ID: 1024305483

View in Genome Browser
Species Human (GRCh38)
Location 7:47925639-47925661
Sequence TGTGCCTCAATTCCAATGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 602
Summary {0: 1, 1: 8, 2: 114, 3: 208, 4: 271}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024305483_1024305487 6 Left 1024305483 7:47925639-47925661 CCTCCCATTGGAATTGAGGCACA 0: 1
1: 8
2: 114
3: 208
4: 271
Right 1024305487 7:47925668-47925690 CAGCATTAACATTTAAACAGAGG 0: 1
1: 5
2: 17
3: 35
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024305483 Original CRISPR TGTGCCTCAATTCCAATGGG AGG (reversed) Intronic
900029186 1:358695-358717 TCTGCCCAAATTCCAAAGGGAGG + Intergenic
900049788 1:587467-587489 TCTGCCCAAATTCCAAAGGGAGG + Intergenic
900813286 1:4824648-4824670 TGTGCCTAAACTCCAAATGGAGG + Intergenic
902739327 1:18423877-18423899 TGTGCCTGAATTCCAAAGTGGGG - Intergenic
903133263 1:21292848-21292870 TCTGCCTCACTCCCACTGGGTGG + Intronic
906300045 1:44674922-44674944 TATGCCTCAACCCCACTGGGTGG - Intronic
908662088 1:66447730-66447752 TGTGCCTGAATTCCAAAGAGAGG - Intergenic
909199884 1:72677684-72677706 TGTGCATAAATTTCAGTGGGAGG + Intergenic
909201581 1:72695842-72695864 TGTGTCTGAATTCCAAAGAGAGG + Intergenic
910577151 1:88777784-88777806 AGTACCTGAATTCCAAAGGGAGG - Intronic
911646090 1:100338438-100338460 TGTACCTGAATTCTAAAGGGAGG + Intergenic
912940262 1:114038557-114038579 TGTGCCTGAATTCCAACAGGAGG - Intergenic
913173596 1:116254212-116254234 TGTGCTTGAACTCCAAAGGGAGG - Intergenic
913652654 1:120933129-120933151 TGTGCCTGAATTCCAAAGGAAGG - Intergenic
914080941 1:144411092-144411114 TGTGCCTGAATTCCAAAGGAAGG + Intergenic
914168446 1:145195920-145195942 TGTGCCTGAATTCCAAAGGAAGG + Intergenic
914175856 1:145279623-145279645 TGTGCCTGAATTCCAAAGGAAGG + Intergenic
914530575 1:148521108-148521130 TGTGCCTGAATTCCAAAGGAAGG + Intergenic
914642837 1:149627250-149627272 TGTGCCTGAATTCCAAAGGAAGG - Intergenic
915278306 1:154805069-154805091 TATGCCCCATTTCCCATGGGAGG + Intronic
915577938 1:156793390-156793412 TGTGCCTCAAAGCAAATGTGGGG - Intronic
915632356 1:157162433-157162455 TGTGCCTGAATTCCAAAGGGAGG + Intergenic
915708362 1:157869171-157869193 TGTGCCTGAGTTCCAAAGGCAGG + Intronic
916354957 1:163894822-163894844 TGAGCCTCTATTCCTAGGGGTGG - Intergenic
916951153 1:169781582-169781604 TGTGCCTGAATTCCAAAGGGAGG - Intronic
917123059 1:171661199-171661221 TGTGTCTAAATTCTAAAGGGAGG + Intergenic
917152906 1:171963971-171963993 TGTGCCTGAGTTTCAAGGGGAGG - Intronic
917257031 1:173126607-173126629 TGTGCCTGAATTGCAAAGGGAGG + Intergenic
917410080 1:174750289-174750311 TGTGCCTGAACTCCAAAGGGAGG + Intronic
918050808 1:180971107-180971129 TCTTCCTCACTTCCAGTGGGTGG + Intergenic
919013483 1:191996445-191996467 AGTACTTCAATTTCAATGGGTGG + Intergenic
919171753 1:193962923-193962945 TGTGCTTCATTTCCAATTAGTGG - Intergenic
919323890 1:196081064-196081086 TGTGTCTAAACTCCAAAGGGAGG - Intergenic
920795318 1:209131164-209131186 TGTTCCTGAATTCCAAAGGAAGG - Intergenic
921665830 1:217869697-217869719 GGTGCCTGAATTCCAAAGGGAGG + Exonic
921776077 1:219101721-219101743 TGTGCCTGAATTCCAAAGGAAGG - Intergenic
922047925 1:221964719-221964741 TGTGCCTGAATTCCACAGGGAGG - Intergenic
922075196 1:222236684-222236706 TGTGCCTGAATTCCATAGGGAGG + Intergenic
922166475 1:223119574-223119596 TGTGCCTGAATTCCAAAGGGAGG - Intronic
922237123 1:223730676-223730698 TGTGCCTGAATTCCTAAAGGAGG + Intronic
922276404 1:224082867-224082889 TGTGCCTGAATTCCAAAGAGAGG - Intergenic
922895105 1:229093804-229093826 TGTGCCTGAACTCCAAAGGGAGG - Intergenic
923328787 1:232903482-232903504 TCTGCCTGAATTCCAAAGGGAGG + Intergenic
923384520 1:233453222-233453244 TGTACCTAAATTCCAAAGAGAGG - Intergenic
923657474 1:235930676-235930698 TGTGCCTAAACTCCAAAGGGAGG + Intergenic
923803874 1:237237485-237237507 TGTGCCTGAATTCCAAAGGGAGG - Intronic
924573193 1:245256708-245256730 TGTGCCTGAATTCCAAGGGGAGG - Intronic
924902502 1:248416660-248416682 TGTGCCTAAACTCCAAAGAGAGG + Intergenic
924907424 1:248471057-248471079 TGTGCCTAAATTCCAAAAGATGG + Intergenic
1064098790 10:12445169-12445191 CGTGCCCGAATTCCAAAGGGAGG + Intronic
1064452491 10:15455203-15455225 TGTGCCTGAATACCAAAGGGAGG - Intergenic
1064619776 10:17203097-17203119 TGTGCCTGAACTCCAAAGAGAGG + Intergenic
1065058158 10:21868845-21868867 TGTGCCTAAACTCCAAAGGGAGG - Intronic
1065839099 10:29685746-29685768 TTTGCCTGAACTCCAAAGGGAGG + Intronic
1066192902 10:33072052-33072074 TGAGCCTGAATTCCAAAGGGAGG - Intergenic
1067341462 10:45408629-45408651 TGTGCCTGAATTCCAAGAGGAGG + Intronic
1068197176 10:53731974-53731996 TTTGCCTAAATTCCAAAGCGAGG + Intergenic
1068505370 10:57893551-57893573 TGTGCCTGGATTCCAAAGGGAGG + Intergenic
1068830181 10:61484998-61485020 GGTGCCTGAATTCCAATGGGAGG + Intergenic
1069248724 10:66243079-66243101 TGTGCCTGAATTCCAAAGGGAGG - Intronic
1071274476 10:84040519-84040541 TGTGCCTGAACTCCAAAGGGAGG + Intergenic
1071287320 10:84161149-84161171 TGTGCCTGAATTCCAACGGGAGG + Intergenic
1071434131 10:85631158-85631180 TGAGCCTCAATTTCCCTGGGTGG - Intronic
1071863043 10:89695543-89695565 TGTGCCTGAATTCCAAAGGGAGG - Intergenic
1073541627 10:104319873-104319895 TGTGCCTGAATTCCAGAGGGAGG - Intronic
1073848660 10:107588703-107588725 TGTGCCTAAACTCCAAGGGGAGG + Intergenic
1075226086 10:120630457-120630479 TGTGCCTGAATTCCAAAGGGAGG - Intergenic
