ID: 1024300650

View in Genome Browser
Species Human (GRCh38)
Location 7:47885088-47885110
Sequence CTCTGGGAAAGGAGGGCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 535
Summary {0: 1, 1: 0, 2: 1, 3: 64, 4: 469}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024300650_1024300664 24 Left 1024300650 7:47885088-47885110 CCCTCAGCCCTCCTTTCCCAGAG 0: 1
1: 0
2: 1
3: 64
4: 469
Right 1024300664 7:47885135-47885157 CCAGCCAGCCAGCCAAGTCTGGG No data
1024300650_1024300662 23 Left 1024300650 7:47885088-47885110 CCCTCAGCCCTCCTTTCCCAGAG 0: 1
1: 0
2: 1
3: 64
4: 469
Right 1024300662 7:47885134-47885156 TCCAGCCAGCCAGCCAAGTCTGG 0: 1
1: 0
2: 78
3: 90
4: 331
1024300650_1024300659 -4 Left 1024300650 7:47885088-47885110 CCCTCAGCCCTCCTTTCCCAGAG 0: 1
1: 0
2: 1
3: 64
4: 469
Right 1024300659 7:47885107-47885129 AGAGGCAGAGGAGCTCACAGCGG No data
1024300650_1024300665 27 Left 1024300650 7:47885088-47885110 CCCTCAGCCCTCCTTTCCCAGAG 0: 1
1: 0
2: 1
3: 64
4: 469
Right 1024300665 7:47885138-47885160 GCCAGCCAGCCAAGTCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024300650 Original CRISPR CTCTGGGAAAGGAGGGCTGA GGG (reversed) Intronic
900095017 1:936671-936693 CTCTTGGGAAGGAGGGGTGGGGG + Intronic
900265621 1:1755717-1755739 CCCTGGGCACGGAGGGCTGGGGG + Intronic
900672988 1:3867441-3867463 TTTTGGGAAAGGAGGGCTTGAGG + Intronic
900964541 1:5948629-5948651 CTCTGGGAAAGGGGGGCTCTGGG - Intronic
901286228 1:8081052-8081074 CTCTGAGAAGAAAGGGCTGATGG + Intergenic
901606511 1:10463383-10463405 CTCTGAGAATTCAGGGCTGATGG - Intronic
901642252 1:10698690-10698712 CCCTGGCAGGGGAGGGCTGAGGG + Intronic
902375370 1:16027800-16027822 CTCTGGGGAAGGAGGGCAGTGGG - Exonic
902380334 1:16049597-16049619 CTCTGGGGAAGGAGGGCAGTGGG - Exonic
902777675 1:18685004-18685026 CTCTGGCAAAAGAGGGAGGAGGG + Intronic
902834467 1:19037758-19037780 CTCTTTGAATGGAGGGCTGGAGG - Intergenic
903213987 1:21833137-21833159 TTCTGGAGAGGGAGGGCTGAGGG + Intronic
903366209 1:22806900-22806922 CTCTGGGGAAGTAGGGCTGGGGG - Intronic
903680503 1:25093277-25093299 CTCTGGGACTGGTGGGCTGGGGG - Intergenic
903799074 1:25953232-25953254 GTCTGGGGAACGAGGGCTGATGG + Intergenic
904354927 1:29932843-29932865 CTCTGGGAAGGGAGGCTTGGTGG - Intergenic
905592170 1:39173604-39173626 CTCTGGGCAGGGAGGGAAGAGGG + Intronic
905878236 1:41447188-41447210 TTCTGGGGAAGGAGAGCAGAAGG - Intergenic
906101608 1:43267476-43267498 CTCTGAGGAAGGCGGGCTGCTGG + Intronic
906287750 1:44598611-44598633 CTCTGGGATAGGGGAGCTGCTGG + Intronic
906886151 1:49650996-49651018 CTCTGTGTACGGAGGGCAGATGG - Intronic
907040761 1:51257149-51257171 ATCTGGGACAGGATGGCTGGAGG + Intronic
907495732 1:54843097-54843119 CCCTGGGGAAGGAGGGCACAGGG - Intergenic
908062449 1:60366764-60366786 TTCTGGGAGAGGAGGGAAGAGGG + Intergenic
908163227 1:61432357-61432379 TTCTTGGAAATGAGGGGTGAAGG - Intronic
908389090 1:63669349-63669371 CTGTGGGAATAGAGGGATGAAGG + Intergenic
910993574 1:93079904-93079926 CGTTGGGAAATGGGGGCTGAGGG + Intronic
911070103 1:93825635-93825657 CCCTGGGGAAGGAGGGTGGAAGG - Intronic
912473717 1:109923086-109923108 CTCTGGGAAAGCTGTGCTGGAGG + Intronic
912940870 1:114043394-114043416 CTCTGGGAAAGCAGTGTTAAAGG + Intergenic
912993061 1:114508731-114508753 CTATGGGAATGGAGGGATGGGGG - Intronic
913186486 1:116373956-116373978 CTCAGGGCACGGAGGGCGGAGGG - Exonic
913237588 1:116798130-116798152 ATGTGGGAAAAGAGGGCTGTAGG + Intergenic
915311175 1:155006513-155006535 CCCAGGCAAAAGAGGGCTGATGG + Intronic
915430210 1:155860296-155860318 CTCTGGGGAAAGAGGGGTGCGGG + Intronic
915473955 1:156141507-156141529 CTCTTGAGGAGGAGGGCTGAGGG + Intergenic
915660480 1:157401014-157401036 CCCTGGGAAGGGAGGGCAGTTGG + Intergenic
916027117 1:160842600-160842622 CTCTGTGAGAGGATGGTTGAGGG - Intronic
916080576 1:161229482-161229504 GGCTGGGAAAGTAGGGCTGAAGG + Exonic
916764097 1:167843687-167843709 CTGTGGGAAAGGATGTGTGAGGG - Intronic
917672073 1:177282221-177282243 CTGTTGGAAAGGAGCTCTGAAGG - Exonic
918438510 1:184541985-184542007 TTCTGGGAAAGGAAGGGCGAAGG + Intronic
918632525 1:186735095-186735117 CTCTGGGAAAGGGAGGCCCAAGG + Intergenic
919674864 1:200371279-200371301 CTCTGGGAAGTGAGGACAGAAGG + Intergenic
920300031 1:204982934-204982956 CTCTGGGAAAGTGGGGCCCAGGG - Intronic
920446731 1:206023639-206023661 CTCTGGGGTAGGAAAGCTGATGG - Intronic
920502024 1:206491488-206491510 CTCTGGGAAAGGAGGAAGGACGG - Exonic
921217596 1:212950821-212950843 CTCGGGGAAAAGGGGGCGGATGG + Intronic
921248775 1:213276798-213276820 CACTGGAAAAGGAGAGTTGAAGG + Intergenic
921446029 1:215248464-215248486 CCCTGTGAAAGGAGGGAGGAAGG + Intergenic
922222381 1:223618562-223618584 CTCTGGGACAGAGTGGCTGATGG - Intronic
923454427 1:234151016-234151038 CTCAGGGCAAGAAGGACTGAAGG + Intronic
923570042 1:235105265-235105287 CTGTGGGAGAGGAAGGCTGTGGG + Intergenic
