960 20:41197530-41197552 ACAAGGAGGTTGAAAGTAAAAGG - Intronic
1174959330 20:55137355-55137377 AAAGTTAGGATATAAATAAAGGG - Intergenic
1175102905 20:56592806-56592828 ACAATTCCATTGTAAGTAAATGG + Intergenic
1175288640 20:57856964-57856986 AAGTTTAGGTTGTAAGTAACAGG + Intergenic
1175700349 20:61132315-61132337 TAAATTACATTGTATGTAAATGG - Intergenic
1176447929 21:6836789-6836811 ATAATTATCTTGTATGTAAATGG + Intergenic
1176826099 21:13701815-13701837 ATAATTATCTTGTATGTAAATGG + Intergenic
1176923130 21:14713408-14713430 ACAAATAGGTTGAAAATAAAAGG + Intergenic
1177696758 21:24583306-24583328 GAAATTAGATTGTAAGTTGATGG - Intergenic
1178394251 21:32226377-32226399 ATAAATAGGTTGAAAATAAAAGG + Intergenic
1179055716 21:37931501-37931523 ACAAATTGGTTGAAAGTAAAAGG + Intergenic
1179130410 21:38631350-38631372 AAAATTTGGTTGAAAAAAAAAGG + Intronic
1179298604 21:40086569-40086591 GAAATTAGGATATAAGTTAAGGG - Intronic
1179306731 21:40160680-40160702 CAAATAAGGTTGCAACTAAAGGG - Intronic
1182369921 22:29803631-29803653 AAAAAGAGATTGTAATTAAAGGG - Intronic
1185090298 22:48764068-48764090 ACAGATAGGTTGAAAGTAAAAGG + Intronic
1185104671 22:48860603-48860625 AAAATTAAGTTGTAAGTGCCTGG - Intergenic
949146205 3:702788-702810 AAAATTAAGTTTTTATTAAAAGG - Intergenic
949159475 3:862357-862379 AAAATTAGTTCATAAGTCAATGG + Intergenic
949192167 3:1263370-1263392 AAAATTAGGTTATAAGAGACTGG - Intronic
949805284 3:7948617-7948639 ACAATCAGGTTAAAAGTAAATGG + Intergenic
951155252 3:19344805-19344827 AATAATATGATGTAAGTAAAAGG - Intronic
951208686 3:19950336-19950358 AAAATTATGTTATTAATAAATGG - Intronic
952022238 3:29037615-29037637 AAAGAAAGGTTGAAAGTAAAAGG - Intergenic
952224667 3:31363095-31363117 AAAATTAGGTGGGAAGTTACAGG - Intergenic
952937632 3:38412826-38412848 AAAGTTAAATTGCAAGTAAACGG + Intronic
953396480 3:42575408-42575430 ATAGGTAGGTTGAAAGTAAATGG + Intronic
953870590 3:46623738-46623760 CAAAATAGGTTAAAAGTAAAAGG - Intronic
954829295 3:53405451-53405473 GAAAGCAGGTTGAAAGTAAAAGG + Intergenic
956259335 3:67320635-67320657 ATAAATAGTTTGAAAGTAAAAGG - Intergenic
956690009 3:71867735-71867757 AAAAATAGGCTAAAAGTAAAAGG + Intergenic
957139212 3:76331396-76331418 AAAAGAAGCTTGTAATTAAAAGG - Intronic
957346508 3:78967820-78967842 TAAATTAGGGTGAAATTAAATGG + Intronic
957499054 3:81029631-81029653 AATATTATTTAGTAAGTAAAAGG + Intergenic
958116761 3:89230391-89230413 AAAGTTATGTTGGAAGTACATGG + Intronic
958140401 3:89555418-89555440 ATATTTAGGTAGTAAGTAAATGG + Intergenic
958180928 3:90060235-90060257 AAAAGTAGTTTGTAAGAAAAGGG - Intergenic
958545704 3:95547627-95547649 AAAAATAGGTTCTATGTAAAAGG - Intergenic
959014246 3:101114521-101114543 AAAATTAGGTAGAAGGTAGAAGG + Intergenic
959474706 3:106795437-106795459 AAAATTAGATTGTAACACAAAGG + Intergenic
960014815 3:112874919-112874941 ACACATAGGTTGAAAGTAAAAGG - Intergenic
960070933 3:113429481-113429503 ACAAATAGGTTGAAAGTAAATGG - Intronic
960114816 3:113883603-113883625 ACAAATAGATTGAAAGTAAAAGG + Intronic
960129556 3:114040649-114040671 ACAAATAGGTTGAAAGGAAAAGG - Intronic
