ID: 1024298942

View in Genome Browser
Species Human (GRCh38)
Location 7:47870855-47870877
Sequence CCCAGCTACTTGGGAGGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 940135
Summary {0: 388, 1: 92154, 2: 204481, 3: 251399, 4: 391713}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024298931_1024298942 27 Left 1024298931 7:47870805-47870827 CCTGGGCAACATGATGAAATTAG 0: 1
1: 4
2: 37
3: 547
4: 7020
Right 1024298942 7:47870855-47870877 CCCAGCTACTTGGGAGGCGGAGG 0: 388
1: 92154
2: 204481
3: 251399
4: 391713
1024298935_1024298942 4 Left 1024298935 7:47870828-47870850 CCAGGCATGGTGGCATGTGCCTA 0: 248
1: 3128
2: 13570
3: 41847
4: 90675
Right 1024298942 7:47870855-47870877 CCCAGCTACTTGGGAGGCGGAGG 0: 388
1: 92154
2: 204481
3: 251399
4: 391713

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024298942 Original CRISPR CCCAGCTACTTGGGAGGCGG AGG Intronic
Too many off-targets to display for this crispr