1075574945 10:123571325-123571347 TGGGCCTCAACTCCAGTGGGAGG - Intergenic
1076471648 10:130723255-130723277 TGTGCCTGAATTCCAGAGGAAGG + Intergenic
1076832493 10:133003313-133003335 TGTGCCTGAATTCCAAAAGGGGG + Intergenic
1076902302 10:133345947-133345969 TTTGCCTGAATTCCAAAAGGAGG + Intronic
1076997554 11:306120-306142 TGTGCCTAAACTCCACAGGGAGG + Intergenic
1077558193 11:3237600-3237622 TGTGCCTGAATTCCAAAGGCAGG + Intergenic
1077559192 11:3246788-3246810 TGTGCCTGAATTCCAAAGGGAGG + Intergenic
1078416881 11:11173299-11173321 AGTGCCTCATTCCCAAAGGGGGG - Intergenic
1079264686 11:18919947-18919969 TGTGTTTCAATTGCAATGGAAGG + Intergenic
1079884707 11:25972732-25972754 TGTGCCTGAATTCCAATGGGAGG + Intergenic
1079891071 11:26053905-26053927 TGTGCCTAAATTCCAAAAGGAGG + Intergenic
1079893706 11:26092016-26092038 TGTGTCTGAATTCCAATGGGAGG + Intergenic
1080777669 11:35401472-35401494 TGTACCTGAATTCCAAAGGAAGG + Intronic
1081530766 11:43957791-43957813 TGTGCCTAAGCTCCAAAGGGAGG + Intergenic
1083083105 11:60113977-60113999 TGTGCCTGAATTCCAAAGGGAGG + Intergenic
1083083135 11:60114262-60114284 TGTGCTTGAATTTCAAAGGGAGG + Intergenic
1083105206 11:60350915-60350937 TGTGCCTGAATTCCAAAGAAAGG - Intronic
1083239595 11:61377611-61377633 TGTGCCTGAATTCCAAAGGGAGG + Intergenic
1084046445 11:66570999-66571021 TGTGCCTCAATTCCAAAGGGAGG - Intergenic
1084744640 11:71161139-71161161 TGTGCCTGAATTCCAAAGGGAGG - Intronic
1085489669 11:76903573-76903595 TGTGCCTAAACTCCAATGGGAGG - Intronic
1085619608 11:78027952-78027974 TGTGCCTGAATTCCAAAAGGGGG + Intronic
1085831031 11:79901138-79901160 TGTGCCTGAATTCCAAAGGGAGG - Intergenic
1085951014 11:81331519-81331541 TGTGCCTCAAGGCCAATAGTTGG - Intergenic
1086203829 11:84234678-84234700 TGTGCCTGAATTCCAACGGGAGG - Intronic
1086272016 11:85079338-85079360 GGTGCCTGAATTCCAAGAGGAGG + Intronic
1086272491 11:85083845-85083867 TGTGCCTAAATTCTAAGGGGAGG + Intronic
1086390383 11:86357280-86357302 TGTGCCTTAACTCCAAAGGGAGG - Intergenic
1086751973 11:90507641-90507663 TGTGCCTAAACTCCAAAGGGAGG + Intergenic
1086782273 11:90922176-90922198 TGTACCTGAATTCCAAAGGGAGG + Intergenic
1087302876 11:96456244-96456266 TGTGCCTGAATTCCAAAGGAAGG - Intronic
1088330034 11:108641895-108641917 TGTGCCTGAATTCCAAAGGGAGG - Intergenic
1088561754 11:111122301-111122323 TGTGTCTAAACTCCAAAGGGAGG - Intergenic
1089735374 11:120547082-120547104 TGTGCCTCAGTTCCTTTGCGTGG + Intronic
1089845902 11:121458060-121458082 TGTCCCTCCATTACAGTGGGTGG - Intronic
1090290061 11:125535394-125535416 TGTCCCTGAATTTCAAAGGGAGG - Intergenic
1091386167 12:96732-96754 TGTGCCTGAATTCCTAAGGGAGG + Intronic
1092304045 12:7281310-7281332 TGTGCCTGAATTCCAAAGGGTGG - Intergenic
1092895620 12:13007470-13007492 TGTGCCTGAATTCCAAAAGGAGG - Intergenic
1093762316 12:22924222-22924244 TGTGCTTGAATTCCAAAGGGAGG - Intergenic
1093812219 12:23504851-23504873 TGTGCTTGAACTCCAAAGGGAGG - Intergenic
1095268107 12:40183596-40183618 TGTGCCTGGATTCCAAAGAGAGG - Intergenic
1095497608 12:42801782-42801804 TGTGCCTGAATTCCAAAGGGAGG + Intergenic
1096421492 12:51462415-51462437 GGTGGCTCAATTCTAATGGAGGG - Exonic
1097459765 12:59846627-59846649 TGTGCCTGAATTCCAAAGGGAGG + Intergenic
1097517667 12:60625225-60625247 TGTGCCTGAGTTCCAAAGGAAGG + Intergenic
1098204954 12:68098808-68098830 TGTGCCTGAATTCCAAAAAGAGG - Intergenic
1098584491 12:72139882-72139904 TGTGCCTGAATTCCAAAGGGAGG - Intronic
1098876594 12:75872164-75872186 TGTACCTGAATTCCAAAGGGAGG - Intergenic
1099227460 12:79986697-79986719 TGTGCCTCAGTTCTAATGATGGG + Intergenic
1099544112 12:83955087-83955109 TGTACCTGAATTCCAAAGGGAGG - Intergenic
1099802019 12:87469522-87469544 TGTGCCTGATTTCCAAAGGGAGG - Intergenic
1100299102 12:93290802-93290824 TGTACCTGAATTCCAAAGGGAGG - Intergenic
1101405217 12:104422648-104422670 TGTGCCTAAATTCCAATGGGAGG + Intergenic
1101537024 12:105627805-105627827 TGTGACTAAATTCCAGTGAGAGG + Intergenic
1102444409 12:112990822-112990844 TGTGCCTGAATTCCAAAGGGAGG + Intronic
1104247061 12:127053741-127053763 TGTGCCTCAGCTGCAATGAGAGG - Intergenic
1104355334 12:128080178-128080200 TGTGCCTGAATTCCAAAGGGAGG - Intergenic
1104530468 12:129565469-129565491 TGTGCCTGAATTCCAAAGGGAGG + Intronic
1104694074 12:130850168-130850190 TTTTCCTGAATTCCAAAGGGAGG - Intergenic
1104914016 12:132255192-132255214 TGTTCCAGAATTCCAAAGGGAGG - Intronic
1105031733 12:132888675-132888697 TATACCTGAATTCCAAAGGGAGG - Intronic
1106434495 13:29711942-29711964 TGTTCCTGAATTCCAAAGGCAGG + Intergenic
1106836270 13:33638687-33638709 TGTGCCTGAATTCTAAAAGGAGG + Intergenic
1106927924 13:34632418-34632440 TGTGCCTGAATTCCAAAGGGGGG - Intergenic
1107117408 13:36762048-36762070 TGTGCCTGAATTCCAAAGGGAGG + Intergenic
1107155818 13:37166026-37166048 TGTGCCTGAATTCCCAAGAGAGG - Intergenic
1107911264 13:45107778-45107800 TGTGCCTGAATTTCAAAGGGAGG + Intergenic
1108298869 13:49054069-49054091 TGTGCCTGAACTCCAAAGGGAGG + Intronic
1108940006 13:55941014-55941036 TGTGCCTGAATTCTAAAAGGAGG - Intergenic
1109177641 13:59176079-59176101 TGTGCCTGAATTCCAACAGGAGG + Intergenic
1109342524 13:61079208-61079230 TGTGCCTGAATTCCAAAGGGAGG - Intergenic
1111034019 13:82646732-82646754 TGTGCCTCAATCCAAGTGGCAGG - Intergenic
1111529521 13:89518529-89518551 TGTGCCTAAACTCCAACGGGAGG - Intergenic
1112185945 13:97127900-97127922 TGTGCCTGAATTCCAGAGGGAGG + Intergenic
1112886665 13:104182019-104182041 TGTGCCTGAATTCCAAAGGGAGG + Intergenic