960237667 3:115302825-115302847 ATGATTAGGTTAAAAGTAAAAGG + Intergenic
960784768 3:121360385-121360407 AGAATTACTTTGAAAGTAAATGG - Intronic
961675483 3:128562808-128562830 AAAAATAAGTAGTAAGTAAATGG - Intergenic
963171915 3:142260152-142260174 ACAAATAGATTGAAAGTAAAAGG + Intergenic
963447544 3:145433717-145433739 AAGATTAAGTTATAAGTAGATGG - Intergenic
963876159 3:150477560-150477582 AAAAATAGGTTGAAAGTAAAAGG - Intergenic
964337351 3:155669643-155669665 AAAATAAGTTAGTAAATAAAAGG + Intronic
964349089 3:155785001-155785023 ACAAATAGGTTGAAAGTGAAAGG + Intronic
965203072 3:165685780-165685802 AGAATTATTTTGTCAGTAAAAGG - Intergenic
965826783 3:172738863-172738885 AAGCATAGGTTGTAAGAAAATGG + Intergenic
967461594 3:189753512-189753534 AAAAGTAGGTTAAAAGTAAAAGG - Intronic
967473345 3:189888325-189888347 AAAATAAAGTTGAAAATAAATGG - Intronic
967724032 3:192844799-192844821 AAAATACGGTTGTATGTGAATGG - Intronic
968051770 3:195659129-195659151 AAAATTACTTTGTAATTAAGAGG - Intergenic
968104045 3:195989204-195989226 AAAATTACTTTGTAATTAAGAGG + Intergenic
968242952 3:197108726-197108748 ACAAAAAGGTTGAAAGTAAACGG - Intronic
968302347 3:197626793-197626815 AAAATTACTTTGTAATTAAGAGG + Intergenic
968344416 3:197989003-197989025 ACAAATAGGTGGAAAGTAAAAGG - Intronic
968534775 4:1117181-1117203 AGAATTAGATTCTAAGCAAATGG + Intergenic
969382890 4:6818025-6818047 ACAAATAGGTTAAAAGTAAAAGG - Intronic
969567599 4:7988008-7988030 AAAAATAGGTAGTAAACAAATGG - Intronic
970645074 4:18110495-18110517 AAAATTATGGTGTGAGTAGAGGG + Intergenic
970880232 4:20919841-20919863 AAAGTTTGATGGTAAGTAAATGG - Intronic
971447798 4:26770235-26770257 ACAATTAGGTTAAAAGTAAAAGG + Intergenic
971483506 4:27135735-27135757 ACAAATAGGTTGAAAGTAAAAGG + Intergenic
971963653 4:33522431-33522453 AAAATCAACTTGTAAGAAAATGG + Intergenic
972036795 4:34533434-34533456 AAGCTTAGGTTGAAAGAAAAAGG + Intergenic
972150491 4:36083462-36083484 AAAAATAATTTGTAATTAAATGG + Intronic
972252297 4:37315556-37315578 ACAAATATGTTGAAAGTAAAAGG - Intronic
972884937 4:43473915-43473937 ATAATAAGATTGAAAGTAAATGG - Intergenic
973225666 4:47781207-47781229 ACAAATAGGTTGTAAGTGAAAGG + Intronic
974006792 4:56565961-56565983 ACAAATAGGTTAAAAGTAAATGG - Intronic
976456583 4:85254740-85254762 AAAATTAAGGTGCAAGTACATGG - Intergenic
977389223 4:96386356-96386378 AAAATTATATTTTAAGTAATAGG - Intergenic
978127270 4:105149153-105149175 AATATTAGTTTGTTAGCAAAAGG - Intronic
978332747 4:107632520-107632542 AAAGATTGGTTGTGAGTAAACGG + Intronic
978355664 4:107870143-107870165 AAGATTATTTTGTAAATAAAAGG - Intronic
978690493 4:111503892-111503914 ATAATTATGTTGTCAGCAAAGGG - Intergenic
978746775 4:112203743-112203765 ACAATTAGGTTCAAAGTAATAGG - Intergenic
979346758 4:119596302-119596324 AAAATTTATTTCTAAGTAAATGG + Intronic
980212414 4:129806962-129806984 AAAATTCGGTTTTAAATGAATGG - Intergenic
980464795 4:133159435-133159457 AAAAAGAGATTGCAAGTAAAAGG + Intronic
980798327 4:137714390-137714412 AAAATTAACTTGTCAATAAAAGG - Intergenic
981068948 4:140514678-140514700 AAAATTAGGTTGTAATAAAGAGG - Intergenic