1062855331 10:777311-777333 CGCTGGGGAAGGAGGCCTGTGGG - Intergenic
1063301312 10:4851358-4851380 CTCTGGGCAGAGAGGGCTAATGG + Intergenic
1064789285 10:18937696-18937718 CTCTTGTAAGGGAGGGCTGGTGG + Intergenic
1067340713 10:45401007-45401029 CTCTGGAAATGGGTGGCTGATGG + Intronic
1067830564 10:49609346-49609368 CTCTGGAAAATGAGGGATGGGGG + Intronic
1068100545 10:52547207-52547229 CCATGGGTATGGAGGGCTGACGG - Intergenic
1068897610 10:62224802-62224824 ATCTGCAAAGGGAGGGCTGAAGG + Intronic
1069058289 10:63867241-63867263 CTCTGGAAAAGGATCTCTGATGG + Intergenic
1069871567 10:71536215-71536237 CTCTGTGGAAGGAGGGCTCGAGG + Intronic
1070118621 10:73553517-73553539 CTCTGGGAAAGGTGGGAGGAGGG - Intronic
1070558304 10:77546709-77546731 AGATGGGAAAGGAGGCCTGAAGG - Intronic
1070587472 10:77777445-77777467 GGCTGGGGAAGGAGGGCTGGTGG - Intergenic
1070782563 10:79146184-79146206 CTCTAGGGGAGGAAGGCTGAGGG - Intronic
1070782672 10:79146669-79146691 CTCTGGGTGGGGAGGGCGGAAGG + Intronic
1071529029 10:86375074-86375096 ATGTGGGAATGGAGGGCAGAGGG - Intergenic
1071602787 10:86967002-86967024 CTCTGGGAGAGGAGGGGCGGGGG + Intronic
1071820349 10:89273515-89273537 CTCTGAGAAAACAGAGCTGATGG + Intronic
1072412204 10:95213301-95213323 CTCTGAGAAATGAGTGCTGGCGG - Intronic
1072474819 10:95750209-95750231 CTGTGGGAAAGGAGCGGGGATGG + Intronic
1073042556 10:100617511-100617533 CTCTGGGAAGGGAGTGGAGATGG + Intergenic
1073253268 10:102134653-102134675 CTCTGAGAAAGTAGGGGAGAAGG - Intronic
1073974409 10:109085182-109085204 CTCTGGAAAAAAAGGGGTGAAGG - Intergenic
1074610166 10:115014291-115014313 CTATGGGAGAAAAGGGCTGACGG - Intergenic
1075437290 10:122454532-122454554 CTCTGGCAGAGCAGGACTGAGGG + Intergenic
1075739511 10:124685768-124685790 CCATGGGAAAGGAAGGCAGATGG - Intronic
1075791019 10:125084519-125084541 CTCTGGGAAGGGAGGGCGTGAGG + Intronic
1075961053 10:126567988-126568010 CTCTGGGAAAGGAGAGGAAATGG + Intronic
1076772667 10:132675055-132675077 CTTTGGGTATGGAGGACTGAGGG - Intronic
1077029008 11:455257-455279 CTCTAAGAAAAGAGGGGTGAAGG - Intronic
1077036407 11:497004-497026 TACTGGGAAAGGCGGGCTGGCGG - Intronic
1077340938 11:2026014-2026036 TTCTGGGAAGCGTGGGCTGAGGG + Intergenic
1077431252 11:2517040-2517062 CTCCTGGAAAGGAGGGATCAGGG + Intronic
1077469908 11:2752636-2752658 CCCTTGGAAAGGAGGCCTGAGGG - Intronic
1077581275 11:3418802-3418824 CACTTGGAACGGAGGGCAGAGGG + Intergenic
1077722496 11:4642608-4642630 CTCTGGGAAAGCAAGGGTGGAGG + Intergenic
1078579320 11:12526348-12526370 CACTGGGAAAGAAGGGGTGGGGG - Intronic
1079525955 11:21388109-21388131 CTCTGTAGAAGGAAGGCTGAAGG - Intronic
1080568215 11:33531848-33531870 TTCTGGGAACGGAAGCCTGACGG + Intergenic
1080883110 11:36341054-36341076 CTCCGGGAAAGGCAGGCAGATGG + Intronic
1080975583 11:37335933-37335955 CTAAAGGAAAGGAGAGCTGAAGG - Intergenic
1081535027 11:43990034-43990056 CTCTGGGAAGGGAGGAGTAAGGG - Intergenic
1081650767 11:44822701-44822723 CTTTGGGGAAGGACAGCTGAAGG - Intronic
1081673791 11:44956677-44956699 CTCTGGGAAAGGAAGTCACAGGG + Intergenic
1082954808 11:58858516-58858538 CTCTGGGCAATGTGAGCTGATGG + Intronic
1083228748 11:61301692-61301714 CTCTAGCCAAGGAGGGCTGATGG - Intronic
1083290035 11:61684723-61684745 CTGTGGGAAGTGAGGGCGGAGGG + Intronic
1083600460 11:63944317-63944339 CTCAGGGAAAGGAGGGGTGTTGG + Intronic
1083989532 11:66238352-66238374 CTCTGGGGATAAAGGGCTGAAGG - Intronic
1084238197 11:67801640-67801662 CACTTGGAAAGGAGGGCAGAGGG + Intergenic
1084834213 11:71791194-71791216 CACTTGGAAAGGAGGGCAGAGGG - Intronic
1085049998 11:73375534-73375556 TCCTGGGACAGTAGGGCTGATGG - Intergenic
1085326305 11:75609344-75609366 CTGTGGGAAAGGAGGAGTTAGGG + Intronic
1085468830 11:76743773-76743795 CTCTAGGATAGGTGGGCTCAGGG - Intergenic
1085829726 11:79886511-79886533 CTCTGGGGAAGGGGGCCTGAGGG + Intergenic
1086085980 11:82955977-82955999 CTGGGGGAAAGGATGGCTGTGGG - Intronic
1087240743 11:95774738-95774760 CTCTCAGAACAGAGGGCTGATGG + Intronic
1087795957 11:102454726-102454748 CCCTTGTAAAGGAGGCCTGAGGG + Intronic
1089432524 11:118436176-118436198 CTCGGGAAAAGGAGGGGGGAAGG - Intergenic
1089564483 11:119363718-119363740 CCCTGGGAAAGGAGGGGTGGGGG + Intronic
1090671003 11:128945307-128945329 CTCTGGGGCAGGTGGGCTGTGGG - Intergenic
1202823923 11_KI270721v1_random:81203-81225 TTCTGGGAAGCGTGGGCTGAGGG + Intergenic
1091697587 12:2638400-2638422 AGCTGGGAAAGGAGAGGTGAGGG + Intronic
1091787205 12:3250394-3250416 TTCTGGAAAAACAGGGCTGATGG - Intronic
1091796911 12:3302756-3302778 CTGTGGATATGGAGGGCTGATGG + Intergenic
1092180650 12:6444586-6444608 GTCTGTGAAAGGAGGGATGCAGG + Intergenic
1092743010 12:11648902-11648924 CTCCGGGAAGGGAAGGCTGCAGG - Intergenic
1094210442 12:27884820-27884842 CTCTGGGGATGGAGGGCACAAGG + Intergenic
1096154503 12:49334484-49334506 CTCTAGAAGAGGGGGGCTGAAGG - Intronic
