ID: 1024308208

View in Genome Browser
Species Human (GRCh38)
Location 7:47945817-47945839
Sequence CTTGGAAGTTATCCTGTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 130}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024308208_1024308211 5 Left 1024308208 7:47945817-47945839 CCCACAACAGGATAACTTCCAAG 0: 1
1: 0
2: 2
3: 11
4: 130
Right 1024308211 7:47945845-47945867 CACACAGAAAACACCAGCCCTGG No data
1024308208_1024308212 12 Left 1024308208 7:47945817-47945839 CCCACAACAGGATAACTTCCAAG 0: 1
1: 0
2: 2
3: 11
4: 130
Right 1024308212 7:47945852-47945874 AAAACACCAGCCCTGGTTCCTGG No data
1024308208_1024308213 13 Left 1024308208 7:47945817-47945839 CCCACAACAGGATAACTTCCAAG 0: 1
1: 0
2: 2
3: 11
4: 130
Right 1024308213 7:47945853-47945875 AAACACCAGCCCTGGTTCCTGGG No data
1024308208_1024308217 23 Left 1024308208 7:47945817-47945839 CCCACAACAGGATAACTTCCAAG 0: 1
1: 0
2: 2
3: 11
4: 130
Right 1024308217 7:47945863-47945885 CCTGGTTCCTGGGACATAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024308208 Original CRISPR CTTGGAAGTTATCCTGTTGT GGG (reversed) Intronic
901092237 1:6649563-6649585 CTTGCAGGTCAGCCTGTTGTAGG - Intronic
905917209 1:41693789-41693811 CTTGGAATTTATTTTGGTGTAGG + Intronic
906126454 1:43430001-43430023 CTAGGAACTTCTCCTGTTGTGGG - Exonic
906332332 1:44896969-44896991 CTAGGCAGTTATCCTGTAGATGG - Intronic
907358641 1:53896783-53896805 CTTGGAAGTTTTCCTGGAGGAGG + Intronic
909481039 1:76129225-76129247 CTTGGAAGTTATGCTGCCCTAGG - Intronic
911084603 1:93965898-93965920 CTTAGAAGTTCTTCTTTTGTGGG - Intergenic
911382047 1:97127354-97127376 CTTGGAAGTTACATTTTTGTAGG + Intronic
912725117 1:112052134-112052156 CTTGGAGTTTATTCTGTTCTAGG - Intergenic
915256598 1:154635911-154635933 CTTGGTAGTTATCATTTTTTAGG + Intergenic
921400075 1:214712213-214712235 CTTGAAAAATATTCTGTTGTTGG + Intergenic
1068410774 10:56651338-56651360 CTTGGAATTTCTCCAGTGGTAGG - Intergenic
1069324901 10:67221502-67221524 CTTGGAAGTTATACTGACGTGGG - Intronic
1071129337 10:82373228-82373250 CTAGAAAGCTATCCTGTTTTAGG - Intronic
1071801589 10:89068951-89068973 TTTTGAATTTGTCCTGTTGTAGG - Intergenic
1072279620 10:93853972-93853994 GGTGGAAGCTATCCTGTGGTGGG - Intergenic
1072776046 10:98195112-98195134 GTTGGATGATATTCTGTTGTAGG - Intronic
1075272894 10:121068667-121068689 CTTGGAAGATAACCAGTTGCAGG - Intergenic
1077305546 11:1867180-1867202 CTTGGAACTTGTCCTGATGGGGG + Intronic
1080305281 11:30828472-30828494 CCTGGAATTTATTCTGTAGTTGG - Intergenic
1080471803 11:32552993-32553015 CTGGGAAGGTTTCCTGTTGGAGG + Intergenic
1081341462 11:41933137-41933159 CTTGGAAGATACACTGTTATAGG + Intergenic
1085345308 11:75764813-75764835 CTTGGACTTCATCCTGTTGGGGG - Intronic
1087631854 11:100659676-100659698 CTGGGTAGATATTCTGTTGTGGG - Intergenic