981174283 4:141662528-141662550 AAAAACAGGCTGAAAGTAAATGG - Intronic
981333070 4:143535195-143535217 AAAATTGGGATTTAATTAAACGG + Intronic
981357479 4:143806451-143806473 AAATTCAGGTTGAAAGAAAAAGG + Intergenic
981428948 4:144638473-144638495 AGAAATAGGTTAAAAGTAAAAGG + Intergenic
981669541 4:147272164-147272186 ATAATTATGTTGAAAGTAAATGG - Intergenic
981838900 4:149088221-149088243 ATAAATAGGTTGAAAATAAAAGG - Intergenic
982743061 4:159078120-159078142 AAAATTAAATGGAAAGTAAAGGG + Intergenic
982829933 4:160046321-160046343 ATAATAATGTTGAAAGTAAATGG + Intergenic
982888880 4:160821765-160821787 AAAATTAGATTGTAGTTTAAAGG - Intergenic
982950687 4:161691667-161691689 AAATTAAAGATGTAAGTAAATGG - Intronic
982979305 4:162111682-162111704 AAAAAAAGGTTGAAAGAAAAGGG + Intronic
983203988 4:164893671-164893693 AAAAATAGATTGAAAGTCAAAGG - Intronic
984149165 4:176105008-176105030 ACAAATAGATTGAAAGTAAAAGG + Intronic
984301180 4:177919960-177919982 AAATCTATGTTGTAAGTGAAAGG - Intronic
984998041 4:185455117-185455139 AAAGGTAGGTTAAAAGTAAAAGG + Intronic
985087789 4:186331651-186331673 ACAAGCAGGTTGAAAGTAAAAGG - Intergenic
985157584 4:187006861-187006883 AAAATGAGGTTATCAGTCAAAGG + Intergenic
985533851 5:450887-450909 ACAAATAGGTTGAAAGTAAAAGG - Intronic
985798923 5:1989185-1989207 AAAAATAGATTAAAAGTAAAAGG + Intergenic
986064830 5:4224836-4224858 AAATTTAAGTTGGGAGTAAAGGG - Intergenic
986072931 5:4304932-4304954 TAAGTTAGGTTGAATGTAAACGG - Intergenic
986171154 5:5315868-5315890 AAAATTGGGTTTGAAGCAAAGGG + Intronic
986343902 5:6816698-6816720 GCAAATAGGTTGAAAGTAAAAGG - Intergenic
986777380 5:11029148-11029170 AGAAATAGATTGAAAGTAAAAGG - Intronic
987082504 5:14438319-14438341 AACATTAGCAAGTAAGTAAAGGG - Intronic
987126147 5:14814614-14814636 AAAATTAAAATGTAACTAAATGG + Intronic
987138874 5:14925644-14925666 AAATTAAGCTTGAAAGTAAAAGG - Intergenic
987256838 5:16163591-16163613 TCAAATAGGTTGAAAGTAAAAGG + Intronic
987439189 5:17934722-17934744 ACATTTAGGCTGAAAGTAAAGGG + Intergenic
988026804 5:25704932-25704954 ACAAATAGATTGAAAGTAAAAGG - Intergenic
988277240 5:29097619-29097641 ACAATTAGGTTAAAGGTAAAAGG - Intergenic
988650549 5:33144990-33145012 ACAAATAGGTTGAAAGTAAAAGG + Intergenic
988892531 5:35633609-35633631 ATAATTATATTGTAAATAAATGG - Intronic
989436946 5:41425221-41425243 ACAAAAAGGTTGAAAGTAAAGGG - Intronic
989529294 5:42488336-42488358 AAAGTTAACTCGTAAGTAAATGG + Intronic
989628748 5:43459698-43459720 AAAATTAAGTGGTCAATAAAAGG + Intronic
989788039 5:45355164-45355186 AATTTTAGTTTGAAAGTAAAAGG - Intronic
990160447 5:52933342-52933364 AAAATTTGATTTTAAGTAAATGG - Intronic
991140635 5:63237470-63237492 TAAAATAGATTGAAAGTAAAAGG - Intergenic
992060862 5:73045705-73045727 ATAGTTAGGTTGAAAGAAAAAGG - Intronic
992209852 5:74468103-74468125 ATGATTAGGTTGTAATTATAGGG - Intergenic
992376329 5:76191375-76191397 AAAATCAGTTTATAAATAAATGG + Intronic
992570008 5:78045807-78045829 AAAATGAGGGTTTAAGAAAAAGG + Intronic
992816382 5:80443940-80443962 AAAAATAGATTTTAAGGAAAAGG - Intronic
992918715 5:81488877-81488899 TAAATTAGGTTCGAAGTATAAGG + Intronic
