ID: 1024308228

View in Genome Browser
Species Human (GRCh38)
Location 7:47945945-47945967
Sequence CTCCACTCACAGAGGCGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024308224_1024308228 -8 Left 1024308224 7:47945930-47945952 CCCAACAGGTGTGTCCTCCACTC 0: 1
1: 0
2: 0
3: 20
4: 114
Right 1024308228 7:47945945-47945967 CTCCACTCACAGAGGCGCCAAGG No data
1024308225_1024308228 -9 Left 1024308225 7:47945931-47945953 CCAACAGGTGTGTCCTCCACTCA 0: 1
1: 0
2: 0
3: 16
4: 177
Right 1024308228 7:47945945-47945967 CTCCACTCACAGAGGCGCCAAGG No data
1024308223_1024308228 -7 Left 1024308223 7:47945929-47945951 CCCCAACAGGTGTGTCCTCCACT 0: 1
1: 0
2: 1
3: 15
4: 165
Right 1024308228 7:47945945-47945967 CTCCACTCACAGAGGCGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024308228 Original CRISPR CTCCACTCACAGAGGCGCCA AGG Intronic
No off target data available for this crispr