ID: 1024298931

View in Genome Browser
Species Human (GRCh38)
Location 7:47870805-47870827
Sequence CTAATTTCATCATGTTGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7609
Summary {0: 1, 1: 4, 2: 37, 3: 547, 4: 7020}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024298931_1024298942 27 Left 1024298931 7:47870805-47870827 CCTGGGCAACATGATGAAATTAG 0: 1
1: 4
2: 37
3: 547
4: 7020
Right 1024298942 7:47870855-47870877 CCCAGCTACTTGGGAGGCGGAGG 0: 388
1: 92154
2: 204481
3: 251399
4: 391713
1024298931_1024298940 24 Left 1024298931 7:47870805-47870827 CCTGGGCAACATGATGAAATTAG 0: 1
1: 4
2: 37
3: 547
4: 7020
Right 1024298940 7:47870852-47870874 AATCCCAGCTACTTGGGAGGCGG 0: 374
1: 1004
2: 1942
3: 6302
4: 6082
1024298931_1024298934 -10 Left 1024298931 7:47870805-47870827 CCTGGGCAACATGATGAAATTAG 0: 1
1: 4
2: 37
3: 547
4: 7020
Right 1024298934 7:47870818-47870840 ATGAAATTAGCCAGGCATGGTGG 0: 15
1: 665
2: 20835
3: 81074
4: 155283
1024298931_1024298937 18 Left 1024298931 7:47870805-47870827 CCTGGGCAACATGATGAAATTAG 0: 1
1: 4
2: 37
3: 547
4: 7020
Right 1024298937 7:47870846-47870868 GCCTATAATCCCAGCTACTTGGG 0: 3416
1: 50029
2: 178371
3: 285916
4: 461982
1024298931_1024298939 21 Left 1024298931 7:47870805-47870827 CCTGGGCAACATGATGAAATTAG 0: 1
1: 4
2: 37
3: 547
4: 7020
Right 1024298939 7:47870849-47870871 TATAATCCCAGCTACTTGGGAGG 0: 4322
1: 61486
2: 159594
3: 280996
4: 549049
1024298931_1024298936 17 Left 1024298931 7:47870805-47870827 CCTGGGCAACATGATGAAATTAG 0: 1
1: 4
2: 37
3: 547
4: 7020
Right 1024298936 7:47870845-47870867 TGCCTATAATCCCAGCTACTTGG 0: 4701
1: 62037
2: 110139
3: 168034
4: 247405
1024298931_1024298944 30 Left 1024298931 7:47870805-47870827 CCTGGGCAACATGATGAAATTAG 0: 1
1: 4
2: 37
3: 547
4: 7020
Right 1024298944 7:47870858-47870880 AGCTACTTGGGAGGCGGAGGTGG 0: 71
1: 13183
2: 28631
3: 47579
4: 211466

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024298931 Original CRISPR CTAATTTCATCATGTTGCCC AGG (reversed) Intronic
Too many off-targets to display for this crispr