1088999783 11:115042191-115042213 CCTGGGAGTCATCATGTTGTAGG + Intergenic
1090705292 11:129330731-129330753 CTTGGAAATCATCCTGCTCTTGG + Intergenic
1094560033 12:31543789-31543811 CTTGGAATTTATTTTGCTGTAGG - Intronic
1095155707 12:38851217-38851239 TTTGGAAGTTATCATGTAGATGG - Intronic
1098413827 12:70210723-70210745 CTTCTAAGTTATCCAATTGTTGG + Intergenic
1099579264 12:84421481-84421503 CTTGGAGTTTATACTCTTGTGGG + Intergenic
1100465995 12:94845853-94845875 GTTGAAGGTTATGCTGTTGTTGG - Intergenic
1101192883 12:102353456-102353478 CTTGAAAGTTCACCTGTTGTTGG + Intergenic
1102767285 12:115444504-115444526 CTTGGCAGCTCTCCTGTGGTTGG + Intergenic
1104928432 12:132325803-132325825 ATGGGAAGTTTTCCTTTTGTTGG - Intronic
1106529662 13:30577905-30577927 CTTGGACTTTATCCTGTTGATGG - Intronic
1107041985 13:35958517-35958539 ATTGGTAGTTATACTGCTGTTGG - Intronic
1107793276 13:44024305-44024327 CTAAGAAGCTATACTGTTGTAGG + Intergenic
1108348329 13:49567510-49567532 CTTGCACGTTATTCTCTTGTAGG - Intronic
1108395099 13:49984156-49984178 CATGGAAGTTATTAAGTTGTTGG + Intergenic
1111719369 13:91922090-91922112 GTTGGAAGTTTTTCTGTTTTTGG - Intronic
1112608660 13:100933295-100933317 CTTGGAAATCGTCCTGCTGTGGG + Intergenic
1113722006 13:112565249-112565271 CTTGCGAGTTATGGTGTTGTAGG - Intronic
1114937691 14:27563772-27563794 CTAGGAATTTATCCAGTTCTAGG - Intergenic
1117766796 14:59092071-59092093 CTTCCATGTTATCCTTTTGTTGG + Intergenic
1124091933 15:26613491-26613513 CTTGGAATTTATCTTGGTGTAGG - Intronic
1124635707 15:31363900-31363922 TTTAGAATTTATCCTGGTGTAGG + Intronic
1126553528 15:49960531-49960553 TTTGGATTTTATCCTGGTGTGGG - Intronic
1127302632 15:57671368-57671390 CTTTGAATTTATCCTGTTTGGGG + Intronic
1131243296 15:90767750-90767772 ATTAGTAGATATCCTGTTGTGGG + Intronic
1135469235 16:22714347-22714369 CTTGGAATCTGTTCTGTTGTAGG + Intergenic
1135862827 16:26072508-26072530 ATGGGATGTTATCCTGTTTTAGG - Intronic
1140707682 16:77645967-77645989 ATTGTGAGTCATCCTGTTGTTGG - Intergenic
1143820012 17:9553074-9553096 CATGAAACTTATCCTTTTGTTGG - Intronic
1143961004 17:10719563-10719585 TTTAGAATTTATCCTGATGTAGG - Intronic
1144543921 17:16174408-16174430 CTTGAAAATTATGCTTTTGTAGG - Intronic
1145054101 17:19687738-19687760 CTAGGAATTTATCCAGTTCTAGG - Intronic
1146023123 17:29295760-29295782 CTTTAATGTTGTCCTGTTGTAGG - Intergenic
1147484663 17:40801121-40801143 TTTGGAAGTAATCCTGGTGCAGG + Intergenic
1149773831 17:59341924-59341946 GTTGGAAGTTATTTTGTTCTGGG - Intronic
1150632528 17:66890094-66890116 CTTGGAAGTTAACCTGCCTTTGG + Intergenic
1153322133 18:3784045-3784067 TTTGGAAATTATGCTTTTGTTGG - Intronic
1155653403 18:28168205-28168227 CTTGTAACTTGACCTGTTGTTGG - Intronic
1157392329 18:47313144-47313166 TTTTGAGGTTATCCTGTTGGAGG + Intergenic
1157897703 18:51484557-51484579 CCTATAACTTATCCTGTTGTGGG + Intergenic
