ID: 1024298944

View in Genome Browser
Species Human (GRCh38)
Location 7:47870858-47870880
Sequence AGCTACTTGGGAGGCGGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300930
Summary {0: 71, 1: 13183, 2: 28631, 3: 47579, 4: 211466}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024298935_1024298944 7 Left 1024298935 7:47870828-47870850 CCAGGCATGGTGGCATGTGCCTA 0: 248
1: 3128
2: 13570
3: 41847
4: 90675
Right 1024298944 7:47870858-47870880 AGCTACTTGGGAGGCGGAGGTGG 0: 71
1: 13183
2: 28631
3: 47579
4: 211466
1024298931_1024298944 30 Left 1024298931 7:47870805-47870827 CCTGGGCAACATGATGAAATTAG 0: 1
1: 4
2: 37
3: 547
4: 7020
Right 1024298944 7:47870858-47870880 AGCTACTTGGGAGGCGGAGGTGG 0: 71
1: 13183
2: 28631
3: 47579
4: 211466

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024298944 Original CRISPR AGCTACTTGGGAGGCGGAGG TGG Intronic
Too many off-targets to display for this crispr