ID: 1024301445

View in Genome Browser
Species Human (GRCh38)
Location 7:47890297-47890319
Sequence TAGCTAAAGCTGGCACAGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 173}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024301445_1024301452 24 Left 1024301445 7:47890297-47890319 CCCGGCTGTGCCAGCTTTAGCTA 0: 1
1: 0
2: 0
3: 10
4: 173
Right 1024301452 7:47890344-47890366 CCAGACATCAGCCCGAGAGCGGG 0: 1
1: 0
2: 1
3: 7
4: 130
1024301445_1024301450 23 Left 1024301445 7:47890297-47890319 CCCGGCTGTGCCAGCTTTAGCTA 0: 1
1: 0
2: 0
3: 10
4: 173
Right 1024301450 7:47890343-47890365 CCCAGACATCAGCCCGAGAGCGG 0: 1
1: 0
2: 0
3: 11
4: 127
1024301445_1024301453 25 Left 1024301445 7:47890297-47890319 CCCGGCTGTGCCAGCTTTAGCTA 0: 1
1: 0
2: 0
3: 10
4: 173
Right 1024301453 7:47890345-47890367 CAGACATCAGCCCGAGAGCGGGG 0: 1
1: 0
2: 1
3: 6
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024301445 Original CRISPR TAGCTAAAGCTGGCACAGCC GGG (reversed) Intronic
902565907 1:17311273-17311295 AAGTTAAAGGTGGCAAAGCCAGG + Intronic
903540038 1:24091709-24091731 TAGCTAATGCTGCCACGGACAGG - Intronic
903678891 1:25083865-25083887 TGGCTAAATCTGGCACAGGGTGG - Intergenic
903938499 1:26912920-26912942 TAGCTAAAGGTAACACAGCCAGG - Intronic
905512048 1:38529602-38529624 TAGTTGCAGCTGGCCCAGCCCGG + Intergenic
910109177 1:83663840-83663862 TAGCAAAAGTTGACACAGCCAGG + Intergenic
911179526 1:94848514-94848536 TAGGTGCAGCTGGCCCAGCCAGG + Intronic
914317865 1:146531002-146531024 TGGCTAGAGCTGGAGCAGCCGGG + Intergenic
914496491 1:148202356-148202378 TGGCTAGAGCTGGAGCAGCCGGG - Intergenic
916649327 1:166820167-166820189 TAGCTGGAGCTGGAACTGCCTGG + Intergenic
917107907 1:171513118-171513140 TACCTAAAGATGGCACAGGGTGG + Exonic
919124361 1:193377921-193377943 TAGCCACAGCTGGAACAGCTGGG - Intergenic
919647916 1:200114519-200114541 TTGCTAAATATGACACAGCCAGG - Intronic
920111295 1:203589060-203589082 TAGCTAAAGCTGGAATTGCCAGG - Intergenic
920128106 1:203709829-203709851 CAGCTAATAGTGGCACAGCCAGG + Intronic
920517869 1:206599896-206599918 TAGCTCACTCTGGCACATCCTGG - Intronic
921751631 1:218800912-218800934 TATCAAAACCTGGCACAGGCCGG - Intergenic
922287676 1:224183727-224183749 TACTCAAGGCTGGCACAGCCGGG - Intronic
922987662 1:229878539-229878561 TTGCTAAATGTGGCAGAGCCAGG + Intergenic
1063520856 10:6739402-6739424 AATCTAAAGCTTGCATAGCCGGG + Intergenic
1064626489 10:17266742-17266764 CAGCTGGAGCTGGCACAGCTAGG - Intergenic
1064628146 10:17282575-17282597 CAGCTGGAGCTGGCACAGCTAGG - Intergenic
1064711769 10:18134876-18134898 TAGCTAAAGGTGACAGAGGCGGG - Intergenic
1069626691 10:69872401-69872423 TAGCTAAAGATGCCCCAGCAGGG - Intronic
1069848561 10:71390337-71390359 TAATTAAAGCTGGCACAGATTGG - Intergenic
1071789961 10:88942959-88942981 CAGCTAGAACTGGCAAAGCCTGG - Intronic