1096257726 12:50073311-50073333 CAGTGGGAAAGGGAGGCTGATGG - Intronic
1096845226 12:54402966-54402988 GTTTGGGTAAGTAGGGCTGACGG - Exonic
1097825500 12:64171405-64171427 CACTGGGGATGGAGAGCTGATGG + Intergenic
1098776147 12:74620259-74620281 TTGTGGGGAAGGAGGGATGAGGG - Intergenic
1099673052 12:85718987-85719009 CACTGGGAAAGAAGAACTGAAGG - Intergenic
1100529857 12:95453105-95453127 CTCTGGGAGAAAAGGGTTGAGGG + Intergenic
1101134921 12:101733084-101733106 CTCTGGGAAAATATGACTGATGG - Intronic
1102446827 12:113009485-113009507 CACTGGGAGAGGAGGGCTAGTGG - Intronic
1102609346 12:114097718-114097740 CTCCAGGAAAGCAGAGCTGATGG + Intergenic
1102807141 12:115791989-115792011 CCACAGGAAAGGAGGGCTGAAGG + Intergenic
1103251774 12:119506139-119506161 CTCTGGGTAAGAAGGGCAGAAGG - Intronic
1104858043 12:131910983-131911005 CTCTGGGACCTGAGGGCTGTGGG - Intronic
1104902677 12:132197763-132197785 CTCTGGGGAAGGGGGGCCGTGGG - Intronic
1105767321 13:23574734-23574756 CTCTGTGATGGGAGGGCAGAGGG + Intronic
1105825986 13:24123961-24123983 CCATGGGAAAGGAAGGCTCAGGG + Intronic
1106150868 13:27100477-27100499 CTCAGAGAGAGGAGGGTTGAGGG - Intronic
1106459588 13:29957239-29957261 CGCTGAGACAGGGGGGCTGAAGG + Intergenic
1107314609 13:39118137-39118159 CTCTCGCAAAGCAGGGCTGGTGG + Intergenic
1109902605 13:68794060-68794082 CTCTTGTAAAGCAGGGCTGGTGG + Intergenic
1110249645 13:73367014-73367036 CTCTGGGAATGGAAGGTTAAGGG + Intergenic
1110538830 13:76684710-76684732 GTTTGGGAAAGGAGAGCTAATGG + Intergenic
1110702366 13:78563547-78563569 CTGTGGGAGGGAAGGGCTGATGG + Intergenic
1112645401 13:101325820-101325842 CTCTGTGAAATGAGGCCAGAAGG - Intronic
1113532407 13:111037810-111037832 CTCTGGGACTGGAGGGATCAGGG + Intergenic
1113745505 13:112741622-112741644 ATCTGGGACAGGTGGGCTGCAGG + Intronic
1116312123 14:43340824-43340846 CTCTGGCAAAGCAGGCCTGGTGG + Intergenic
1117035450 14:51723309-51723331 CTTTGGGAAGGGAGGTATGAGGG + Intronic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1117419857 14:55533611-55533633 CCCTGGGAAAGGGGGACTCAGGG + Intergenic
1117439477 14:55746311-55746333 ATCTGGGACAGGAAGGCTGCTGG - Intergenic
1118361840 14:65063504-65063526 CTCTGGAAAAGGATGTCTCATGG - Intronic
1120183364 14:81367793-81367815 CTCTGGGCCTGGAGGGCAGATGG + Intronic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1122262633 14:100531900-100531922 CTGTGGGGAAAGGGGGCTGAGGG - Intergenic
1122346044 14:101061007-101061029 CTCTGGGAAGCAAGGGGTGAAGG + Intergenic
1122666510 14:103334001-103334023 CTCTGGGAAAGGCGGGGGGAGGG + Exonic
1122802723 14:104239630-104239652 CTATGAGAAAGGACGGCAGAAGG + Intergenic
1124493748 15:30174022-30174044 CCCAGGGAAGGGAGGGCTGGGGG + Intergenic
1124625007 15:31302772-31302794 CTCTAGGAATGGGGGGCTGCTGG + Intergenic
1124749819 15:32364627-32364649 CCCAGGGAAGGGAGGGCTGGGGG - Intergenic
1126457923 15:48884816-48884838 CTCTGGGAAGGGAAAGATGAGGG - Intronic
1128475369 15:67992794-67992816 ATTTGGGTGAGGAGGGCTGAAGG - Intergenic
1128916227 15:71565404-71565426 CTCTGGAATAGGAGAGATGATGG - Intronic
1128969001 15:72089534-72089556 CTCTGGGAAAGGAAGGGAGGAGG + Intronic
1129359072 15:75013046-75013068 CTCTGTGAAAGGAGGGTGGAGGG - Intronic
1129581478 15:76816055-76816077 CTCTGGGTAAGGGAGGGTGAGGG + Intronic
1129694189 15:77731274-77731296 CTCTGGGAAACTAGGGCAGTGGG - Intronic
1129702170 15:77774330-77774352 CCCTGGGAGAGGTGGGCAGAGGG - Intronic
1131306883 15:91252827-91252849 CTCAGGGGGAGGAGGGCTGGAGG - Intronic
1131489241 15:92848349-92848371 CCTTGGAAAAGGAGGGCTGGAGG + Intergenic
1132348212 15:101121257-101121279 GACTGGGAAAGGAGGGCTTCGGG + Intergenic
1132942474 16:2514797-2514819 GTTTGGGAAAGCTGGGCTGAGGG + Intronic
1132977976 16:2719975-2719997 CTCAGGGGCAGGAGGGATGATGG + Intronic
1133133042 16:3689861-3689883 CTCTCAGAAAGGAGGTCTCAGGG + Intronic
1133349843 16:5094087-5094109 CACTTGGAAAGGAGGGCAGAGGG + Intronic
1133434217 16:5765443-5765465 CTCTGGGAAAGAAGGGTCAAAGG - Intergenic
1133440087 16:5814201-5814223 GGCTGGGAAAGGAGGGCATACGG - Intergenic
1134745586 16:16585551-16585573 CTGTGGGGAAGGAGGGCTTGAGG + Intergenic
1135657762 16:24266607-24266629 CTCTGGGAAAGCAGAGATAAAGG + Intronic
1135943086 16:26839856-26839878 CTCTGGGAAGTTAGGGCAGAGGG + Intergenic
1136087198 16:27893994-27894016 CTTTGGGAAACCAGGGCTGGAGG - Intronic
1136229373 16:28877754-28877776 CTCTGGGAACAGAGCCCTGAGGG - Intergenic
1136500077 16:30665617-30665639 CTCTGGGAAAGGGGAGTGGAGGG - Exonic
1137539669 16:49353634-49353656 GTCTGGGAAAGCAGGCATGATGG + Intergenic
1137777249 16:51066244-51066266 CTCTGGGAGAGGGAGTCTGAGGG - Intergenic
1137868835 16:51929873-51929895 CTTTGGGAAGGGAAGGTTGATGG - Intergenic
1138088162 16:54152883-54152905 CTCTGAGATAGCAGGGATGACGG + Intergenic
1138194658 16:55043434-55043456 CTTTGGGAAAGGAGGAGTGGGGG + Intergenic
1138438525 16:57020493-57020515 CTGGGGGACAGGAGAGCTGAGGG - Intronic