1113479517 13:110610250-110610272 TGTGCCTGAATTCCAAGGCATGG - Intergenic
1113479778 13:110612013-110612035 TGTGCCTGAATTCCAAAGGGAGG - Intergenic
1114426302 14:22626429-22626451 TGTGCCTGAATTCCAAAGGGAGG - Intergenic
1115060079 14:29176881-29176903 TGTGCCTGAATTCCAAAGGGAGG - Intergenic
1115933532 14:38526045-38526067 TGTGCCTGAATTCCAAAGGGAGG + Intergenic
1116118914 14:40695899-40695921 TGTGCTTGAATTCCAAAGAGTGG + Intergenic
1116395891 14:44448398-44448420 TGTGTCTGAATTCCAAAGGGAGG + Intergenic
1116978550 14:51142804-51142826 TGTGCCTGAATTCCAAAAGGAGG + Intergenic
1118158596 14:63266311-63266333 TGTGCCTAAATTCCAAAGGGAGG + Intronic
1118380421 14:65213531-65213553 TGTGCCTGAATTCCACAGGGAGG + Intergenic
1118441301 14:65814228-65814250 TGTGCCCGAATTCCAAAGGGAGG + Intergenic
1118491563 14:66265949-66265971 TGTCCCTGAATTCCAAAGAGAGG + Intergenic
1120267707 14:82272565-82272587 TCTGCCTGGATTCCAAAGGGAGG + Intergenic
1120267997 14:82275733-82275755 TGTGCCTAAATTCCAGAGGAAGG + Intergenic
1120357770 14:83456385-83456407 TGTGCCTGAATTCCAAAGGGAGG - Intergenic
1120407283 14:84104912-84104934 TGTGCCTAAATTCTAAAGGGAGG - Intergenic
1120769664 14:88365274-88365296 TGTGCCTGAACTTCAAAGGGAGG + Intergenic
1120970490 14:90203006-90203028 TGTGCCTGAATTCCCAGTGGAGG - Intergenic
1121425008 14:93844327-93844349 TGTGCCTGAATTCCAAAAGGAGG + Intergenic
1122351436 14:101095587-101095609 TGTGCCTGAACCCCAAAGGGAGG - Intergenic
1122659387 14:103284404-103284426 TGTGCCTGAACTCCAAAGGCAGG - Intergenic
1122988603 14:105225423-105225445 TGTGCCTGAACTCCAAAGGGAGG - Intronic
1123137428 14:106041722-106041744 GGTGCCTTAATTCCAAAGAGAGG + Intergenic
1123159245 14:106261763-106261785 TGTGCTTGAATTCCAAAGTGAGG + Intergenic
1123160358 14:106272631-106272653 TGTGCTTGAATTCCAAAGGGAGG + Intergenic
1123178913 14:106448631-106448653 TGTGCTTGAATTCCAAAGGGAGG + Intergenic
1123208012 14:106732365-106732387 TGTGCTTGAATTCCAAAGGGGGG + Intergenic
1123212965 14:106778420-106778442 TGTGCTTGAATTCCAAAGGGAGG + Intergenic
1123481439 15:20635961-20635983 TGTGCTTGAATTCCAAAGGCAGG + Intergenic
1123636573 15:22364404-22364426 TGTGCTTGAATTCCAAAGGCAGG - Intergenic
1124027919 15:25983881-25983903 TGTGCCTGAATCCCAAAGGGAGG + Intergenic
1124208752 15:27744884-27744906 TGTGCCTGAATTCCAAAGGGAGG - Intergenic
1124245372 15:28066450-28066472 TGTGCCTGAATTCCAACGGGAGG - Intronic
1124603422 15:31152597-31152619 TGTGCCTAAATTCCAAAAGAAGG - Intronic
1125844680 15:42841004-42841026 TGTGGCTCAATTCTTTTGGGGGG - Intronic
1126158281 15:45585586-45585608 TCAGCCTGAATTCCAAAGGGAGG + Intergenic
1127398348 15:58561829-58561851 TGTGCCTGAATTCCAAAGGGAGG + Intronic
1127670664 15:61191618-61191640 AGTGTCTCAATTCCATTGGAAGG - Intronic
1127851348 15:62914678-62914700 TGTGCCTGAATTCCAAAGGGAGG + Intergenic
1128218279 15:65949550-65949572 TGGGCCCCAAATCCTATGGGAGG + Intronic
1128742151 15:70091336-70091358 AGTGCCTCAAATCCAATGCATGG + Intronic
1129927086 15:79374323-79374345 TGTGCCTGAATTCCAAAGGAAGG + Intronic
1130695053 15:86122839-86122861 TGTGCCTGAATTCCAAAGGGAGG - Intergenic
1131463601 15:92637253-92637275 TGGGCCTCAAGGCCAGTGGGAGG - Intronic
1132263610 15:100446858-100446880 TGTGCCTGGATTCCAAAGGAAGG - Intronic
1132536417 16:483410-483432 TGGGCCTCAGTTCCAAAGGGAGG - Intronic
1133137116 16:3719871-3719893 TGTGCCTCATTTCCAAGGGGTGG + Intergenic
1134002096 16:10790908-10790930 TGTGCCTGGATTCCAATGGGAGG + Intronic
1134338672 16:13325368-13325390 TGTGCCTAAACTCCAAAGGGAGG + Intergenic
1135225058 16:20648542-20648564 TTTGCCTGAATTCCAAAGGAAGG - Intronic
1135323236 16:21510580-21510602 TGTACCTGAATTCCAGAGGGAGG - Intergenic
1135788600 16:25372858-25372880 TGTGCCTAAACTCCAAAAGGGGG - Intergenic
1136289581 16:29263448-29263470 TGGGCCTGAATTCCATAGGGAGG + Intergenic
1136334720 16:29603767-29603789 TGTACCTGAATTCCAGAGGGAGG - Intergenic
1138031602 16:53563655-53563677 TGTGCCTGAATTCCAAAGGGAGG + Intergenic
1138261718 16:55628401-55628423 TGTGCCTGAATTCCAAAGGGAGG + Intergenic
1138331126 16:56216329-56216351 CCAGCCTCAATTCCACTGGGAGG + Intronic
1141030318 16:80581851-80581873 TGGGCCTGAATTACAAAGGGAGG - Intergenic
1141411891 16:83840777-83840799 TGTGCCTGAATTCCAAAGGAAGG + Intergenic
1141583363 16:85016005-85016027 TGTGCCTAAATTCCAACAGGAGG + Intergenic
1142035436 16:87859603-87859625 TGTACCTGAATTCCAGAGGGAGG - Intronic
1142095317 16:88236428-88236450 TGGGCCTGAATTCCATAGGGAGG + Intergenic
1144144053 17:12380259-12380281 TGTGCCTGAATTCCAAAGGCAGG - Intergenic
1145027903 17:19482774-19482796 TGTGCCTGAATTCCAAAGGGAGG - Intergenic
1145031846 17:19510443-19510465 TGTGCCTGAATTCCAAAGGGAGG + Intronic
1148951836 17:51320164-51320186 TGTGCCTGAATTCCAAAGGGAGG + Intergenic
1150623330 17:66824416-66824438 CCTGCCTCTATTCCCATGGGTGG - Intergenic
1151872527 17:76845971-76845993 TGTGCCTTAAGTACGATGGGAGG - Intergenic
1152137491 17:78513196-78513218 TGTGCCTGAATCCCAAAGGGAGG - Intronic
1152871419 17:82755574-82755596 TGTGCCTGAATTCCAACGAGAGG + Intronic
1152950572 17:83227861-83227883 TCTGCCCAAATTCCAAAGGGAGG - Intergenic
1153023740 18:655822-655844 TGTGCCTAAATTCCAAACGGAGG - Intronic
1153084494 18:1268798-1268820 TGAGCCTCACATCCAATGGCAGG + Intergenic
1153121985 18:1739722-1739744 TGTGCCTGAATTCCAAAGGCAGG + Intergenic
1153432998 18:5039234-5039256 TGTGCCTGAATTCCAAAGGGAGG + Intergenic
1153750045 18:8219958-8219980 TGTGCCTAAACTCCAAAAGGGGG + Intronic