1071801538 10:89068176-89068198 TACCTAAAGCTGGCAGAGAAGGG + Intergenic
1072760101 10:98049485-98049507 TGGCCCAAGGTGGCACAGCCAGG - Intergenic
1073344897 10:102775714-102775736 TAGAGAAAGTTGGGACAGCCAGG + Intronic
1076560762 10:131361821-131361843 CAGCTGAAGCTTGCAGAGCCTGG - Intergenic
1077336327 11:2006483-2006505 GAGGTACAGCTGCCACAGCCAGG - Intergenic
1080966251 11:37217869-37217891 TAGCTACAGCTGGAGCAGCTAGG + Intergenic
1081220942 11:40460688-40460710 TAGCTATAGCTGGAAAAGTCTGG - Intronic
1082128131 11:48456040-48456062 TGGCTGAAGCTGGAGCAGCCTGG + Intergenic
1082759164 11:57109792-57109814 CAGGAAAACCTGGCACAGCCAGG - Intergenic
1083339837 11:61951956-61951978 TAGGTAAAGCTGGCAGGGCTGGG + Intronic
1083696225 11:64444565-64444587 TCGCTATTTCTGGCACAGCCGGG + Intergenic
1084498700 11:69521498-69521520 CAGCTAGAGCTGGAGCAGCCTGG + Intergenic
1084693563 11:70740737-70740759 AAGCGTCAGCTGGCACAGCCTGG + Intronic
1086031633 11:82365742-82365764 TCTCTTAAGCTGGCACAGCAAGG - Intergenic
1089624046 11:119740129-119740151 CAGCCAGAGCTGGCACACCCAGG - Intergenic
1202819311 11_KI270721v1_random:61665-61687 GAGGTACAGCTGCCACAGCCAGG - Intergenic
1093328616 12:17809313-17809335 TAACTAAATCTAGCACAGCATGG - Intergenic
1094300820 12:28963398-28963420 CAGCTAAATCTGTAACAGCCAGG + Intergenic
1099076331 12:78113570-78113592 TAGTTAAAGCTGGAGCAGCTGGG + Intronic
1101436366 12:104668101-104668123 TAGCTCAAGGTCACACAGCCAGG - Intronic
1102203802 12:111076457-111076479 TTGCCAAAGCTCACACAGCCAGG + Intronic
1103590356 12:121987812-121987834 TAGCTACCGAGGGCACAGCCAGG + Intronic
1104933285 12:132351697-132351719 GAGTTAAAGCTGGGAGAGCCTGG + Intergenic
1109522489 13:63531999-63532021 TAGCCATAGCTGGTACAGCTGGG - Intergenic
1111694736 13:91609243-91609265 TAGCTAAAGCTCTGAGAGCCGGG + Intronic
1116369329 14:44109729-44109751 TAGATGAAGCTGGAATAGCCTGG - Intergenic
1116526853 14:45916403-45916425 CAGCTAGAGCTGGAGCAGCCAGG + Intergenic
1117203667 14:53418434-53418456 TAGCCACAGCTGGAACAGCTGGG - Intergenic
1119504697 14:75162353-75162375 TAGCTAAAGCTGAAACAATCAGG + Intronic
1120509737 14:85398801-85398823 AAGCTAAAGAAGCCACAGCCAGG - Intergenic
1122828235 14:104382692-104382714 TGGCTTAAGGTGGCACAGCTGGG - Intergenic
1123109395 14:105858627-105858649 CAGCTCAACCTGGCCCAGCCTGG + Intergenic
1128227563 15:66012834-66012856 TAGAGAAAGCTGGCAAAGTCTGG - Intronic
1131538110 15:93254171-93254193 TGGCTACAGCTGGAACAGACCGG + Intergenic
1131755362 15:95554879-95554901 TAGCGATAGCTGGCACATGCTGG + Intergenic
1132222805 15:100117538-100117560 CAGGTAAAGGTAGCACAGCCCGG - Intronic
1132644273 16:991642-991664 CAGCTGACGCTGGCCCAGCCTGG - Intergenic
1134686493 16:16162337-16162359 CAGCTAATACTGGCAGAGCCAGG - Intronic
1136226835 16:28865488-28865510 TGGCTGAGGCTGGCCCAGCCGGG + Intronic