993135776 5:83960986-83961008 ACAAATAGGTTAAAAGTAAAAGG + Intronic
993727277 5:91382429-91382451 CATCTTAGGTTGCAAGTAAAAGG + Intronic
994609751 5:102020921-102020943 AAACATAGGTTGAAAATAAAGGG + Intergenic
995150756 5:108841858-108841880 TAAATTATGTTGTAAGTACCTGG + Intronic
995594913 5:113737373-113737395 CAAAATTGGTTGAAAGTAAAGGG + Intergenic
995773102 5:115693745-115693767 ATAAATAGGTTGAAAGTGAAGGG - Intergenic
995840451 5:116438854-116438876 AAAGTTAGTTTGAAAGTAAGAGG - Intergenic
996521343 5:124429425-124429447 AAAATTATCTTGAATGTAAATGG + Intergenic
997576658 5:134983561-134983583 ACAAATAGGTTGAAAGTGAAAGG + Intronic
997994061 5:138571627-138571649 AATAGTAGTTTGAAAGTAAAGGG - Intronic
998281867 5:140817622-140817644 AAAAGTAGGGTACAAGTAAATGG - Intronic
999067604 5:148707008-148707030 ATAAATAGATTGAAAGTAAAAGG + Intergenic
999550254 5:152678701-152678723 TAAATTATGTAGTAAGTTAAAGG - Intergenic
999590988 5:153145609-153145631 AAACATAGGCTGAAAGTAAATGG + Intergenic
999596021 5:153205425-153205447 ACAAGTAGGTTGTTACTAAAGGG - Intergenic
999904643 5:156126358-156126380 AAATTTATGTTGTAAGTAGCTGG - Intronic
1002157265 5:177292943-177292965 AACTTTAGGGTATAAGTAAAAGG + Intronic
1002768980 6:272275-272297 ACAAAAAGGTTGAAAGTAAAAGG - Intergenic
1002911257 6:1492723-1492745 AAAATGAGGTAGAAAATAAAAGG + Intergenic
1004644670 6:17548514-17548536 AGAGTGATGTTGTAAGTAAATGG + Intronic
1005078871 6:21936719-21936741 ATAATTAGGTTATATGTATATGG + Intergenic
1005187408 6:23178614-23178636 AAAATTAATATGTAAGTATAAGG + Intergenic
1005267524 6:24127265-24127287 AAAATTTGGGGGAAAGTAAATGG + Intronic
1005288822 6:24358189-24358211 AAAATTAGGCTGTTTGGAAAGGG - Exonic
1005773718 6:29105609-29105631 GAAAATAAGATGTAAGTAAATGG - Intergenic
1006556194 6:34868976-34868998 CAAACTAGGTGGTGAGTAAATGG - Intronic
1007346122 6:41230276-41230298 AAAATTTGGTAGTGAGGAAAGGG + Intronic
1008015042 6:46509078-46509100 ATAGATAGGTTTTAAGTAAATGG - Intergenic
1008727366 6:54438889-54438911 ATAATAACGTTGAAAGTAAATGG - Intergenic
1008883051 6:56400782-56400804 AAAAATAGGTTGAAAATTAAAGG - Intergenic
1009898067 6:69777611-69777633 AAGATCAGTTTGTCAGTAAATGG - Intronic
1010562786 6:77371221-77371243 ATAAGTAGGTGGTAGGTAAAAGG - Intergenic
1010626804 6:78146646-78146668 AAAATTACTTTGAATGTAAATGG + Intergenic
1010675978 6:78743891-78743913 ACAAATAGCTTGAAAGTAAAGGG - Intergenic
1010720255 6:79275509-79275531 AAAATGACTTTGTAAGTCAATGG + Intergenic
1011845376 6:91556919-91556941 ATAAATAAGTTGAAAGTAAAAGG + Intergenic
1012266814 6:97155040-97155062 ATAAATAGATTGAAAGTAAAAGG - Intronic
1012296002 6:97524873-97524895 AAAATGAGGTTGTCTGTTAAAGG + Intergenic
1012556999 6:100525739-100525761 AAAAATAGGTTCTAGGTATATGG + Intronic
1012559154 6:100557630-100557652 AAAATTAGGTTAAAAGTGAAGGG - Intronic
1012782091 6:103574227-103574249 ATAATTAGGTTGACAGTAAAAGG - Intergenic
1013044338 6:106469504-106469526 GAAATTAAGTTGAAAATAAAAGG - Intergenic
1013498848 6:110727256-110727278 AAAAATAGGTAGTTAGTGAAAGG - Intronic