1139215031 16:65119637-65119659 CCCTGGGAAAGGGGGAATGAAGG - Intronic
1139434605 16:66928770-66928792 CTCTGGGCAATAGGGGCTGATGG + Intergenic
1139683466 16:68583299-68583321 CTCGGGGAGAGGAGGAGTGACGG - Intergenic
1141610756 16:85179913-85179935 CTCTGGAAAATGGGGGCAGATGG + Intronic
1141621986 16:85241240-85241262 GTCTGTAAAAGCAGGGCTGATGG + Intergenic
1141675687 16:85516037-85516059 GGCTGGGAAAGGAGGCCTGGGGG + Intergenic
1141696891 16:85624403-85624425 CTGTGGGAAAGTGGGGCTGGGGG + Intronic
1141769101 16:86078124-86078146 CTCTGGGAAGGGAAGGCAGAGGG - Intergenic
1142006379 16:87691304-87691326 CTTTGGGAATGAAGGGCTGTGGG + Intronic
1142024451 16:87804971-87804993 CTCTGGGGAAGGAAGGATGACGG - Intergenic
1142470992 17:163229-163251 CTCAGGGATATGAGGGCCGAGGG - Intronic
1142766162 17:2065392-2065414 CTCCAGGAAGGAAGGGCTGAAGG - Intronic
1142998185 17:3773727-3773749 TTCTGGGAGAGAAGGGCTGAAGG - Intronic
1143272028 17:5682985-5683007 CTCTGGTCAAGAAGAGCTGAAGG + Intergenic
1143379916 17:6489589-6489611 CTCTGAGGAGGCAGGGCTGAGGG - Intronic
1143500786 17:7337291-7337313 CTCTGGGAAAGAGGGGGTCATGG - Exonic
1144230669 17:13199938-13199960 CTAGTGGAAAGGAGGGCGGAAGG - Intergenic
1144638817 17:16926648-16926670 CTCTGGCTAAGCAGGGCTAAGGG - Intergenic
1144650697 17:17005104-17005126 CCCTGGGACCTGAGGGCTGAGGG - Intergenic
1144770733 17:17758019-17758041 CTCTGGAAAGGGAGAGATGAGGG - Intronic
1144891109 17:18494817-18494839 CTCCTGGAAAGCAGGCCTGATGG + Exonic
1145035103 17:19535107-19535129 CTGTGAGAAAGCATGGCTGATGG - Intronic
1145141114 17:20449501-20449523 CTCCTGGAAAGCAGGTCTGATGG - Intronic
1145208110 17:20995310-20995332 CTCTGGCTAAGCAGGGCTAAGGG + Intergenic
1145794812 17:27649432-27649454 CTCCTGGAAAGCAGGCCTGATGG + Exonic
1146443381 17:32916562-32916584 CTCAGGGAAAAGAAGGCTGAGGG - Intergenic
1146526742 17:33573195-33573217 ATCTGAGAAAGGAGTCCTGAGGG - Intronic
1147615313 17:41823874-41823896 CCCTGGGCAAGAAGTGCTGATGG - Intergenic
1147615569 17:41825379-41825401 CTCAGGGAAAGGAGGACGGAGGG + Intronic
1147972591 17:44227637-44227659 TTCTGGGAGAGGAGGGGTGGGGG - Intergenic
1147978733 17:44262111-44262133 CTCTTGGAAATGAGGGCTGGGGG - Intronic
1148046538 17:44748398-44748420 CCCTGGGATGGGAGGGCTGATGG - Exonic
1148104486 17:45112162-45112184 CTGGGGTAAAGGAGGGCTTAGGG + Exonic
1148360644 17:47009706-47009728 CCCTGGGACAGGAGGCCTGCCGG - Intronic
1148484807 17:47983737-47983759 TTCTTGGAAAGGAGAGGTGAGGG + Intergenic
1148507550 17:48139913-48139935 CTCTCGGAAAGGAAGGAGGAGGG - Intronic
1148543904 17:48502416-48502438 CTGGGGGAAAAGAGGGCTGTGGG - Intergenic
1148551483 17:48552943-48552965 CTCTGGGATAGGATGGCTCAAGG + Exonic
1148567858 17:48644335-48644357 CTCAGAGAAAGGAGTCCTGAGGG - Intergenic
1148763627 17:50022778-50022800 CTCTGGGAATGGGGGGTTGAGGG - Intergenic
1148869543 17:50648302-50648324 CTCGGGGATTGGAGGGCTGAAGG + Intronic
1148922596 17:51052224-51052246 TTCAGGGAAAGGAAGCCTGAAGG - Intronic
1149131062 17:53302977-53302999 CTCTGGGAAAGGCCAGCAGACGG - Intergenic
1150009145 17:61488400-61488422 CTCTGGGGCAGGAGGGCTCAGGG + Intergenic
1150171126 17:62996025-62996047 CTCTGTGAAAGGCATGCTGAAGG - Intergenic
1150284558 17:63947676-63947698 CTCAGGGAAAGGAGGCCTTGGGG - Intronic
1150635626 17:66911346-66911368 CTCAGTGACAGGAGGGATGATGG - Intergenic
1150785902 17:68162444-68162466 CCCTGGGATAGGAGGTCTGCAGG + Intergenic
1151141130 17:71993193-71993215 CTCTAGGAAAGGCTGGCAGATGG - Intergenic
1151488777 17:74419394-74419416 TCCTGGGAAAGGAGGTTTGATGG - Intergenic
1151517692 17:74606862-74606884 CACAAGGAAAGGAGGCCTGAGGG - Intergenic
1151660581 17:75516176-75516198 GGCTGGGCAAGGAGGGCAGAAGG - Intronic
1151723966 17:75874219-75874241 ACCTGGGAAAGGAGGGGTTAGGG + Exonic
1151907106 17:77056013-77056035 CGCTGGGAATGGAGGCCTGTGGG - Intergenic
1152121224 17:78419945-78419967 CCCTGGGAAGGGAGAGCAGAAGG - Intronic
1152140205 17:78532075-78532097 CTCAGGGAGATGAGGGCTGAGGG - Intronic
1152448792 17:80363368-80363390 CTCTGGGAATGGAGAGCTTCTGG + Intronic
1152570067 17:81117783-81117805 CTGTGGGAAGGGTGGGCTTACGG + Exonic
1153014818 18:573968-573990 ATCTGGGAAAGAAGGGGAGAGGG + Intergenic
1153172631 18:2333649-2333671 CTCCAGGAAAGGAGAGCTGAAGG - Intergenic
1153399616 18:4668604-4668626 CTCTTGTAAAGAAGGACTGATGG - Intergenic
1153577472 18:6536978-6537000 TCCTGGGAATGGAGGGCTGAAGG + Intronic
1153619886 18:6967796-6967818 TTTTGGGAGAGGAGGGCTCACGG - Intronic
1153626028 18:7023202-7023224 CACTGTGAAAGGTGTGCTGACGG - Exonic
1153971856 18:10234368-10234390 GGCTGGGACAGGTGGGCTGAGGG + Intergenic
1153979217 18:10295042-10295064 CTCTGGGAAAGGATGGCTCTGGG + Intergenic
1154303325 18:13213445-13213467 CTCAGGTAAAGGAGGTGTGAGGG + Intergenic
1157386221 18:47261492-47261514 CACTGGGCATGGAGGGGTGAAGG - Intergenic
1158337381 18:56427679-56427701 CTCTTGTAAAGCAGGTCTGATGG - Intergenic