1136509920 16:30730995-30731017 AAGCTAAAGATGGTACAGCAGGG - Intronic
1138696389 16:58817402-58817424 TAGCCAAAGGTGGTAAAGCCTGG - Intergenic
1140410581 16:74738345-74738367 TAGGTGACGGTGGCACAGCCTGG + Intronic
1140714386 16:77708726-77708748 AAGCTAAAACTGGGACAGGCAGG + Intergenic
1143101018 17:4504780-4504802 TGGCGAAGGCTGGCAGAGCCAGG - Intronic
1147158193 17:38555833-38555855 TTTATAAAACTGGCACAGCCTGG - Intronic
1151085582 17:71376741-71376763 TATCCAAAGCTGGCAAAGACTGG + Intergenic
1151901764 17:77020535-77020557 TAGCAAAAGGTGGCAGAGCCAGG - Intergenic
1153232845 18:2956370-2956392 CAGCCCAAGCTGGCAGAGCCAGG - Intronic
1156369233 18:36457780-36457802 TAGCTCAGGATGTCACAGCCTGG + Intronic
1156595424 18:38542811-38542833 TAGGTTAATCTGGCAGAGCCAGG - Intergenic
1158621207 18:59034076-59034098 TGGCCAAACCTGGCAGAGCCCGG + Intergenic
1159557403 18:69959807-69959829 TTGCTAAATATGGCACAGCCAGG + Intronic
1161504409 19:4636225-4636247 TAGCTGCAGGTTGCACAGCCCGG + Intergenic
1162128841 19:8513236-8513258 GGGCTGCAGCTGGCACAGCCGGG + Exonic
1162896916 19:13770129-13770151 TTGCTAACGGTTGCACAGCCAGG - Intronic
1164270202 19:23665866-23665888 TAGAGAAAGCAGGCACAGCATGG + Intronic
1165914086 19:39247444-39247466 CAGCTTGAGCTGGCACGGCCAGG - Intergenic
1167630721 19:50625020-50625042 CAGCTAAAGTTGGCACAGCAGGG + Intronic
1168581332 19:57558168-57558190 TAGCTACAGCCAGCACTGCCAGG + Intronic
932416729 2:71578099-71578121 TAGCAAAAGCAGGCACCGTCTGG + Intronic
933188851 2:79310699-79310721 TAGTTAAAGCCAGCATAGCCTGG + Intronic
933699183 2:85242526-85242548 CAGCAGAAGCGGGCACAGCCGGG - Intronic
936888944 2:117346695-117346717 CAGATAAAGCTGGTAGAGCCAGG - Intergenic
938104674 2:128521696-128521718 GAGCTAAACCTGGGACAGGCGGG - Intergenic
939469528 2:142601954-142601976 TAGCTGAGGCTGGGACACCCAGG - Intergenic
940408767 2:153335931-153335953 CAGCCACAGCTGGCACAGCTGGG - Intergenic
942353132 2:175076125-175076147 TAGCTAAAGTTGACACTACCAGG - Intronic
942521888 2:176812968-176812990 TATTTATAGCTGGCACTGCCGGG + Intergenic
947611842 2:231529725-231529747 TCGCTAAAGGTCACACAGCCTGG - Intronic
948495857 2:238349406-238349428 TAGGTAAGGCTGGCTCAGCAGGG + Exonic
948621421 2:239237280-239237302 CACCTAAACCTGGCACAGGCTGG + Intronic
948831203 2:240599128-240599150 TGGCAAGAGCAGGCACAGCCTGG - Intronic
1174581919 20:51578296-51578318 TGGGTAACGCTGGCACTGCCTGG - Intergenic
1177088680 21:16739420-16739442 TAGCTAAAGCTGGCAGTTCTTGG + Intergenic
1179116147 21:38494295-38494317 TACCAAACGCTGGAACAGCCTGG + Intronic
1180140829 21:45892638-45892660 CAGCTGAGGCTGGCACTGCCAGG + Intronic
1181470533 22:23136545-23136567 TTGCTAATGTGGGCACAGCCAGG + Intronic
1183031577 22:35110412-35110434 TAGCTCAAGCTTGCATAGCTGGG - Intergenic