1013675113 6:112450794-112450816 ACAACTAGGCTGAAAGTAAAAGG - Intergenic
1013678502 6:112494522-112494544 AAACTTAGTTTGCAGGTAAAGGG + Intergenic
1013952131 6:115795808-115795830 GAAATTAGGTTGTATGTTAAAGG - Intergenic
1014201276 6:118611632-118611654 ATAGATAGGTTGTATGTAAAAGG + Intronic
1014229272 6:118884701-118884723 AGAAATGGGTTGAAAGTAAAAGG + Intronic
1014268207 6:119306187-119306209 AAAATTTGTCTGTAAGTAACAGG - Intronic
1014605635 6:123470764-123470786 AAAATAATGTTGTAAAGAAAAGG + Intronic
1014934533 6:127372237-127372259 ACAAATAGATTGAAAGTAAAAGG - Intergenic
1015772849 6:136786711-136786733 AAGAATAGGTTGCAAGTTAAAGG - Intronic
1016161364 6:140884407-140884429 AGAAAGAGGTTGTAAATAAAGGG - Intergenic
1016833829 6:148457186-148457208 AAAATTAAGGTGTAAAAAAAAGG - Intronic
1017040806 6:150307342-150307364 ATTATTATGTTGTAAGTAAGAGG + Intergenic
1017551681 6:155516476-155516498 ATAAGTAGGTTGAAAGTAAATGG - Intergenic
1020378771 7:7518585-7518607 AAAATTAGGCAATAAGTAAGAGG - Intronic
1020771359 7:12399204-12399226 ACAATTAGATTGAAAGTAAAAGG + Intronic
1020773465 7:12424656-12424678 ACAAATAGGTTGAAAGTGAAAGG - Intergenic
1020993733 7:15234900-15234922 AAATTTATGTTGTAAATCAAGGG - Intronic
1021152744 7:17171680-17171702 ATAAATAGGTTAAAAGTAAAAGG + Intergenic
1021198719 7:17701974-17701996 AAAATTAGACTAGAAGTAAATGG + Intergenic
1022386841 7:29908134-29908156 ACAAATAGGTTGAAAGTGAAAGG + Intronic
1022718789 7:32923661-32923683 CCAATTAGGTTGGCAGTAAAAGG + Intergenic
1022825158 7:34002871-34002893 ACAAGTAAGTTGAAAGTAAAAGG - Intronic
1023007924 7:35894198-35894220 AAAATGTGATTTTAAGTAAAGGG - Intronic
1023269130 7:38441046-38441068 ACAAATAGGTTCAAAGTAAAAGG + Intronic
1023509621 7:40937763-40937785 AAAAATAGGCTAAAAGTAAAAGG - Intergenic
1023996974 7:45164940-45164962 ATAATCAGATTGAAAGTAAATGG - Intronic
1024170646 7:46781734-46781756 ACAATTTTGCTGTAAGTAAAGGG - Intergenic
1024298840 7:47869391-47869413 AAAATTAGGTTGTAAGTAAAAGG + Intronic
1024369956 7:48570627-48570649 ACAAATAGTTTGAAAGTAAAAGG - Intronic
1024494284 7:50026003-50026025 AAAAATAGGTTAAAAGTAAAGGG + Intronic
1024601732 7:50988028-50988050 AACATTATATTATAAGTAAAGGG + Intergenic
1024614271 7:51095667-51095689 ATAAATAGGCTGGAAGTAAAAGG + Intronic
1024619940 7:51148579-51148601 AAAATTTGGGAGTAAGTCAAGGG - Intronic
1026021226 7:66707974-66707996 ACAAATAGGTTGAAAGTAAAAGG - Intronic
1026105487 7:67417620-67417642 AAACTCACGTTGCAAGTAAAAGG - Intergenic
1026248576 7:68646326-68646348 AAAATAATGATGTATGTAAAAGG + Intergenic
1026292604 7:69021659-69021681 TAAAATAAGTTTTAAGTAAATGG - Intergenic
1026351749 7:69522616-69522638 GCAAGTAGGTTGAAAGTAAAAGG - Intergenic
1027299928 7:76821470-76821492 AAAATTAGGAGGAAGGTAAAAGG + Intergenic
1027484267 7:78740359-78740381 CAAAGTAGGTTATCAGTAAATGG + Intronic
1028294329 7:89108800-89108822 AAAAATAAGTGGTAAGCAAAAGG + Intronic
1028481223 7:91307748-91307770 ACAAATAGGTTGAAATTAAAAGG + Intergenic
1029038132 7:97543786-97543808 ATGATTAGGTTGAAAGTAAAAGG + Intergenic
1030878488 7:114846309-114846331 AAAATTGTGATGTAAGTGAATGG + Intergenic