1158453354 18:57586387-57586409 CGCGGAGAAGGGAGGGCTGAGGG - Intronic
1158827587 18:61240834-61240856 CTCTTGGCAAGGAGAGCTGGTGG - Intergenic
1159812966 18:73038990-73039012 CTCTGGGAGAAGAGGGATGGGGG - Intergenic
1160727469 19:623728-623750 CGCGGGGAAAGGCGGGCTGCGGG + Intronic
1160881363 19:1322221-1322243 CCCGGGGAAAGGAGGGGTGAAGG + Intergenic
1161281367 19:3447544-3447566 CCCTCGGAAAGCAGGGCTGAAGG + Intronic
1161334984 19:3708258-3708280 CTCTGGGCAAGCAGGGGTTAAGG + Intronic
1161699721 19:5787965-5787987 CTCTGAGACAGGACGGCCGAGGG + Intronic
1162043753 19:7985551-7985573 CCCTGAGACAGGAGGCCTGAGGG + Intronic
1162588604 19:11576685-11576707 ATCTCGGAAGGCAGGGCTGAGGG + Intronic
1163312178 19:16521237-16521259 CACTGGGAAGGGTGGGCTGAGGG + Exonic
1164378610 19:27711737-27711759 CTGTGGGAGAGGAAGGCTGAGGG + Intergenic
1166299305 19:41905092-41905114 CCCAGGGACAGGAGGGCTGTGGG + Intronic
1166529693 19:43535006-43535028 CTGGGGGACAGGAGGGCTGGTGG - Intronic
1166572252 19:43804656-43804678 TTCTGGGAAGTGAGGCCTGATGG - Intronic
1166852079 19:45765891-45765913 CTCTGGGAGAGCAGGGCTGGGGG + Exonic
1167111759 19:47466489-47466511 CACTGGGGAAGGAGGGTTGGGGG + Intronic
1167267308 19:48489989-48490011 CTCTGGGAGAGCAGGGCACACGG - Intronic
1168250821 19:55140999-55141021 CTCTGGGGAAGGAAGACTGGGGG - Intronic
1168337130 19:55603065-55603087 GTCTGGGGGAGGGGGGCTGAAGG - Exonic
925266528 2:2570281-2570303 CTCTGTGACAGGACAGCTGAGGG + Intergenic
925281209 2:2686598-2686620 CTCAGGGAAACGTGGGATGAAGG + Intergenic
925378445 2:3406021-3406043 CTCTGGGGCAAGAGGCCTGAGGG - Intronic
925975129 2:9137099-9137121 CCCTGTGAACGGAGGGCTGGAGG + Intergenic
925983197 2:9193438-9193460 CTCTGGGAACACGGGGCTGAGGG - Intergenic
926004344 2:9361299-9361321 CTCAGGGAAAGCAGGGTTGAAGG - Intronic
926174271 2:10575092-10575114 CTCTGTGACAGGAGTGCTGGAGG - Intronic
927135954 2:20096689-20096711 CTATGAGAATGGAGGGCAGAGGG - Intergenic
927665722 2:25031340-25031362 GCCTGGGAAAGGAGTGCTCAGGG - Intergenic
928328655 2:30339940-30339962 CCCAGGGAAAGCAGGACTGAGGG - Intergenic
929122329 2:38493889-38493911 ATCTGGGATAGGAGGGGAGAGGG + Intergenic
930226429 2:48798938-48798960 ATCTAGGAAAGCAAGGCTGAAGG + Intergenic
931748456 2:65310626-65310648 CTCAGTGAAAGGAAGGCTGCAGG - Intergenic
932421209 2:71602551-71602573 CCCTGGGAAAGAAGGTGTGATGG - Intronic
932895477 2:75635485-75635507 TCCTGGGTAAAGAGGGCTGAGGG - Intergenic
933984694 2:87580868-87580890 CTCTGGTAAAAGAAGGCTGTGGG + Intergenic
935131660 2:100265311-100265333 CTGTGGGGAGGGAGGGCTTAGGG - Intergenic
935354791 2:102187933-102187955 CTCTGGGAACGGAGGACACACGG - Intronic
935359850 2:102238078-102238100 GTCTTGGAAAGGAGTGATGAGGG - Intronic
935924900 2:108057105-108057127 AACTGGAAAAGGAGGGCTCATGG - Intergenic
936035764 2:109109925-109109947 CCAAGGGAAAGGAGGGCTGTGGG - Intergenic
936267311 2:111020395-111020417 CTCTGGGGATGGAGAGCTGGTGG + Intronic
936309157 2:111369932-111369954 CTCTGGTAAAAGAAGGCTGTGGG - Intergenic
937163038 2:119784227-119784249 TTCTGGGGAAGGAGGGGTGGGGG - Intronic
937379675 2:121365368-121365390 CTCTGGGAGAGGAGGCAGGAAGG - Intronic
937890267 2:126933312-126933334 CTTTGGGAAAGGACGGGCGAGGG + Intergenic
938306898 2:130262738-130262760 TGCAGGGAAAGGAGGGCAGAGGG - Intergenic
938912629 2:135899156-135899178 CCTGGGGAAAGGAGGGTTGAAGG + Intergenic
941901744 2:170685751-170685773 CTGTGGGAAATGGGGGCTCAGGG - Intergenic
942784606 2:179686465-179686487 CTTGGGGAAAGGAAGGCTGAAGG + Intronic
943148289 2:184074549-184074571 CTCTGTGCCAGGAGGTCTGAAGG + Intergenic
944562083 2:200949932-200949954 CCCTGGGAAGGGAGGACTAAAGG + Intronic
945272151 2:207951869-207951891 GTCAGGGAAAGGAGAACTGAAGG - Intronic
946061933 2:216950107-216950129 CTCTAGGGAATGAGGGCTGATGG + Intergenic
946111405 2:217421057-217421079 CTCTGGGAAAGGCAAGCTGAGGG + Intronic
947280569 2:228448470-228448492 CTATGGGAAAGGAGGGCTAAAGG - Intergenic
947960277 2:234230436-234230458 GGCTGGGAAAGGAGGTCTGTCGG + Intergenic
948341543 2:237256650-237256672 GTCTGGGAAAGGAGGGCAGTTGG - Intergenic
949054751 2:241921768-241921790 CTCTGGGACAGGAGGCCAGGGGG + Intergenic
949054845 2:241922089-241922111 CTCTGGGACAGGAGGCCAGGGGG + Intergenic
1168821443 20:776036-776058 CTCGGGGAAAGGCAGGCGGAGGG + Intergenic
1168968016 20:1911764-1911786 CTCAGGGAGAGGAGGGCGGCTGG - Intronic
1169687185 20:8288575-8288597 CTCTGGGAGAGGTAGGCTGCTGG - Intronic
1170205411 20:13792670-13792692 CCCGGAGAAAAGAGGGCTGAGGG + Intronic
1170970586 20:21112661-21112683 CTCTTGTAAAAGAGGCCTGAGGG - Intergenic
1171022879 20:21602698-21602720 CTGTGGGTAGGGAGGGCTGGAGG + Intergenic
1171374159 20:24680809-24680831 CTCTGAGAAATCAGGGCTGGAGG - Intergenic
1171771679 20:29326896-29326918 CCCCGGGAAAGAGGGGCTGAGGG + Intergenic
1172090382 20:32427513-32427535 CTCAGGGAAACTAGGGCTGTGGG - Intronic