950451560 3:13068381-13068403 TACCCAAAGCTGGCATGGCCTGG - Intronic
951184625 3:19698684-19698706 ATGCTAAAACTGGCACAGCAGGG + Intergenic
951609598 3:24477662-24477684 TAGCTAACGCTGCCAAAGCAAGG + Intronic
951699302 3:25478716-25478738 TCCATAAAGCTGGCAGAGCCAGG - Intronic
953340541 3:42130869-42130891 TTGCTAAGCCTTGCACAGCCAGG + Intronic
954727227 3:52623125-52623147 TCCCAAAAGTTGGCACAGCCCGG + Intronic
956646919 3:71465461-71465483 TTGCTTAAGATGGAACAGCCAGG + Intronic
957662823 3:83183618-83183640 TAGCCACAGCTGGAACAGCTGGG - Intergenic
960625846 3:119681438-119681460 TTGGTAAAGCTGGCACACCTGGG - Intergenic
961316279 3:126037959-126037981 TGGCTGAAGCTGGAACAGCCAGG - Intronic
961381378 3:126498372-126498394 TAGCTAGAGATGGTACAGCCAGG - Intronic
962918162 3:139927168-139927190 TGGCTTAAGCTCACACAGCCTGG - Intergenic
965479095 3:169194719-169194741 TGGCAAATTCTGGCACAGCCTGG - Intronic
972411275 4:38797360-38797382 CTGCTAAAGCTGCCACATCCAGG + Exonic
972414805 4:38827987-38828009 CTGCTAAAGCTGCCACATCCAGG + Exonic
976064131 4:81164349-81164371 GAGCTAAAGGTGGGGCAGCCAGG - Intronic
978428950 4:108612454-108612476 TAGCTGAGGCTGGCACACCATGG - Intergenic
980266552 4:130524166-130524188 TAGCCATGGCTGGAACAGCCAGG + Intergenic
982309981 4:153974662-153974684 TAGCCAAAGCTGGAACAGCTGGG - Intergenic
982430316 4:155315116-155315138 TAGCCACAGCTGGAACAGCTGGG - Intergenic
987910724 5:24140866-24140888 TAGGTAAATCTGTCACAGCTTGG + Intronic
988670475 5:33375911-33375933 CAGCTAATGATGACACAGCCAGG + Intergenic
988911242 5:35845876-35845898 TAGCCACAGCTGGAACAGCTGGG + Intergenic
989148561 5:38273556-38273578 CTGCTAAAGCTGTCACAGCACGG - Intronic
992258875 5:74950283-74950305 TCACTAAAAGTGGCACAGCCGGG - Intergenic
993153621 5:84193022-84193044 TAGCTAGAACAGGCACAGCAAGG + Intronic
994353684 5:98773197-98773219 GAGCTGAAGCTGGCAGGGCCAGG + Intronic
995410903 5:111855991-111856013 TAACCAAAGCTGGCCCACCCAGG - Intronic
996453729 5:123656398-123656420 TGGCTAGAGCTGGAACAGCTGGG + Intergenic
997246573 5:132355144-132355166 CAGCTGGAGCTGGAACAGCCTGG - Intergenic
998321770 5:141239249-141239271 TGGCTAAAGTTGGCACAGTTGGG + Intergenic
1005842360 6:29752171-29752193 TTGCTAGAGCTGGCACAGGGAGG - Intergenic
1006190525 6:32204968-32204990 TAGCTATAGGTGGCAGAGCTGGG + Intronic
1007003128 6:38333885-38333907 TAGGTAGAACTGGAACAGCCTGG + Intronic
1010185451 6:73138711-73138733 TGGGAAAAACTGGCACAGCCTGG + Intronic
1012900347 6:104997782-104997804 TAGCTAAGGCTGACACTTCCGGG + Intronic
1013430051 6:110047665-110047687 TAGCTGCAGCTGGTACACCCAGG + Intergenic
1014771772 6:125465563-125465585 CAGCCACAGCTGGCACAGCTGGG - Intergenic
1015555177 6:134453778-134453800 AAGCTAATGCTGGCAGAGCTGGG + Intergenic
1016192766 6:141291088-141291110 TAGCTCATACTGGCAGAGCCAGG + Intergenic