1030937660 7:115605473-115605495 ACAATTAAGTTGAAAGTAAAAGG - Intergenic
1031271889 7:119661144-119661166 CAAATGAGGGTGAAAGTAAAAGG - Intergenic
1031496728 7:122458430-122458452 AAAATTAGAGGGGAAGTAAAAGG - Intronic
1032605893 7:133352506-133352528 ACAAATAGGCTGAAAGTAAAAGG - Intronic
1032855285 7:135828796-135828818 CCAATTAGGTTGGAAGTAAATGG - Intergenic
1032952014 7:136925434-136925456 ACAATTAAGTGGTAAGTAAAAGG + Intronic
1033796105 7:144847428-144847450 AAAGATAGGTTAAAAGTAAATGG - Intergenic
1033876713 7:145828834-145828856 TAAAATAGGTTAGAAGTAAAAGG + Intergenic
1035597920 8:875107-875129 ACAAATAGATTGAAAGTAAAAGG - Intergenic
1036280749 8:7399008-7399030 AAAGATAGGTTGATAGTAAAGGG - Intergenic
1036340716 8:7912564-7912586 AAAGATAGGTTGATAGTAAAGGG + Intergenic
1037017806 8:13930352-13930374 TAAAATAGGTTGTTATTAAAAGG + Intergenic
1038129131 8:24709571-24709593 AAAATAAAGTTGTAAGGAACTGG + Intergenic
1038158263 8:25011661-25011683 AAAATTAGATTGTAACACAAAGG - Intergenic
1039098553 8:33914470-33914492 CACATCAGGTTGTAAATAAAAGG - Intergenic
1039139168 8:34365303-34365325 ACAAATAGATTGAAAGTAAAAGG - Intergenic
1039362322 8:36890917-36890939 AAAAATAGGTTGAAAGTAAAAGG - Intronic
1039388071 8:37153904-37153926 AAAATTAGGTATGATGTAAAGGG + Intergenic
1039523053 8:38188371-38188393 ACAAATAGTTTGAAAGTAAATGG + Intronic
1040031233 8:42825692-42825714 AAAAATAGGTTGAAAGCTAAAGG - Intergenic
1040966372 8:53084977-53084999 AAAATTAGGTTCAAAGCATAAGG + Intergenic
1041113807 8:54514213-54514235 AAAAGGAGGTTGAACGTAAAAGG + Intergenic
1041425091 8:57711883-57711905 AAAATTAGGGTATGAGTAGAAGG - Intergenic
1042128835 8:65566263-65566285 AAAATTATTTTGTAAAGAAAGGG - Intergenic
1043282415 8:78484637-78484659 AAAAGATGGTTGTAAGAAAAAGG - Intergenic
1043589037 8:81806609-81806631 AAAGTTAGGATGAAAGGAAAAGG + Intronic
1043735442 8:83736076-83736098 AATATAATGTTGTAAGTATATGG + Intergenic
1043781507 8:84341567-84341589 TAAATTAGTTTGTAAACAAATGG - Intronic
1044080440 8:87875639-87875661 AAATTTAAGTTGAAAGTAAAAGG - Intergenic
1044372969 8:91435451-91435473 AAAATTAGCTGGAAATTAAATGG + Intergenic
1044378866 8:91508555-91508577 ACACATAGGTTGAAAGTAAAAGG - Intergenic
1046095178 8:109549918-109549940 ACAAATAGGTTAAAAGTAAAAGG - Intronic
1046449160 8:114365314-114365336 AAAATAACGTTGAATGTAAATGG + Intergenic
1046579078 8:116069178-116069200 AATATTTGGTGGTAAGTTAATGG - Intergenic
1046841745 8:118866242-118866264 AAAAGTATGTTGTTATTAAATGG - Intergenic
1046911901 8:119637632-119637654 AAAATTACATTTTAAGTAATGGG - Intronic
1047028027 8:120845781-120845803 AAAAGTAGGTGGTAAGTACAAGG + Intergenic
1047048259 8:121079313-121079335 AAAGTTAGGGTGGTAGTAAATGG - Intergenic
1047265734 8:123306710-123306732 ACAAATAGGTTGAAAGTGAAAGG - Intergenic
1047599332 8:126410565-126410587 AAAATGTGTTTGTAGGTAAAAGG + Intergenic
1047650731 8:126917206-126917228 GAAATGAGGTTTTATGTAAAGGG - Intergenic
1047855840 8:128911373-128911395 ACAAATAGGTTGAAAGTGAAAGG + Intergenic
1048150343 8:131887641-131887663 AGACTTAGGGTGTATGTAAAAGG - Intergenic
