ID: 1024298939

View in Genome Browser
Species Human (GRCh38)
Location 7:47870849-47870871
Sequence TATAATCCCAGCTACTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1055447
Summary {0: 4322, 1: 61486, 2: 159594, 3: 280996, 4: 549049}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024298931_1024298939 21 Left 1024298931 7:47870805-47870827 CCTGGGCAACATGATGAAATTAG 0: 1
1: 4
2: 37
3: 547
4: 7020
Right 1024298939 7:47870849-47870871 TATAATCCCAGCTACTTGGGAGG 0: 4322
1: 61486
2: 159594
3: 280996
4: 549049
1024298930_1024298939 25 Left 1024298930 7:47870801-47870823 CCAGCCTGGGCAACATGATGAAA 0: 825
1: 17240
2: 126298
3: 210528
4: 267266
Right 1024298939 7:47870849-47870871 TATAATCCCAGCTACTTGGGAGG 0: 4322
1: 61486
2: 159594
3: 280996
4: 549049
1024298935_1024298939 -2 Left 1024298935 7:47870828-47870850 CCAGGCATGGTGGCATGTGCCTA 0: 248
1: 3128
2: 13570
3: 41847
4: 90675
Right 1024298939 7:47870849-47870871 TATAATCCCAGCTACTTGGGAGG 0: 4322
1: 61486
2: 159594
3: 280996
4: 549049

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024298939 Original CRISPR TATAATCCCAGCTACTTGGG AGG Intronic
Too many off-targets to display for this crispr