1173225105 20:41157966-41157988 GACTGGGGAAGGATGGCTGATGG + Intronic
1176457823 21:6928780-6928802 CTCTGGGGACGGAGAGCAGAGGG + Intergenic
1176835995 21:13793864-13793886 CTCTGGGGACGGAGAGCAGAGGG + Intergenic
1176882676 21:14216290-14216312 CTCTGGGAAGGGGCGGCGGAGGG + Intronic
1177089058 21:16743398-16743420 CTATGAGAAAAGAGGGCAGATGG - Intergenic
1177867100 21:26525485-26525507 CTCTGGGGAAGGAAGGCGGCAGG - Intronic
1178022587 21:28426944-28426966 CTCTGGGAAATGAGGCCTGCAGG + Intergenic
1178414518 21:32393061-32393083 CTCGGGGAAAGGCCGGCGGAAGG + Intergenic
1178636096 21:34305356-34305378 CTGGGGGAAAGGGTGGCTGAGGG + Intergenic
1179942829 21:44650776-44650798 GGCTGGGAAAGGAGTTCTGAGGG + Intronic
1181159082 22:20946296-20946318 CTCTGGACAAGTAGGGCTGTAGG + Intronic
1181560505 22:23697058-23697080 CTCTGGGAGACAGGGGCTGATGG + Intronic
1181783163 22:25207406-25207428 CTGTGGGAGAGGCGTGCTGAAGG + Intergenic
1182300577 22:29334700-29334722 CACTTGGGAAGTAGGGCTGAGGG + Intronic
1182300589 22:29334749-29334771 CACTTGGGAAGTAGGGCTGAGGG + Intronic
1182364217 22:29767037-29767059 CTCTGGGAAGGGCGAACTGATGG - Intergenic
1182827021 22:33274218-33274240 CTCTGGGAATGCAGGGTTGTGGG + Exonic
1183459598 22:37941808-37941830 CTATGGGAGAGGAGGAGTGATGG + Exonic
1183581535 22:38729370-38729392 CTGTGGGAGAAGGGGGCTGAGGG + Intronic
1183663418 22:39234348-39234370 TGCTGGGAAGTGAGGGCTGAGGG + Intronic
1183911319 22:41081595-41081617 CTCTGGGAAACGAGCTCTAAAGG - Intergenic
1184159320 22:42688510-42688532 TTCTGGGAAAGGAGGAGGGAGGG + Intergenic
1184352814 22:43955632-43955654 CTCTGGGCCAGCAGGGCAGACGG + Intronic
1184550876 22:45203564-45203586 CCCTGGGAAGTGATGGCTGATGG - Intronic
1184718851 22:46297299-46297321 CTCTGTGAGCCGAGGGCTGAAGG + Intronic
1184834346 22:47012320-47012342 CTCAGGGGCAGGAGGGCTGGGGG - Intronic
1185134288 22:49060316-49060338 CTCTGGGGCAGGAGGGCTGGAGG - Intergenic
949692569 3:6656653-6656675 CTCTAGGGAAGTAGGTCTGAAGG - Intergenic
950081863 3:10228285-10228307 CTCTGGGGTAGGGAGGCTGAAGG + Intronic
950117367 3:10460109-10460131 CTCTGGGAATGAAGTGCTGATGG + Intronic
951026620 3:17837873-17837895 ATGTGGGTAAAGAGGGCTGAAGG + Intronic
951322785 3:21267185-21267207 CTCTGAGAAGGGATGGCTGAAGG + Intergenic
951328935 3:21342163-21342185 GTATGGGAAAGGAGTGGTGAGGG + Intergenic
953697234 3:45169643-45169665 GTCAGGGAGAGGAGAGCTGAGGG + Intergenic
954403897 3:50334414-50334436 CCCTGGAAAATGAGGGCTGGAGG + Intronic
954675151 3:52311587-52311609 CTCAGGCAAAGGAGGGCTGGAGG - Intergenic
955066999 3:55542377-55542399 CTCTGTGAAAAGAGTGCAGAAGG + Intronic
955798481 3:62662154-62662176 CCTTGAGAAAGGAGGGCTGAGGG + Intronic
957054144 3:75431437-75431459 CCCTTGGAAAGGAGGGCAGAGGG + Intergenic
961243473 3:125432231-125432253 CTGTGGGCAAGGAGGTGTGAGGG - Intergenic
961300694 3:125920276-125920298 CACTTGGAAAGGAGGGCAGAGGG - Intergenic
962091247 3:132246333-132246355 CTGCTGGAAAGGAAGGCTGATGG - Intronic
962462565 3:135628165-135628187 ATATGGGCAAGGAAGGCTGATGG - Intergenic
962752091 3:138441022-138441044 CTCTGAGAAAGCATGGGTGAGGG + Intronic
965646574 3:170888047-170888069 CCCTGGGAAATCAGGGGTGAGGG + Intergenic
965774249 3:172211594-172211616 CTGTAGAAGAGGAGGGCTGATGG + Intronic
966907966 3:184541458-184541480 CAATGGCAAAGGAAGGCTGATGG + Intronic
966939575 3:184737096-184737118 CTCTGGGACAGAAGTGGTGAGGG - Intergenic
967100498 3:186211525-186211547 CACGGTGGAAGGAGGGCTGAGGG + Intronic
967483815 3:190006708-190006730 CACTGAGAAAGTAGGACTGAGGG + Intronic
968127402 3:196169919-196169941 CTCTGGGAGAGGCAGGCTCAGGG + Intergenic
968815352 4:2818755-2818777 CTCTGGGCAGGGAGGGGTCAGGG - Intronic
968996943 4:3951744-3951766 CACATGGAAAGGAGGGCAGAGGG + Intergenic
969757062 4:9156936-9156958 CACTTGGAAAGGAGGGCAGAGGG - Intergenic
969817021 4:9694511-9694533 CACTTGGAAATGAGGGCAGAGGG - Intergenic
969842575 4:9893284-9893306 CTCTGGGAAAGCAAAGATGAAGG - Intronic
970392219 4:15624572-15624594 CTAGAGGAAAGAAGGGCTGAAGG - Intronic
970831161 4:20341215-20341237 CTTTAGCAAAGGAGAGCTGAAGG + Intronic
971161685 4:24140043-24140065 CTCTGGAATGGTAGGGCTGATGG - Intergenic
972113140 4:35591566-35591588 CTTTGTGAAAGAAAGGCTGATGG - Intergenic
972291738 4:37696003-37696025 TTTTGGGGAAGGTGGGCTGATGG - Intergenic
972730942 4:41794426-41794448 ATCTAGGAAAGGAAGGCGGAAGG - Intergenic
972805689 4:42527919-42527941 CTCTGGGGAAGGATGGGAGAAGG - Intronic
974436220 4:61860623-61860645 CTCTGGGGAAGGACCGCAGATGG - Intronic
975119691 4:70715156-70715178 TTCTGGGAAAGGAGGTGGGAGGG + Intronic
976974174 4:91146897-91146919 CTCTGGGAAAGGGAGACAGAGGG + Intronic
978445471 4:108776149-108776171 CTCTGGAGATGGAGGGCTCAAGG + Intergenic
981365920 4:143903027-143903049 TTCTGGGAAAAGAGGACAGAAGG - Intronic
981386550 4:144138199-144138221 TTCTGGGAAAAGAGGACAGAAGG - Intronic