1160440282 18:78884307-78884329 CTGTGAAGTGATCCTGGTGTGGG + Intergenic
1165483370 19:36079697-36079719 CTTTGGAATTATCCTGTTGCTGG + Intronic
929202349 2:39249634-39249656 CTTGGAATTTTTACTTTTGTTGG - Exonic
930259574 2:49129356-49129378 CATGGAAGTCATCCTGTGGATGG - Intronic
934869177 2:97845047-97845069 CTTGTAAGTTACTCTTTTGTTGG - Intronic
935699495 2:105799362-105799384 TTTGGAATTTATCCTGTTGTGGG + Intronic
938234121 2:129687929-129687951 GTTGGGATTTATCCTGTTTTGGG - Intergenic
938633717 2:133198304-133198326 CTTTGAAATTATCCTGTTTGGGG - Intronic
938674082 2:133613377-133613399 CTTGGAGTTTATCCTGATGGAGG - Intergenic
939345405 2:140959748-140959770 CTTGGAAGTTGTAGTGTTGTAGG - Intronic
941732183 2:168930850-168930872 CCTGGAAGTTGTCCTGTGGATGG + Exonic
941976320 2:171409103-171409125 CTTGGGACTAAGCCTGTTGTCGG - Intronic
942126741 2:172833556-172833578 CTTGGCAGTTGTACTGTTTTTGG + Intronic
942520231 2:176796269-176796291 CTTAGAATTTGTCCTGTTATTGG + Intergenic
944345403 2:198659484-198659506 TTTATAAGTTATCCTATTGTGGG - Intergenic
945367272 2:208970532-208970554 CTTAGAATTTATCCTGTTGTAGG - Intergenic
1169514922 20:6305435-6305457 CTTGGAAGTTATATTTCTGTTGG + Intergenic
1169528982 20:6464027-6464049 CTTGGAAATTATACTGTGCTTGG + Intergenic
1175280236 20:57799344-57799366 CTTGGAAATTATTCTGTAGGAGG + Intergenic
1177074321 21:16553082-16553104 CCTGGAAGTTATCCTGCTTTGGG - Intergenic
1179041647 21:37808200-37808222 CGTGGAATTTGTCCTGTTGTAGG + Intronic
1181479218 22:23187315-23187337 CTAGGCAGTTTTCCTGTTGTGGG + Intronic
1183708757 22:39490418-39490440 CTTGGGAGTTATCTTATTGATGG + Exonic
949256649 3:2055579-2055601 CTAGGAAGTTATCCTTATGCAGG - Intergenic
951682920 3:25313170-25313192 CTTGGAAGTTCCCCTCTTATGGG + Intronic
952199914 3:31115422-31115444 CTTAGAACTTACCCAGTTGTGGG - Intergenic
954090587 3:48280812-48280834 GTTGGAAGTTATTCTCTTATAGG + Intronic
957844948 3:85719769-85719791 CTTGGATGTTTTCCTGTTTTAGG - Intronic
960498387 3:118404970-118404992 CATGGAAGTTATTCTGATGTTGG - Intergenic
963663948 3:148158863-148158885 CTTGTAACATATCCTGTTGCGGG + Intergenic
965691692 3:171364033-171364055 ATTGTATGTTATCCTGTTATAGG - Intronic
966424612 3:179767587-179767609 CTTGTTAGTTCTTCTGTTGTTGG + Intronic
966916517 3:184587323-184587345 CTTCCTAGGTATCCTGTTGTAGG - Intronic
970373949 4:15437388-15437410 CATGGCAGTTATCCTGTGGAAGG - Intronic
972724188 4:41731893-41731915 GTTGGAAATGATCCTGCTGTGGG + Intergenic
973555901 4:52082805-52082827 CTTTGAAGTTATCTTGTAGGAGG + Intronic
977557950 4:98503712-98503734 CATGGAGTTTATCCAGTTGTAGG - Intronic
977661909 4:99598625-99598647 CTTGAAGGATATACTGTTGTTGG - Intronic
977856587 4:101902461-101902483 TTTGGAAGTTAGCATGATGTGGG + Intronic
978080485 4:104584244-104584266 CATAGAAGTTATGCAGTTGTGGG + Intergenic