1153889068 18:9495687-9495709 TATGTCTGAATTCCAAGGGGAGG - Intronic
1154113527 18:11591047-11591069 TGTGCCTGAATTCCAAAGCAGGG + Intergenic
1154175213 18:12082781-12082803 TGCGCTTCAATTCCAAGGGTAGG - Intergenic
1155197094 18:23485573-23485595 TGTGCCTGAATTCCAAAGTGGGG - Intronic
1155294369 18:24371732-24371754 TGAGCCTCATCTGCAATGGGTGG - Intronic
1156133221 18:34003900-34003922 TGTGCCTGAATTCCAAAGGGAGG - Intronic
1156151837 18:34252248-34252270 TGTACCTGAATTCCAATGGGGGG + Intergenic
1156185668 18:34660306-34660328 TGTGCCTGAATTCCAAAGGGAGG - Intronic
1156696910 18:39778561-39778583 TGTGCCTCCCTTACTATGGGAGG - Intergenic
1156988460 18:43377504-43377526 TGTGCTTGAACTCCAAAGGGAGG - Intergenic
1157504326 18:48216014-48216036 CGTGCCTGAATTCCAAAAGGAGG + Intronic
1157669405 18:49515561-49515583 TGGAGCTCAATTCCTATGGGGGG + Intergenic
1157876883 18:51282068-51282090 TGTGCCTGAATTCCAAAAGGAGG + Intergenic
1158164932 18:54529638-54529660 TGTGCCTAAATTCCAAAGGGAGG + Intergenic
1159670489 18:71215170-71215192 TGTGTCTGAATTCCAAAGGGAGG + Intergenic
1159831865 18:73286834-73286856 TGTTCATCATTTCCAATGGCAGG + Intergenic
1159992690 18:74928728-74928750 TGTGCCTGAACTCCAAAGGGAGG + Intronic
1160543743 18:79639307-79639329 TGTGCCTGAATTCCAGAGGGAGG - Intergenic
1161231591 19:3177431-3177453 TGCACCTCAATCCCAGTGGGGGG + Intronic
1161889156 19:7021547-7021569 AATGCTTCAAATCCAATGGGTGG - Intergenic
1161890197 19:7030435-7030457 AATGCCTCAAATCCAATGGGCGG + Intergenic
1161891252 19:7040299-7040321 AATGCCTCAAATCCAATGGGCGG - Intergenic
1161892296 19:7049202-7049224 AATGCTTCAAATCCAATGGGTGG + Intergenic
1161893337 19:7058760-7058782 AATGCCTCAAATCCAATGGGCGG - Intergenic
1162204362 19:9044649-9044671 TGTGCTTAAACTCCAAAGGGAGG - Intergenic
1163283455 19:16331380-16331402 TGTGCCTCAGTTTCCTTGGGTGG + Intergenic
1163322126 19:16581040-16581062 TCTGCCCCACTTCCAGTGGGAGG + Intronic
1163617366 19:18337410-18337432 GTTTCCTCAATTGCAATGGGAGG - Intergenic
1164446790 19:28324486-28324508 TGTGCCTGAATTCCAATAGGGGG - Intergenic
1164636098 19:29792499-29792521 TGTGCCTCCATTCCAGGAGGAGG + Intergenic
1165391087 19:35539309-35539331 TATGCCTGAATTCCAAAGGGAGG + Intronic
1166790793 19:45397173-45397195 TGTGCCTGAATTTCCATGGCCGG - Intronic
1167302335 19:48685445-48685467 TGAGCCTGAATTACAATGGCAGG + Intergenic
1168536246 19:57172671-57172693 TGTGCCTGAATTTCAAAGAGAGG - Intergenic
1168584221 19:57579570-57579592 TGTGCCTGAATTCCAAGGGGAGG + Intronic
1168691228 19:58378763-58378785 TGTGCCCTAATTCCAATGACAGG + Intronic
926382464 2:12304025-12304047 TGTGCCTGAATTCCAAAGAGAGG - Intergenic
928243079 2:29603516-29603538 TGTGCCTGCATTCCAAAGGAAGG + Intronic
928604738 2:32935292-32935314 TGTGCCTGAATTCCTAAGGAAGG - Intergenic
929211752 2:39365254-39365276 TGAGCTTGAATTCCAAAGGGAGG + Intronic
929299744 2:40289468-40289490 AGTAGCTCAATTCCAATGGCTGG - Intronic
930285461 2:49422405-49422427 TGTGCCTAAATTCCAAAGGCAGG - Intergenic
930488341 2:52037024-52037046 TATGCCTGAATTCCAACAGGAGG - Intergenic
930741007 2:54832486-54832508 TGTGCCCCAAATCCAAAGTGAGG + Intronic
931042180 2:58313094-58313116 TGTGCCTGAATTCCAAAGGGAGG + Intergenic
932959721 2:76398350-76398372 TGTGCCTGAATTCCAAAGGGAGG - Intergenic
933345384 2:81078497-81078519 TCTGCCTGAATTCCAAAGGGAGG - Intergenic
933389088 2:81648594-81648616 TATGCCTGAATTCCAAAGGGAGG + Intergenic
933432365 2:82199370-82199392 TGTGTTTAAATTCCAAAGGGAGG - Intergenic
934141183 2:89049412-89049434 TGTGTCTGAACTCCAAAGGGAGG - Intergenic
934228056 2:90151133-90151155 TGTGTCTGAACTCCAAAGGGAGG + Intergenic
934537248 2:95145286-95145308 TGTGCCTGAATTCCAAAGAGAGG - Intronic
934881355 2:97983304-97983326 GGTGCCTGAATTCCAAAGGGAGG + Intronic
934940256 2:98496118-98496140 TGTGCCTAAATTTCAAAGGGAGG + Intronic
935161825 2:100535967-100535989 TGTACCTGAATTCCAAAGGGAGG + Intergenic
935807299 2:106761641-106761663 TGTGCCTGATTTCCAACGGGAGG - Intergenic
936586436 2:113762544-113762566 TGTGCCTGAATTCCAAAGGGAGG + Intergenic
936860599 2:117013580-117013602 TATGCCTGAATTCCAAAAGGCGG + Intergenic
937522197 2:122725430-122725452 TGTGCTTGAATTCCAAAGGATGG - Intergenic
937838064 2:126493875-126493897 TGTGCCTAAATTGTAAAGGGAGG + Intergenic
938930019 2:136078534-136078556 TGTGCCTTAATTCCTTTGGGTGG + Intergenic
939423107 2:141999194-141999216 TGTGGCTGAATTCCAATGGGAGG + Intronic
940050580 2:149458383-149458405 GTAGCCTCAATACCAATGGGTGG - Intronic
940153676 2:150630299-150630321 TGGGCCTTAAATCCAATGGCTGG + Intergenic
940704145 2:157082827-157082849 TGTGCCTAAACTCCAAAGGGAGG - Intergenic
942347991 2:175023052-175023074 TGTGCCCCAATTTCAATTTGTGG + Intergenic
942358710 2:175148592-175148614 TGTGCCTGAATTTCAACGGGAGG - Intronic
943548261 2:189308299-189308321 TGTGCCTGAGTGCCAAAGGGAGG - Intergenic
943853750 2:192762284-192762306 GGTGCCACAATTCCACTGGATGG + Intergenic
944043759 2:195385217-195385239 TGTGCCTTAAAGCCAATGGAAGG + Intergenic
944301419 2:198128945-198128967 TCAGCCTGAATTCCAAAGGGAGG - Intronic
945048539 2:205802258-205802280 TGTGCTTCAATTCCCAGTGGAGG - Intergenic
945111336 2:206362932-206362954 TGTGCCTGAATTCCAGAGGGAGG - Intergenic
948021779 2:234739078-234739100 TGTGCCTGAACTGCAAAGGGAGG - Intergenic
948321039 2:237069936-237069958 TGTGCCTGAATTCCAAAGGGAGG - Intergenic
948433877 2:237939038-237939060 TGTGCCTGAACTCCAAAGGGAGG + Intergenic