984590621 4:181613491-181613513 CTCTGCGTTAGGAGAGCTGAGGG - Intergenic
985204521 4:187521022-187521044 CTCTGGGAAGGGGCGGCTGTGGG + Intergenic
985566295 5:619726-619748 ATCTGTGAAGGGGGGGCTGATGG + Intronic
987183017 5:15386248-15386270 CTCTGGGGAAGGAGGAGGGATGG - Intergenic
988466012 5:31493141-31493163 CTTTTGGAAAGAAGGGATGAAGG + Intronic
988594329 5:32577621-32577643 CTCTGGCTAAGCAGGGCTGTTGG + Intronic
988731950 5:33981187-33981209 CTCTGTGTAAGGAAGGCAGAGGG - Intronic
988779679 5:34508901-34508923 CTCACGGAGAGGATGGCTGAAGG - Intergenic
989187879 5:38642666-38642688 CACTGGGAGAGGAGGACGGAGGG - Intergenic
992416662 5:76558745-76558767 CTCTGCTAAAGGAGGGGTGTTGG - Intronic
992950875 5:81857043-81857065 CTCTGCCAGAGGAGGCCTGATGG - Intergenic
995865267 5:116683596-116683618 CTCTGGGAAAGCAAGGCAGGGGG + Intergenic
995903145 5:117093446-117093468 GTCTGGGAAAGGTGGGAAGAGGG - Intergenic
996536265 5:124581110-124581132 CGCTGGGAAAGGCTGCCTGATGG - Intergenic
997836465 5:137197314-137197336 CTCTGGGAGATGAGGGATGAGGG + Intronic
997972931 5:138419137-138419159 GTCAGGGCAAGGAGGCCTGATGG - Exonic
1000342952 5:160291546-160291568 CTCTGGGAAAAGGTGCCTGAGGG + Intronic
1000345540 5:160311137-160311159 CTCAAGGAGAGAAGGGCTGAGGG - Intronic
1001059949 5:168479649-168479671 CTTTGGGAAAGATGGGGTGAGGG + Intergenic
1001273675 5:170334581-170334603 CACTGGGAAAGTGGGGATGAGGG - Intergenic
1002721188 5:181262082-181262104 CCCTGGGGAGGGAGGGCTGGGGG + Intergenic
1002791611 6:441488-441510 GTGTGGGAATGGAGGGCTGTGGG - Intergenic
1002923085 6:1587048-1587070 CTGTGGGAAAGGGAGGCTGGAGG - Intergenic
1003372184 6:5539137-5539159 ATGGGGGAAAGGAAGGCTGATGG - Intronic
1003586188 6:7391038-7391060 GTCTGGGGAAAGAGGGATGAAGG + Intronic
1004383582 6:15153023-15153045 TTCAGAGAAAGGAGGGCAGAGGG - Intergenic
1005245954 6:23885441-23885463 CACTGTGGAAGGAGGGGTGAAGG - Intergenic
1005423144 6:25673391-25673413 CTCTGGGCAACTAGGGCTGCTGG - Intronic
1005882155 6:30070065-30070087 CTCTGGGAGAGGAAGGAAGAGGG + Exonic
1006020003 6:31112276-31112298 CTCCGGGCAAAGAGGCCTGAGGG + Exonic
1006389132 6:33748319-33748341 CTCTGTGAAATGAGCGGTGAGGG - Intergenic
1006736612 6:36278037-36278059 CTCTCTGAAAGGGGGGCAGAGGG - Intronic
1007364972 6:41384831-41384853 TCCTTGGAAAGGAGGTCTGATGG + Intergenic
1007533627 6:42564654-42564676 CTGGGGGAAAGGAGGTATGATGG - Intronic
1007579604 6:42949532-42949554 GTGTGGGAAAGGAATGCTGAAGG - Intergenic
1008029201 6:46674087-46674109 CTCAGGGTCAGGAGGGATGAGGG + Intronic
1009280244 6:61741002-61741024 CTCTAGGAAATGAGGGCACAAGG + Intronic
1009450471 6:63794080-63794102 ATTTGGGAAGGGAGTGCTGAAGG - Intronic
1011193045 6:84753527-84753549 CTTTTGGAATTGAGGGCTGAGGG + Intronic
1012990056 6:105916299-105916321 CTCTGGTAAAAGAAGGCTGAAGG - Intergenic
1013068488 6:106706276-106706298 CTCGGGGAAGGGTGGGCTGGAGG + Intergenic
1013932838 6:115555481-115555503 CTCTGGGAGATGAGGGAAGATGG - Intergenic
1014504524 6:122238455-122238477 CTCTGGGAAGGTAGTACTGAGGG - Intergenic
1015692385 6:135939541-135939563 CTCTGGCACCGGAGTGCTGAGGG + Intronic
1015823208 6:137284445-137284467 GGCTGGGAAAGGAGGGAAGATGG + Intergenic
1017329432 6:153178353-153178375 CTATGGAAATGAAGGGCTGATGG - Intergenic
1017523400 6:155221764-155221786 ATCTGGAAATAGAGGGCTGAGGG - Intronic
1017750705 6:157488119-157488141 CTCTGGGAAGGGAGGCCTCCCGG - Intronic
1018038641 6:159902987-159903009 CTGTGGAAAAGAAGGGCTGAGGG - Intergenic
1019353876 7:568955-568977 CTCTGGGAGGGGAGGGTTGAGGG + Intronic
1019703872 7:2488243-2488265 CTCTGGGAAAACAGGGGTGCTGG - Intergenic
1020321236 7:6940126-6940148 CACTTGGAACGGAGGGCAGAGGG + Intergenic
1021458267 7:20855240-20855262 ATGCGGCAAAGGAGGGCTGAGGG + Intergenic
1023565857 7:41523129-41523151 CTCTATGAAAGGAGGACTGTTGG - Intergenic
1023912429 7:44565517-44565539 CTCGGGGAGAGGAAGGCTGGCGG + Exonic
1024300650 7:47885088-47885110 CTCTGGGAAAGGAGGGCTGAGGG - Intronic
1024579418 7:50789919-50789941 CTCGTGGAAAGGCAGGCTGATGG - Intronic
1024858975 7:53815548-53815570 CTATGGGAAAGAAGGGAAGATGG - Intergenic
1025819725 7:64950821-64950843 CTGTTGGAAAGGAGTGCTGTGGG + Intergenic
1026352686 7:69531316-69531338 CTGTGGCAAAGGAGGGATGGGGG + Intergenic
1026394201 7:69935169-69935191 CTCTGGGAAAAAAGGACGGAGGG + Intronic
1026877172 7:73886481-73886503 CTCTGGGACAGGAGGGAGGCGGG + Intergenic
1028768357 7:94586450-94586472 CTCCTGGAGAGAAGGGCTGATGG - Intronic
1029159837 7:98543799-98543821 GGCTGGGAAAGGATGGCTGAGGG - Intergenic
1029730406 7:102434494-102434516 CTCAGGGCAGTGAGGGCTGAGGG - Intronic
1031803515 7:126278352-126278374 CTCTTGTAAGGCAGGGCTGATGG + Intergenic
1032589714 7:133180524-133180546 ATCTGGGAAAGAAGGTCTTATGG - Intergenic
1033247165 7:139727322-139727344 CTGTGGGAAAAGAGGGCTATTGG - Intronic
1034227600 7:149496012-149496034 ATCTGAGAAAGGAGAGGTGAGGG - Intronic