984343208 4:178486023-178486045 CATGGAATTTAACCTGTTATTGG - Intergenic
988260913 5:28885018-28885040 GTTGGCAGTTATCCTGTTTAAGG - Intergenic
989762193 5:45029386-45029408 TTTGGAAGATATTCTATTGTGGG + Intergenic
991541435 5:67733912-67733934 CTGTGAAGGGATCCTGTTGTGGG + Intergenic
993186436 5:84627848-84627870 CTGGCAAGATATCCTGTTTTGGG + Intergenic
995534522 5:113121697-113121719 CTTGGAAGTTAAAATTTTGTTGG - Intronic
997826315 5:137109936-137109958 CTTGGAAGTTACCATCTGGTAGG - Intronic
999482155 5:151958612-151958634 CTTGGAAGACATTGTGTTGTGGG + Intergenic
1002853498 6:1017497-1017519 CTTGAAAGTCATTGTGTTGTGGG + Intergenic
1007398553 6:41590838-41590860 TTTGGAATTTATCCTGATTTTGG - Intronic
1007903713 6:45437597-45437619 CTTGGATGTGTTCCTGATGTTGG + Intronic
1012243411 6:96899229-96899251 CTGGGAAGTTATCCTGAAGGTGG + Intergenic
1014231767 6:118911550-118911572 CTTGAAATTTATCCTATTATAGG + Intronic
1017023231 6:150158674-150158696 CTTTGAAGTTATTCTCTTATAGG - Intronic
1017313654 6:153002966-153002988 CTTGGTAGGTATCCGGTTGATGG + Intergenic
1022853716 7:34294691-34294713 CTAGGATCTTTTCCTGTTGTGGG + Intergenic
1024308208 7:47945817-47945839 CTTGGAAGTTATCCTGTTGTGGG - Intronic
1027200976 7:76063701-76063723 TTTGGAAGGGCTCCTGTTGTAGG + Intronic
1028882277 7:95893148-95893170 TTTGGAAATCAGCCTGTTGTGGG - Intronic
1030214135 7:107026242-107026264 CTTTTAAGTTATTCTGTTATTGG - Intergenic
1030428370 7:109409546-109409568 CTTGGAAATTATTTTATTGTGGG - Intergenic
1032911839 7:136441282-136441304 CTGGGGAGATATCCTGTAGTGGG + Intergenic
1033185284 7:139221999-139222021 CTAGAAATTTATCCTTTTGTAGG + Intergenic
1033554562 7:142477380-142477402 CTTGGTAGTTATATTGTTTTTGG + Intergenic
1033559183 7:142514935-142514957 CTTGGTAGTTATATTGTTTTTGG + Intergenic
1037482612 8:19318471-19318493 CCTAGAAGTTCTCCTGTGGTTGG - Intronic
1039381270 8:37087713-37087735 CTTGGAACCTATCCTGGTTTGGG + Intergenic
1041892582 8:62887354-62887376 TTTGGCATTTATCCTGTTCTTGG + Intronic
1044387825 8:91610900-91610922 CTTGGAAGTAAGCCTGTGGGTGG + Intergenic
1047065396 8:121276402-121276424 ACTGGAAGCTATCCTGTGGTTGG - Intergenic
1051033425 9:12712580-12712602 CTTATAAGTTATCCAATTGTTGG - Intergenic
1057390428 9:94638264-94638286 CTAAGAAGTTCTCCTGTGGTGGG - Intronic
1062314323 9:135958675-135958697 CCTGGATGTCATCCTGCTGTAGG - Intronic
1185833126 X:3320360-3320382 ATGGGAATGTATCCTGTTGTAGG + Exonic
1188026397 X:25214340-25214362 CTTAGAAGTTAATCTGTTCTGGG + Intergenic
1193194544 X:78616003-78616025 CTAGGAATTTATCCAGTTCTAGG + Intergenic
1198587442 X:138138391-138138413 CTTTGATGTTATGCTATTGTGGG + Intergenic
1198776185 X:140181752-140181774 TTTGTAAGTTTTCCTGTTATTGG + Intergenic
1199243607 X:145576470-145576492 CTTGGAACATATGTTGTTGTGGG + Intergenic
1200833830 Y:7713549-7713571 CTTGGAAGTTCTCATGATGAGGG + Intergenic