948717959 2:239877822-239877844 TGTGCCTGAATTAAAACGGGAGG + Intergenic
1168845854 20:944351-944373 TGTGCCTGAATTCCAAAGGGAGG + Intergenic
1169302819 20:4459297-4459319 TGTGCCTGAATTCCAAAGGGAGG - Intergenic
1170074563 20:12405490-12405512 TATGCCTGAATTCCAAAGGGAGG + Intergenic
1170301029 20:14884734-14884756 TGTGCCTCAATTCCAAAGGGAGG - Intronic
1170724158 20:18911103-18911125 TCTGCCTGAATTCCAAAGGAAGG - Intergenic
1171165204 20:22964174-22964196 TGTGCCTGAATTCCAAAAGGAGG + Intergenic
1171235642 20:23522186-23522208 TGTTTCTGAATTCCAAAGGGAGG + Intergenic
1171405854 20:24912022-24912044 TGTGCCTGGATTCAAATGAGAGG - Intergenic
1173746491 20:45441443-45441465 TGTGCCTGAATTCCAAAGGGAGG + Intergenic
1173919941 20:46736705-46736727 TGACCCTCAATTCCAACTGGTGG + Intergenic
1173919947 20:46736736-46736758 TGACCCTCAATTCCAACTGGTGG + Intergenic
1174159100 20:48537852-48537874 TGTGCCTCAATTCCAACAAGAGG + Intergenic
1174323422 20:49760316-49760338 TGTGCCTAAACTCCAAAGGGAGG - Intergenic
1174543240 20:51306246-51306268 CGTGCCTGAATTCCAAAGGGCGG + Intergenic
1174544058 20:51312055-51312077 TGTGCTTGAATTCCAAAGGGAGG + Intergenic
1174913877 20:54635092-54635114 TTTGCCTGAACTCCAAAGGGAGG - Intronic
1175635514 20:60579631-60579653 TGTGCCTGAATTCCAAAGAAAGG + Intergenic
1176230867 20:64032258-64032280 GGTGCCTCAATTCCAGGGTGTGG - Intronic
1176362874 21:6012894-6012916 TGTACCTGAATTCCAAAGGGAGG + Intergenic
1178199602 21:30389210-30389232 TGTCCCACAATTGCAATGGCAGG + Intronic
1178247511 21:30968253-30968275 TGTGCCTAAATTCCAAAGGATGG + Intergenic
1178516732 21:33254259-33254281 TGTGCCTGAATTCCAAAGGTAGG - Intronic
1179760644 21:43525651-43525673 TGTACCTGAATTCCAAAGGGAGG - Intergenic
1182501710 22:30752941-30752963 TGTGCCTGAATTCCAAAGGGAGG + Intronic
1183611155 22:38907249-38907271 TGTGCCTGAATTCCAAAGGAGGG - Intergenic
1183781905 22:40004142-40004164 TCTGCCTTAAGTCTAATGGGGGG + Intronic
1184933352 22:47698434-47698456 TGTGCCTGAACTCCAAAGGGAGG + Intergenic
949293604 3:2494833-2494855 TGTGCCTGAATTCCAAAGGGAGG + Intronic
950753843 3:15155765-15155787 AGTGCCTCAGTTCCAGTGGGAGG + Intergenic
950920636 3:16690616-16690638 TGTGCCTAAATTCCAAAGAGAGG + Intergenic
951449911 3:22825644-22825666 TGAGCTTCCATTCTAATGGGCGG - Intergenic
951662685 3:25087174-25087196 TGTGGCTGAATTCCAAAGGGAGG + Intergenic
951773817 3:26286517-26286539 TGCGCCCGAATTCCAAAGGGAGG - Intergenic
951857454 3:27213654-27213676 TGTGCCTGAATTCCAAAAAGAGG - Intronic
952033793 3:29175831-29175853 TGTACCTGAATTCCAAAGGGAGG + Intergenic
952666024 3:35905421-35905443 TGTGCCTGAATTCCAAAGAGAGG + Intergenic
952850580 3:37725172-37725194 TGTGGCTTCATTCCAGTGGGAGG + Intronic
953320020 3:41962976-41962998 TGTGCCTGTATTCCAACGGGAGG - Intergenic
953378206 3:42446618-42446640 TGTGCCTAAATTCCAAAGGGAGG + Intergenic
953505412 3:43481539-43481561 TGGGCCTGAATTCCAAAGGGAGG - Intronic
955398220 3:58572698-58572720 TTTCCTTCACTTCCAATGGGTGG + Intronic
955541787 3:59984378-59984400 TGGGGCTCAAATCCACTGGGGGG + Intronic
957128899 3:76198309-76198331 TGTGCCTAAATTCCAAAGGGAGG - Intronic
957165052 3:76662058-76662080 TATGCCTGAATTCCAAAGAGAGG + Intronic
957393809 3:79615102-79615124 TGTGCCTAAATTGCAAAGGGAGG - Intronic
959376581 3:105595149-105595171 TGTGCCTGAATTCCAAAGGGAGG + Intergenic
960410243 3:117314233-117314255 TGTGCCTAAATTCCAAAGGGAGG - Intergenic
960569924 3:119175656-119175678 AGTCCCTGATTTCCAATGGGTGG + Intronic
961470872 3:127111162-127111184 TGTGCCTAAACTCCAAAGCGGGG - Intergenic
961689825 3:128661164-128661186 TGTGCCTGAATTTCAACGAGAGG + Intronic
962749281 3:138421544-138421566 TGTGCCTGAATTCCAAAGAGGGG + Intergenic
963058091 3:141203996-141204018 TGTGCCTGAGTTCCAAAGGGAGG + Intergenic
963226615 3:142868954-142868976 TGTGCCTGGATTCCAAAGGGAGG - Intronic
963470400 3:145734726-145734748 TGTGCCTGAATTCCAAAGGGAGG + Intergenic
963756446 3:149239525-149239547 TGTGCCTGAATTCCAAAGGGTGG + Intergenic
965278230 3:166715584-166715606 TGTGCCAGAATTCCAATGAGAGG - Intergenic
965601800 3:170461951-170461973 TGTCCCTAACTTCCAATGGAGGG - Exonic
965959505 3:174412120-174412142 TCTGCCTGAATTCCAAAGGGAGG - Intergenic
966392654 3:179468592-179468614 TGTGCCTGAATTCCAAAGAGTGG - Intergenic
966994586 3:185267231-185267253 TGTGCCTGAATTCCAAGGGGTGG - Intronic
968561795 4:1287252-1287274 TGTGCCTGAACTCGAAAGGGAGG - Intergenic
969322314 4:6419898-6419920 TGGGCCTCAAGTCCAATGGCTGG - Intronic
969566270 4:7980241-7980263 TGTGCCTGAATTCCGAAGGGAGG - Intronic
969578398 4:8049532-8049554 TTTTCCTGAATTCCAAAGGGAGG - Intronic
969661515 4:8532385-8532407 TGTGCCTGAATTCCAAAGGGGGG + Intergenic
970276222 4:14404048-14404070 TGTGTCTAAATTCCAAAGGGAGG + Intergenic
971277219 4:25209824-25209846 TGAGCCTGAATTCCAAAGGGAGG + Intronic
971689207 4:29811306-29811328 TGTGCCTGAAATCCAAAGGGAGG + Intergenic
971804325 4:31335952-31335974 TGTGCCTGCATTCCAAAGGGAGG + Intergenic
971851857 4:31994488-31994510 TGTGCCTGAATTCCAATAGGAGG + Intergenic
971878771 4:32340561-32340583 TGTGCCTGAATTCCAGCTGGGGG - Intergenic
971919280 4:32915572-32915594 TGTGCCTGAATTCCAAAGGAAGG + Intergenic
971970406 4:33612441-33612463 TGTGCCTGAATTCCAAAGGGAGG + Intergenic
972293426 4:37713629-37713651 TGTGCTTGAATTCCAAAGGGAGG + Intergenic
972322872 4:37988866-37988888 TGTGCCTGAATTCCAGAGAGAGG - Intronic
972565853 4:40268339-40268361 TGTGCCTGAATTCCAAAGAAAGG - Intergenic