1019720862 7:2569706-2569728 CATCTACAGATGGCACAGCCAGG - Intronic
1021754010 7:23833666-23833688 TAGCCACAGCTGGAGCAGCCAGG - Intergenic
1021901089 7:25286476-25286498 TAGCTAAAGTTAGACCAGCCAGG - Intergenic
1023780562 7:43651494-43651516 CTGCTCAAGCTGGCACAGGCTGG + Intronic
1024301445 7:47890297-47890319 TAGCTAAAGCTGGCACAGCCGGG - Intronic
1024563423 7:50663127-50663149 GAGATAAAGCCAGCACAGCCTGG + Intronic
1024897897 7:54281530-54281552 CAGCTAAATCAGGAACAGCCTGG - Intergenic
1025076816 7:55951020-55951042 TAGGTAAATCTGGACCAGCCAGG + Intergenic
1025962064 7:66231525-66231547 CAGCTAAGGCTGGCACTGCTGGG + Intronic
1026603567 7:71796920-71796942 TCGCTAGAGCTTGCACACCCAGG - Intronic
1031120597 7:117717129-117717151 TGGCAAGAGCTGGCACAGCATGG - Intronic
1031193887 7:118588490-118588512 CAGCTGAAGCTGGAGCAGCCAGG + Intergenic
1031595514 7:123645614-123645636 TACCACAAGCTGGCACAGCTGGG + Intergenic
1032837004 7:135683867-135683889 TAGAGAAAGCTGGAACAGACAGG - Intronic
1033885013 7:145933996-145934018 TAGCCAAAGCTGGAGCAGCTGGG - Intergenic
1035467062 7:159086436-159086458 AAGCAAAAGCTGTGACAGCCTGG + Intronic
1035638664 8:1165367-1165389 TACCAAGCGCTGGCACAGCCGGG + Intergenic
1036914988 8:12796470-12796492 CAGCTAAGGCTGGCACTGCTCGG - Intergenic
1048197406 8:132343489-132343511 TACCCAAAGCTGGCAGAGGCTGG + Intronic
1051547683 9:18294554-18294576 TAGTCTAAGCTGGCACTGCCTGG + Intergenic
1051799728 9:20918958-20918980 TAGCTACGGCTGCCACAGGCTGG + Intronic
1056695428 9:88846369-88846391 AGGCTGAAGCTGGGACAGCCAGG - Intergenic
1060645417 9:125274878-125274900 TAGCCAAAGATTGCACAGCTAGG + Intronic
1062268070 9:135696420-135696442 TCACAAAAGCAGGCACAGCCCGG + Intronic
1186420494 X:9421755-9421777 TTCCTAAAGATGGCACAGACAGG + Intergenic
1187894446 X:23967118-23967140 TAGCCAAAGCTGGAGCAGCTAGG + Intergenic
1188487475 X:30699062-30699084 TATCTAAAGCTCCCAGAGCCTGG + Intronic
1189198789 X:39174296-39174318 CAGCTAGGGCTGCCACAGCCAGG + Intergenic
1193120600 X:77819256-77819278 TGTCTAAAGCTTTCACAGCCTGG + Intergenic
1193862798 X:86691778-86691800 TAGCTAAGGCTGCCACAGACAGG - Intronic
1195497411 X:105552670-105552692 ATGCTGAAGGTGGCACAGCCTGG + Intronic
1196286405 X:113885924-113885946 TAGCTTGAGCTGGCAGACCCGGG + Intergenic
1197274073 X:124457574-124457596 TGCCTAAAGCTGGGGCAGCCTGG + Intronic
1197473428 X:126891063-126891085 TACCTAAAGCTGGAGCAGCTGGG + Intergenic
1199243445 X:145575138-145575160 TAGCTAGAGCTGGGGCAGCAGGG - Intergenic
1199844664 X:151682164-151682186 CAGCTTAAGCTGCCACATCCAGG - Intergenic
1200692680 Y:6322897-6322919 TAGTTAATGCTGGTACATCCTGG - Intergenic
1201042593 Y:9851829-9851851 TAGTTAATGCTGGTACATCCTGG + Intergenic
1201066020 Y:10095048-10095070 GACCTAAAGCTAGCACAGCATGG + Intergenic
1201569528 Y:15399331-15399353 TGGCTGAAGCTGGAACAGCTGGG - Intergenic