1048388723 8:133939325-133939347 ACAAATAGGTTAAAAGTAAAAGG + Intergenic
1048479729 8:134777799-134777821 ACAATTAGGCTATAAGGAAAAGG + Intergenic
1049986035 9:952422-952444 AAAATTACGGTGTAATCAAAAGG + Intronic
1050012369 9:1197944-1197966 AAAATTAAGTTGTAACTGGAAGG - Intergenic
1050040259 9:1484274-1484296 ATAATTATGTTGAATGTAAATGG - Intergenic
1050171738 9:2826703-2826725 AAAATTAGCTTGGCATTAAAAGG - Intronic
1050723737 9:8621804-8621826 AAAATTTGAGTGTAAATAAAAGG + Intronic
1050910223 9:11059005-11059027 AAAATTCGAAAGTAAGTAAACGG - Intergenic
1051510413 9:17871298-17871320 ACAAATAGGTTAAAAGTAAAAGG - Intergenic
1051546658 9:18283300-18283322 AAAGATAGGTTTAAAGTAAAAGG - Intergenic
1051550350 9:18321087-18321109 ACAAGTAAGTTTTAAGTAAAAGG + Intergenic
1051697188 9:19781155-19781177 AAAAGAAGGTTGAAAATAAAAGG + Intronic
1051842718 9:21416408-21416430 AAATTTAGTTTGTTGGTAAAGGG - Intronic
1051924027 9:22301263-22301285 AAAATTTTGTTTTAAGGAAATGG + Intergenic
1052541971 9:29823263-29823285 ACAAAGAGGTTGAAAGTAAACGG + Intergenic
1052615399 9:30833004-30833026 AAAATGAGGTGGTAGGAAAATGG - Intergenic
1052623716 9:30946741-30946763 ACAAATAGGTTAAAAGTAAAAGG - Intergenic
1054714534 9:68544003-68544025 AAAATTAGGTTGAAAAGATAGGG + Intergenic
1055223010 9:73960876-73960898 AAAATACATTTGTAAGTAAAAGG + Intergenic
1055407623 9:75991187-75991209 AGAATTACGTTACAAGTAAATGG - Intronic
1055493872 9:76834844-76834866 AAAATAAGTTTGTAACTAAATGG - Intronic
1056063553 9:82909955-82909977 AACATTATGTGGTAAATAAAGGG - Intergenic
1056146453 9:83735641-83735663 ACAGATAGGTTGAAAGTAAAAGG - Intergenic
1056378003 9:86033175-86033197 AAAATTATATTGTAATTAATGGG - Intronic
1056482842 9:87023327-87023349 AAAATAAGGAAGTAACTAAATGG + Intergenic
1056641853 9:88378343-88378365 ACAATAAGGGTGTAAGTAAAAGG + Intergenic
1056861421 9:90187438-90187460 ACAAATAGGTTGAAAGAAAATGG - Intergenic
1057295593 9:93836199-93836221 ACAAATAGGTTGAAAGTGAAAGG - Intergenic
1057373929 9:94500975-94500997 ACAAATAGGTGGAAAGTAAAAGG - Intergenic
1058657280 9:107234868-107234890 AAAATGAAGTTGTAATTAGATGG + Intergenic
1059370450 9:113827730-113827752 ACAGATAGGTTGAAAGTAAAAGG + Intergenic
1059815835 9:117912885-117912907 ACAAATAAGTTGAAAGTAAAAGG + Intergenic
1059856383 9:118402422-118402444 AAAATTATATTGTAAATTAAAGG + Intergenic
1060753105 9:126187443-126187465 AAAATTAAGTGATAAGTATATGG + Intergenic
1060867496 9:127011766-127011788 AAAATTGGTTTGTATGTAACAGG + Intronic
1061834911 9:133322520-133322542 AAAATTAGGATGGCAGAAAAGGG - Intergenic
1061942231 9:133890010-133890032 AAAATTAGCTAGTAACTAACAGG + Intronic
1062604188 9:137337028-137337050 AAAAGAAGGTTGAAAGTAAAAGG + Intronic
1062719635 9:138031866-138031888 ATAGTTAGGTTGAAAGCAAAAGG - Intronic
1203521261 Un_GL000213v1:47743-47765 ATAATTATCTTGTATGTAAATGG - Intergenic
1186408317 X:9323333-9323355 AAACTTAGGTTGAAAGCAGAAGG + Intergenic
1187284312 X:17888914-17888936 ATAGGTAGGTTGAAAGTAAAAGG + Intergenic
1187486071 X:19705574-19705596 AAAATTCGGAAGTAGGTAAAAGG + Intronic
1187595617 X:20769133-20769155 AAACATAGGTTAAAAGTAAAAGG + Intergenic