973971459 4:56217704-56217726 TGTGCCTGAATTGCAAAGGGAGG + Intronic
974669854 4:65015363-65015385 TGTGCCTGATTTCCAAAGGGAGG + Intergenic
975332633 4:73135118-73135140 TGTGCATCAATATCAATGGCAGG + Exonic
975484995 4:74926158-74926180 TATGCCTGAATTCCAAAGGGAGG + Intergenic
976008739 4:80461555-80461577 TGCGCCTGAATTCCCAAGGGAGG + Intronic
976347383 4:84020280-84020302 TGTGTCTAAACTCCAAAGGGAGG - Intergenic
976696044 4:87920649-87920671 TGTGCCTGAATTCCAAAGGGAGG - Intergenic
976813398 4:89120700-89120722 TGTGCCTAAATTCCAAAGGGCGG - Intergenic
977622455 4:99153065-99153087 TGTGCCTGAATTCCAGGTGGGGG - Intronic
977681318 4:99801551-99801573 TGTGCCTGAATTCCAAAAGGTGG + Intergenic
978551159 4:109928813-109928835 TGTGCCTGAATTCCAACGGGAGG + Intronic
978663712 4:111156747-111156769 TGAGGCTAAATGCCAATGGGAGG - Intergenic
980259817 4:130433655-130433677 TTTGCCTGAATTCCAAAGTGAGG - Intergenic
980306068 4:131063356-131063378 TGTGTCTGAATTCCAAAGAGAGG - Intergenic
980736730 4:136900018-136900040 TGTGCTTGAATTCCAAAGAGAGG + Intergenic
980908709 4:138974627-138974649 TGTGCCTGAATTCCAAAGGTAGG - Intergenic
980982854 4:139669082-139669104 TATGCCTGAATTCCAAAGGGCGG + Intronic
981089203 4:140715207-140715229 TGTGCCTGAATTCCAAAGGAAGG + Intronic
981189643 4:141847065-141847087 TGTGCCTGAATTCTAAAGGGAGG - Intergenic
981312312 4:143309236-143309258 TGTGCCTGAATTCTACAGGGAGG + Intergenic
981422863 4:144571334-144571356 TGTGCCTGAACTCCAAAGGGAGG - Intergenic
981692386 4:147523836-147523858 TGTGCCTAAATTCCAAAGAGAGG + Intronic
981903310 4:149891524-149891546 TGTGTCTGAATTCCAAAGGGAGG + Intergenic
982009544 4:151093389-151093411 TGCACCTGAATTCCAAGGGGAGG + Intergenic
982415015 4:155120773-155120795 TGTGCCTGAATTCCAAAAGGAGG - Intergenic
982428366 4:155293837-155293859 TGTGACTAAATTCCAAAGGGAGG + Intergenic
982500690 4:156151406-156151428 TGTGTCTAAACTCCAAAGGGCGG + Intergenic
982614648 4:157625258-157625280 TGTGTCTGAATTCCAAAGAGAGG + Intergenic
982773152 4:159416487-159416509 TGTGCCTGGATTCCAGTGAGAGG - Intergenic
982787944 4:159558231-159558253 TGTACATGAATTCCAAAGGGAGG + Intergenic
982971893 4:161998980-161999002 TGTGCCGAAACTCCAAAGGGAGG + Intronic
984086775 4:175323222-175323244 TGTGCCTAAACTCCAAAGAGAGG - Intergenic
985054995 4:186028304-186028326 TGTACCTAAACTCCAAAGGGAGG - Intergenic
985608044 5:869254-869276 TGTGCCTGAATTCCAAAAGAGGG - Intronic
986148299 5:5101702-5101724 TGTGCATCAATTCTGTTGGGTGG - Intergenic
986949564 5:13066376-13066398 TGTGCCTGAATTCCAAAGGGAGG + Intergenic
987144881 5:14982460-14982482 TGTGCCTAAACTCCAACGGGAGG + Intergenic
987144974 5:14982990-14983012 TTTGCCTAAACTCCAAAGGGAGG - Intergenic
987586128 5:19859231-19859253 TGTGCCTGAATTCCAAAGGGAGG - Intronic
987740353 5:21900234-21900256 TGTGCCTCAATTCCTGTGGAAGG + Intronic
987965258 5:24864555-24864577 TTTGCCTGAATTCCAAAGGAAGG + Intergenic
988679732 5:33473186-33473208 TGTGCCTGAATTCCAAAGGGAGG - Intergenic
989422124 5:41252393-41252415 TTTGCCTCAACTCCAAAGGGAGG - Intronic
990067286 5:51733969-51733991 TGGGTGTCAATTACAATGGGAGG + Intergenic
992439316 5:76784392-76784414 TGTGCCTGAATTCCAAAGGGAGG + Intergenic
992541874 5:77774090-77774112 TGTTCCTGAGTTCCAAAGGGAGG - Intronic
993272002 5:85808752-85808774 TGTGCCTGAATTTCAAAAGGAGG + Intergenic
993299014 5:86183625-86183647 TGTGCCTGGACTCCAAAGGGAGG - Intergenic
994198498 5:96945659-96945681 TGTGCCAGAATTCCAAAGGGAGG + Intronic
994859256 5:105167342-105167364 TGTGCCTGAATTGTAAAGGGTGG - Intergenic
994867387 5:105293654-105293676 TGTTCCTGAATTCCAAAAGGAGG - Intergenic
995083464 5:108081196-108081218 TGTGCCTGAATTCCAAAAGGAGG + Intronic
995109828 5:108416861-108416883 TGTGCCTGAATTCCAATAGGAGG - Intergenic
995454140 5:112334085-112334107 TGTGCCTGAACTCCAAAGGGAGG - Intronic
995596840 5:113756391-113756413 GGTGCCTGAATTCCAAAGTGAGG - Intergenic
996236443 5:121136690-121136712 TGTGCCCAAATTCCAACAGGAGG - Intergenic
996708172 5:126518122-126518144 TGTGCCTGAATTCCAGTGGGAGG - Intergenic
996998120 5:129724365-129724387 TATGCCTGAATTCCAAAGGGAGG + Intronic
998032629 5:138884682-138884704 TGTGCCTGAATTCCAAAGGGAGG + Intronic
998773368 5:145571363-145571385 TGTGCCTGAATTCCAAAGGGAGG - Intronic
999053131 5:148545463-148545485 TGTCTTTCTATTCCAATGGGAGG - Intronic
999628000 5:153540507-153540529 TCTGCCTCAACTCCCATGGTTGG + Intronic
1000061446 5:157660037-157660059 TGTGCCTGAATTCCAACGGGAGG + Intronic
1000481802 5:161785908-161785930 TGTGCCTGAATTCCAATGGGAGG + Intergenic
1000601028 5:163274661-163274683 TATGCCTGAATTCTAATGGGAGG + Intergenic
1001077005 5:168637455-168637477 TGTGCCTGAATTCCAAAGGGAGG + Intergenic
1001282492 5:170397100-170397122 TGTGCCTGAATACCAAAGGGAGG + Intronic
1002407265 5:179044894-179044916 TGTGCCTAAACTCCAGAGGGAGG + Intergenic
1002652645 5:180712736-180712758 TTTGCCTGAACTCCAAAGGGAGG - Intergenic
1002744804 5:181461676-181461698 TCTGCCCAAATTCCAAAGGGAGG - Intergenic
1003070507 6:2941936-2941958 TGTGCCTGAATTCCAACGGGAGG + Intergenic
1003075232 6:2977901-2977923 TGTGTCTGAATTCCAAAGGGAGG + Intergenic
1005784979 6:29235745-29235767 TATGCCTGAATTCCAAAGGGAGG - Intergenic
1006233961 6:32611202-32611224 TGTGCCTCGATTCTAGAGGGAGG - Intergenic
1006413300 6:33888246-33888268 TGTGCCTCAATCCCTATCGTTGG - Intergenic
1006579952 6:35071487-35071509 TGTGCCTGAATTCCACAGGGAGG + Intronic
1007099204 6:39232934-39232956 TGTGCCTGAATTCCAAAGGGAGG - Intergenic