1034251102 7:149691386-149691408 CTAGGGGAAATGAGGGCAGAAGG - Intergenic
1034459786 7:151192000-151192022 CCCTGGGGAAGGGGAGCTGATGG - Intronic
1035253457 7:157612070-157612092 CTCTGGGCCTGGAGGGCTGCAGG - Intronic
1035700645 8:1637167-1637189 CTCTGGGAAAGGAGGATAGGAGG - Intronic
1036380292 8:8232251-8232273 CACTTGGAAAGGAGGGCAGAGGG - Intergenic
1036706745 8:11052330-11052352 CTCTGGGAAACAAGAGCTGGGGG - Intronic
1036849268 8:12190409-12190431 CACTTGGAACGGAGGGCAGAGGG + Intronic
1036870628 8:12432683-12432705 CACTTGGAACGGAGGGCAGAGGG + Intronic
1037786372 8:21905824-21905846 CCTTGGGAAAGGTGGGGTGAGGG - Intergenic
1038382147 8:27106057-27106079 CTCTGGGGAAGGTGAGCTGCTGG + Intergenic
1038644111 8:29349203-29349225 CTCTGGGAGCGGGAGGCTGAAGG - Intronic
1038669490 8:29570994-29571016 CTCTGGGAAGTGAAGGCTGGTGG - Intergenic
1040915563 8:52564353-52564375 CCCTGGAAAAGGAGGTCCGAGGG - Intronic
1042224411 8:66504320-66504342 CTCTCGGAAAGGAGGAGTGAGGG - Intronic
1042791070 8:72606933-72606955 ATCTGGGAGAGCAGGCCTGAGGG + Intronic
1042901500 8:73732808-73732830 TGGTGGGAAAGGAGGGCAGACGG - Intronic
1044488527 8:92783381-92783403 CTGTGTGTAAGGAGAGCTGACGG + Intergenic
1044532120 8:93319140-93319162 ATCTGGGAAAGGAAGTCTCAAGG - Intergenic
1046645782 8:116783863-116783885 CTCTAGGAAGCCAGGGCTGACGG + Intronic
1047933389 8:129751948-129751970 TTCAGGGAAAGAAGGGCAGAAGG - Intronic
1048329059 8:133459990-133460012 CTCTGAGAAAGGAAGCCTGTAGG + Intronic
1048372714 8:133793466-133793488 CTGCAGGAAAGGAGGGCTAAGGG - Intergenic
1049201843 8:141344069-141344091 CTGTGGGAAAGGAGGACTCTGGG + Intergenic
1049271184 8:141697142-141697164 CTCTGGGACAGGAGAGCTCGGGG - Intergenic
1049623081 8:143607346-143607368 CACTGGGGATGGAGGGCTCAGGG - Intronic
1050440989 9:5663980-5664002 CTCTTGCAAAGCAGGTCTGATGG + Intronic
1050470781 9:5987456-5987478 CTATAGGAAAGGAGGGCTTATGG - Intronic
1051398028 9:16647447-16647469 CTCAGGGAAAGGAGGTCAAAGGG + Intronic
1051505984 9:17828310-17828332 AGGTGGGAAAGGAGGGCTGTAGG - Intergenic
1051689210 9:19691427-19691449 CTTTGGAAAAGCAGGGCTCAAGG + Intronic
1052626675 9:30984203-30984225 CTCTTGAAAAGTAGGTCTGATGG - Intergenic
1053421926 9:37985115-37985137 CTCTGCGGAAGCAGGGCTGTGGG + Intronic
1053489697 9:38489232-38489254 CTCTGGGCAGGGAGTGCTGGGGG + Intergenic
1054743424 9:68830900-68830922 CTCAGGGAAAGGGGGCCTGCTGG - Intronic
1055335344 9:75227818-75227840 CTCAGGGAAAGAGGGTCTGAGGG + Intergenic
1056181721 9:84090192-84090214 CTCGGGGAAAGGGAGGCTCAAGG + Intergenic
1057034911 9:91804974-91804996 CTGTGAGAAAGGAGGGCTAAGGG - Intronic
1057312304 9:93950035-93950057 CTGTGGAAAGGGAGGCCTGAGGG - Intergenic
1057734360 9:97640611-97640633 CTCTGGGAATGGGAGGCTGTTGG + Intronic
1058021994 9:100099178-100099200 CTGTGGGATAGAAGGGCGGAGGG + Intergenic
1058675943 9:107400139-107400161 ATCTGGGAAAGGATGGCAGTGGG + Intergenic
1058826056 9:108776942-108776964 CTCTGGGAAAGAAAGTCTAATGG - Intergenic
1059446578 9:114341952-114341974 CCCTGGTCAAGGAGAGCTGAGGG + Intronic
1059630745 9:116119166-116119188 GTCTGGGAAAGGGGGGCTAGGGG - Intergenic
1059729563 9:117043493-117043515 GTCTGGGGAAAGAAGGCTGAGGG + Intronic
1060801375 9:126547791-126547813 CTCTGGGTGGGGAGGGATGAGGG - Intergenic
1060959046 9:127666075-127666097 CTCTTGTAAAGGAGGGCAGCAGG - Intronic
1061226076 9:129281695-129281717 CGCTGGGAGTGGAGGGCTGAGGG + Intergenic
1061416080 9:130447586-130447608 TTCCGGGGAAGGAGGGCTGGAGG + Intronic
1061509482 9:131051798-131051820 CACTGGGAAAGGAGGAGGGAGGG + Intronic
1061825613 9:133256562-133256584 CTCTTACTAAGGAGGGCTGAGGG + Intronic
1203787176 EBV:134493-134515 CCCGGGGAAAAGAGAGCTGATGG - Intergenic
1186180271 X:6967125-6967147 CTCTGGGAAAGGAGTCCTACAGG - Intergenic
1186436770 X:9549799-9549821 TTCGGGGATAGGAGGGCTGGGGG + Intronic
1187180944 X:16943330-16943352 ACCTGGGAAAGGTGGGCTGGGGG - Intergenic
1188592164 X:31851040-31851062 CTCTGACAAATGAAGGCTGATGG + Intronic
1192224528 X:69219231-69219253 CTGTGGGAAAGGAGGCCAGGAGG - Intergenic
1192358202 X:70423001-70423023 CTCAGGGAGGCGAGGGCTGAGGG - Intergenic
1192560908 X:72127370-72127392 ATCTGGGAAAGGAAGGAAGAGGG + Intronic
1192958126 X:76095440-76095462 CTGGGGGAAAGGGTGGCTGATGG - Intergenic
1194371928 X:93084182-93084204 TTCTGGGAAAGAAGGGATCAAGG - Intergenic
1194688221 X:96950925-96950947 CTCTGGGAAATGCTGGCAGAAGG - Intronic
1194708342 X:97202127-97202149 CTCTTGAAAAGCAGGCCTGATGG - Intronic
1198734990 X:139775696-139775718 CCCTAGGTAAGGAGGGCAGAGGG - Intronic
1199978263 X:152906905-152906927 CTCCGGGAAGGCAAGGCTGAAGG + Intergenic
1200679969 Y:6198215-6198237 TTCTGGGAAAGAAGGGATCAAGG - Intergenic
1201073368 Y:10169765-10169787 TCCTGGGAAAGAGGGGCTGACGG - Intergenic
1201074025 Y:10172910-10172932 ATCTGGGAAAGGAGGGCTTCTGG + Intergenic
1201566549 Y:15370659-15370681 CTCTTGTGAAGGAGGCCTGATGG - Intergenic