1187640181 X:21279001-21279023 AAACATAGGTTCAAAGTAAAAGG + Intergenic
1188659750 X:32744124-32744146 AGAAATAGCTTGTAAGTAGAGGG - Intronic
1188928294 X:36073108-36073130 AAAATTAGTTTGTTAAAAAAGGG - Intronic
1188935002 X:36164519-36164541 AAAAATAGATTGAAAGTAAAAGG - Intergenic
1189715069 X:43856937-43856959 AAAATTAAATTGTAGTTAAATGG - Intronic
1189824336 X:44901855-44901877 AAAAATAGGTTGAAACTAAAAGG - Intronic
1189960289 X:46318007-46318029 AAAAAAAGGTTGGAAGTGAAGGG + Intergenic
1189963378 X:46346951-46346973 AAAATGATTTTGTAATTAAAGGG + Intergenic
1190616120 X:52234294-52234316 AGACTTAGGTTAAAAGTAAAGGG - Intergenic
1191023795 X:55891526-55891548 ATAGGTAGGTTGAAAGTAAAAGG - Intergenic
1191632862 X:63341520-63341542 ATAAATAGGTTGGAAGTAATAGG + Intergenic
1191712532 X:64165705-64165727 ACAAATAGGTTGAAAGTAAAAGG - Intergenic
1191803723 X:65110127-65110149 CAAATTAGAAAGTAAGTAAAAGG - Intergenic
1192187244 X:68957080-68957102 ACAGATAGGTTGAAAGTAAAAGG + Intergenic
1192456008 X:71276457-71276479 AAAAAAAGGATCTAAGTAAAAGG - Intergenic
1192540272 X:71963570-71963592 ACAAATAGATTGAAAGTAAAAGG + Intergenic
1192593072 X:72377671-72377693 ACACGTAGGTTGGAAGTAAAAGG - Intronic
1192869008 X:75168325-75168347 AAAATAAGGTTGTAAAAAGATGG + Intergenic
1192918050 X:75675009-75675031 ACAAATAGGTTGAAAGTAAAAGG + Intergenic
1192984955 X:76387962-76387984 AAAAATAGGTTGCAAGTAAAAGG - Intergenic
1193326543 X:80184517-80184539 AAACTTAGGTTGAAAGTAAAAGG - Intergenic
1194314343 X:92356444-92356466 TAAATTATGTTGTAAATATAGGG - Intronic
1194336438 X:92652828-92652850 AAATTTAGGTAGAAATTAAAAGG + Intergenic
1194376520 X:93140655-93140677 AAAACTAGGTTGAAAGTAAAAGG - Intergenic
1194697453 X:97072024-97072046 AAAACAGGGTTGTAAGTAATGGG - Intronic
1194729590 X:97438293-97438315 AAAATTACATTGAAAGTACATGG - Intronic
1194889384 X:99358722-99358744 ATAATTAGGATAAAAGTAAAAGG - Intergenic
1194931142 X:99888498-99888520 AACATTAGCATGTAAATAAATGG + Intergenic
1195020713 X:100824470-100824492 AAAGTTAGCTTATAAGAAAAGGG - Intronic
1195274307 X:103266152-103266174 ACAAGTAGGTTGAAAATAAAAGG - Intergenic
1195620367 X:106947630-106947652 ACAGATAGGTTGGAAGTAAAAGG + Intronic
1196968323 X:121082751-121082773 AAAATTGGCTTACAAGTAAAAGG - Intergenic
1197038978 X:121911517-121911539 AAAAATAGATTGAAATTAAAAGG - Intergenic
1197930343 X:131688256-131688278 CCAAATAGGTTGAAAGTAAAAGG - Intergenic
1198418638 X:136446683-136446705 AATATTAGGAAGTAAGTATAAGG + Intergenic
1198490940 X:137140847-137140869 AAAATTATTTTTAAAGTAAATGG - Intergenic
1198699194 X:139378985-139379007 ATAAATAAGTTGCAAGTAAAAGG - Intergenic
1199116044 X:143993732-143993754 ATCATTATGTTGTAAGAAAATGG + Intergenic
1199324417 X:146479980-146480002 AGAAATAGGTTCAAAGTAAAAGG - Intergenic
1199740080 X:150726983-150727005 TTAATGAGGTTTTAAGTAAAGGG - Intronic
1199926039 X:152465267-152465289 ACAGGTAGGTTGGAAGTAAAAGG + Intergenic
1200396553 X:155993074-155993096 ACAAATAGGATGAAAGTAAAAGG + Intergenic
1200622405 Y:5467974-5467996 TAAATTATGTTGTAAATATAGGG - Intronic