1008226504 6:48924748-48924770 TGTGCCTAAACTTCAAAGGGAGG - Intergenic
1008464211 6:51812470-51812492 TGTACCTAAATTCCAAAGGCAGG - Intronic
1008649872 6:53551214-53551236 TGTGCCTGAAATCCAAAGGGAGG - Intronic
1009992936 6:70865816-70865838 TGTGCCTCTTTTCCAATGTCTGG - Intronic
1010584661 6:77643214-77643236 TGTGCCTGAATTCCAACAGGAGG + Intergenic
1012227209 6:96717901-96717923 TGTGCCTGAATTCCAACGGGAGG - Intergenic
1012315332 6:97778496-97778518 TGTACCTGAATTCCAAAGGGAGG - Intergenic
1013607350 6:111762463-111762485 TGTGCCTGAACTCCAAAGGGAGG - Intronic
1013888182 6:114996661-114996683 TGTGCCTGAATTCTAAAGGGAGG + Intergenic
1014242707 6:119035317-119035339 TGTCCCTGAATTCCAGTGGGAGG - Intronic
1014252390 6:119128069-119128091 TGTGCCTAAACTCCAAAGGGAGG - Intronic
1015188949 6:130451987-130452009 TGTGATTCAATTACAATGAGAGG - Intergenic
1015681685 6:135815459-135815481 GGTGCCTGAATTCCAAAGGAAGG + Intergenic
1015704154 6:136069020-136069042 TGTGCCTGAATTCCTAAGGGAGG + Intronic
1015751928 6:136569035-136569057 TGTGCCTAAACTCCAAAGGGAGG - Intronic
1015879794 6:137860191-137860213 TGTGCCTGAATTCCAAAGAGAGG - Intergenic
1015986634 6:138891096-138891118 TGTGCCTGAATTCTTAAGGGAGG - Intronic
1016028561 6:139313929-139313951 TGTGCCTGAATTCCAAAGGGAGG - Intergenic
1016293801 6:142552276-142552298 TGTGCCTAAACTCCTAAGGGAGG - Intergenic
1016490742 6:144598761-144598783 TGTGCCTGAATTCCAAAGAGAGG + Intronic
1016681078 6:146830000-146830022 TGTGCCTGAATTCCAATGGGAGG - Intergenic
1017285504 6:152670787-152670809 TGTGCCTCAATTGCCAGGAGGGG - Intergenic
1018759368 6:166877911-166877933 TGTGCCTGAATTCCACTGGGAGG + Intronic
1019003851 6:168779672-168779694 TGGGCCTCACTTCTAATGAGTGG + Intergenic
1019014499 6:168870091-168870113 TGTGTCTGAACTCCAAAGGGAGG - Intergenic
1019249715 6:170735217-170735239 TCTGCCCAAATTCCAAAGGGAGG - Intergenic
1019729478 7:2622430-2622452 TGTGGCTCCATTCCAGGGGGAGG - Intergenic
1019950074 7:4364978-4365000 TATGCCTGAATTCCAGTGGGAGG - Intergenic
1020706789 7:11554244-11554266 TGAGCCCTAAATCCAATGGGTGG + Intronic
1020756883 7:12213949-12213971 TGTGCCTGAATTCCAAAGAGAGG - Intronic
1020782101 7:12530509-12530531 TGCGCCTGAATTCCAAAGGGAGG + Intergenic
1020974536 7:14988656-14988678 TGTGCCTGAATTTCAAAGGGAGG + Intergenic
1021390422 7:20086213-20086235 TGTGCCTGAGTTCTAAAGGGAGG - Intergenic
1023222081 7:37929861-37929883 TGTGCCTCAATTTCAATTTTGGG + Intronic
1023391980 7:39719649-39719671 TGTGCCTGAATTCTAAAGGGAGG + Intergenic
1023731205 7:43194104-43194126 GGTGCCTGAACTCCAAAGGGAGG + Intronic
1023843757 7:44110020-44110042 TGTGACTCCATCCCAATGGGGGG - Exonic
1024122097 7:46253771-46253793 TGTGCCTGAATTCTAAAGGGAGG - Intergenic
1024160614 7:46671249-46671271 TGTGCCTGAATTCCAAAGGGTGG - Intergenic
1024305483 7:47925639-47925661 TGTGCCTCAATTCCAATGGGAGG - Intronic
1024318001 7:48039368-48039390 TGTGCCTGAATTCCAAAGGAAGG + Intronic
1024388440 7:48780127-48780149 TGTGCCTGAATTCCAAAGGAAGG + Intergenic
1024485027 7:49908224-49908246 TGTGCCTGAATTCCAAAAGGAGG + Intronic
1024627021 7:51216488-51216510 TGTGCCTCAATTAAAATGATGGG + Intronic
1025005898 7:55354503-55354525 TGTGCCTGAATTCCAAAGGGAGG - Intergenic
1026118897 7:67519311-67519333 TGTGCCTAAACTCCAAAGGGAGG - Intergenic
1026247421 7:68633658-68633680 TGTGCCTGAATTCCAAAGGGAGG + Intergenic
1026290287 7:68999931-68999953 TGTACCTAAACTCCAAAGGGAGG - Intergenic
1027521504 7:79215139-79215161 TGTTCCTGAATTCCAAAGGGAGG - Intronic
1027620686 7:80481404-80481426 TATGCCTGAATTCCAAAGGGAGG - Intronic
1027693071 7:81372863-81372885 TGTGCCTTAATCCAAAGGGGAGG - Intergenic
1027869844 7:83693475-83693497 TTTGCCTGAATTCCAAAGGAAGG + Intergenic
1028368993 7:90069627-90069649 TGTGCCTGAATTGCAAATGGAGG + Intergenic
1028389433 7:90297245-90297267 TGTGCCTGAATTCCAAAGGGAGG + Intronic
1029616238 7:101659866-101659888 TGTACCTGAATTCCAAAGGGAGG + Intergenic
1030185309 7:106755884-106755906 TGTGCCTGAATTCCAAAGGGAGG + Intergenic
1030686183 7:112489317-112489339 TGTTCTTCCATTCTAATGGGTGG + Intronic
1031188822 7:118519763-118519785 TGTGCCTAAACTCCAAAGGGAGG + Intergenic
1031810449 7:126361393-126361415 TGTGTCTAAACTCCAAAGGGAGG + Intergenic
1031953766 7:127920793-127920815 TGTGCCTCAAGTAAAAAGGGCGG - Intronic
1032987946 7:137359635-137359657 TTGGCCTAAATTCCAATGGAAGG + Intergenic
1033162247 7:139007946-139007968 TGTGCCTGAGTTCCAAAGGGAGG - Intergenic
1033801287 7:144905485-144905507 TGTGCATGAATTCCAAAGGGAGG + Intergenic
1034060133 7:148079806-148079828 TGTGCCTGGATTCCAAAGGGAGG + Intronic
1034109868 7:148526535-148526557 TGTGCCTGAACTCCAAAGGGAGG - Intergenic
1035498381 8:72439-72461 TCTGCCCAAATTCCAAAGGGAGG + Intergenic
1035811061 8:2491578-2491600 TGTGACTGAATTCCAAAAGGAGG + Intergenic
1036221446 8:6924168-6924190 TGTGCCTGAATTCCAATGGGAGG - Intergenic
1036636660 8:10555259-10555281 TGTGCCTGAATTCCAAAGGGAGG - Intergenic
1036827567 8:11989816-11989838 TGTGTCTAAACTCCAAAGGGAGG - Intergenic
1037174749 8:15933428-15933450 TGTGCCTGAATTCCAAAGGGAGG + Intergenic
1037331041 8:17743960-17743982 TGTGCCTGAATTCTAAAGGGAGG - Intronic
1037413012 8:18617712-18617734 TGTGCCTAAACTCCAAAGGGAGG - Intronic
1037670107 8:21007619-21007641 TGTGCCTGAATTTCAAAGGGAGG - Intergenic
1038458159 8:27692081-27692103 TGTGCTTGAATTCCAAAGGGAGG - Intergenic
1038470016 8:27807719-27807741 AGTACCTCCCTTCCAATGGGGGG - Intronic
1039492210 8:37956325-37956347 TGGGCCCCAAATCCAATGAGAGG + Intergenic
1040713957 8:50224711-50224733 TATGCCTGGATTCCAAAGGGAGG - Intronic
1040717949 8:50281258-50281280 TGTGCCTGAACACCAAAGGGAGG + Intronic
1040968008 8:53103474-53103496 TGTGCCTATATTCCACTGGTAGG - Intergenic
1041177585 8:55212498-55212520 TGTGCCTAAATTCCAAGCGGAGG + Intronic
1041805329 8:61843081-61843103 TGTGCCTGAATTCCAAAGGGAGG - Intergenic
1042198204 8:66252545-66252567 TGTGCCTGGACTCCAAAGGGAGG + Intergenic
1042820350 8:72923505-72923527 TGTCCCTGAATTCCAAAGGGTGG + Intronic
1042979029 8:74505172-74505194 TGTGCCTGAATTCCAAAGGGAGG - Intergenic
1044184274 8:89233848-89233870 TGTGCCTAAACTACAAAGGGAGG + Intergenic
1044274162 8:90280802-90280824 TGTGCCTGAATTCCAAAGGGAGG + Intergenic
1044309482 8:90677222-90677244 TGTGCCTGAATTCCAAAGAAAGG + Intronic
1044396570 8:91720403-91720425 TGTGCCTAAATTCCAAAGGGAGG + Intergenic
1045126027 8:99090001-99090023 TGTGCCTGAATTTCAAGGAGAGG + Intronic
1045290824 8:100831256-100831278 TGTGCCTGAACTCCAAAGGGAGG + Intergenic
1045644268 8:104284916-104284938 TGTCCCTGAATTCCAAAGGGTGG + Intergenic
1048232696 8:132659326-132659348 AGTGCCTAAATGCCTATGGGTGG + Intronic
1048596416 8:135871661-135871683 TGTCCCTCAATACAAATGAGTGG - Intergenic
1048800575 8:138190366-138190388 TGTGCCTGAATTCCAAAGGGAGG - Intronic
1049012970 8:139899914-139899936 TGTGCCTAATTTCCAAAGGCAGG + Intronic
1049429466 8:142553018-142553040 TGTGCCTGAATTCCCAAGAGAGG + Intergenic
1049460442 8:142724902-142724924 TGGGCCTGAAATCCAAAGGGAGG - Intergenic
1049482186 8:142831119-142831141 TGTGCCTGAATTCCAAGGTGGGG - Intergenic
1049959849 9:727989-728011 TGTGCCTGAATTCCAAAGGGAGG - Intronic
1049997203 9:1044846-1044868 CGTGGCTCAATTCCCTTGGGGGG - Intergenic
1050796875 9:9557265-9557287 TGTGCCTGAATTCCAAAGGTAGG - Intronic
1050830811 9:10009918-10009940 TGTGCCTGAATTCCAAAGGGAGG + Intronic
1050995099 9:12207437-12207459 TGTGCCTGAATTCCAACGGGAGG + Intergenic
1052132852 9:24870773-24870795 TATGCCTGAATTCCATTGTGGGG - Intergenic
1053534867 9:38915449-38915471 TGTTTCTCAATTCCATTGGCTGG + Intergenic
1053846874 9:42248638-42248660 TGTGCCTGAATTCCAAAGGAAGG - Intergenic
1054207086 9:62139871-62139893 TGTTTCTCAATTCCATTGGCTGG + Intergenic
1054631264 9:67448483-67448505 TGTTTCTCAATTCCATTGGCTGG - Intergenic
1056283657 9:85066479-85066501 TATGCCTGAATCCCAAAGGGAGG - Intergenic
1056453122 9:86735581-86735603 TGTGCCTGAACTCCAAAGGGTGG - Intergenic
1056715592 9:89025627-89025649 TGTGCCTGAATTCCAAAGGGAGG - Intronic
1056868409 9:90253141-90253163 TGTGCCTAAATTTCAATGAAAGG - Intergenic
1056881125 9:90394901-90394923 TGTGCCTAAACTCCAAAAGGTGG + Intergenic
1056955975 9:91081598-91081620 TATGCCTGAATTCCAAAGGGAGG + Intergenic
1056983983 9:91344052-91344074 TGTGCCTGAATTCCAACGGGAGG - Intronic
1057580116 9:96280117-96280139 TGTGCCTGAATTCCAAAGGGAGG + Intronic
1057943927 9:99308158-99308180 TGTGCCTGAACTCCAAAGGGAGG - Intergenic
1058449498 9:105082939-105082961 TGTACCTGAATTCCACTGGGAGG + Intergenic
1059310771 9:113387812-113387834 TTTGCCGCAATTCCACTGGAAGG - Exonic
1060126672 9:121054133-121054155 TGTGCCTAAACTCCAAAGGGAGG - Intergenic
1062371787 9:136243020-136243042 TCTGCCTAAACTCCAAAGGGAGG - Intronic
1203610615 Un_KI270748v1:92155-92177 TCTGCCCAAATTCCAAAGGGAGG - Intergenic
1185588642 X:1259159-1259181 TGTGCCTGAATTCTAAAGGCAGG - Intergenic
1185788668 X:2911786-2911808 TGTGCCTGAATTCCAAAGGGAGG - Intronic
1186340796 X:8644335-8644357 TGTGCCTAAACTCCAAAGGAAGG - Intronic
1186811925 X:13198676-13198698 TGTGCCTGAACTCCAAAGGGAGG - Intergenic
1186820529 X:13283557-13283579 TGTGCCCAGATTCCAATGGGAGG + Intergenic
1187057426 X:15754080-15754102 TGTGCCTAAACTCTAAAGGGAGG + Intronic
1187124969 X:16446278-16446300 TGTGCCTGAATTCCAAAGCAAGG - Intergenic
1188061120 X:25603276-25603298 TATGCCTGAACTCCAAAGGGAGG - Intergenic
1188508146 X:30905766-30905788 TGTGCCTCAATTCCAAAGGGAGG - Intronic
1188937806 X:36198736-36198758 TGTGCCTGAATTCCAACAGGAGG + Intergenic
1189176198 X:38959879-38959901 TGTGCCTGAATTCCAAAGGGAGG + Intergenic
1189785301 X:44554073-44554095 TGTGCCTGAATTCCAGAGGGAGG + Intergenic
1190404659 X:50074662-50074684 TATGCCTACATTCCAACGGGCGG - Intronic
1190866947 X:54392668-54392690 TGTGTCTGAATTCCAATGGGAGG - Intergenic
1192283044 X:69704491-69704513 TGTGCCTGAATTTCAAAAGGGGG + Intronic
1192675922 X:73196680-73196702 TGTGTCTAAACTCCAAAGGGAGG - Intergenic
1192732016 X:73809884-73809906 TGTGTCTAAATTCCAAAGGGAGG - Intergenic
1194481798 X:94435922-94435944 TGTGCCTGAATTCCGAAGGGAGG + Intergenic
1194719774 X:97326792-97326814 TGTGCATCAATTACCATGGCAGG - Intronic
1195463472 X:105154181-105154203 TGTGTCTAAACTCCAAAGGGAGG + Intronic
1195733721 X:107991945-107991967 TGAGACTCAATTCCAATTGTAGG - Intergenic
1196257618 X:113540139-113540161 TGTACCTGAATTCCAAAAGGAGG + Intergenic
1197468184 X:126832822-126832844 TGTGCCTGAATTCTAAAGGGAGG + Intergenic
1199260422 X:145767140-145767162 TCTGCCTGAATTCCAAAGGGAGG - Intergenic
1199480337 X:148291513-148291535 TGTGGCTCAATCCCAAATGGAGG + Intergenic
1199984484 X:152940922-152940944 TGGGCATGAATTCCAAAGGGAGG + Intronic
1200298550 X:154948071-154948093 TGGGCCCCAATCCCAATGTGAGG + Intronic
1201148285 Y:11078808-11078830 TGTGCCTGAATTACAAAGGGAGG - Intergenic
1201286261 Y:12381326-12381348 TGCACCTGAATTCCAAAGGGAGG + Intergenic
1201403106 Y:13624282-13624304 TGTGCCTAAACACCAAAGGGAGG - Intergenic