ID: 1024312198

View in Genome Browser
Species Human (GRCh38)
Location 7:47979575-47979597
Sequence TTTCCGGGCGGGGACACTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 41}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024312198_1024312208 12 Left 1024312198 7:47979575-47979597 CCCTGAGTGTCCCCGCCCGGAAA 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1024312208 7:47979610-47979632 AACAGTGGTTCCGCCCGGCTCGG 0: 1
1: 0
2: 0
3: 3
4: 68
1024312198_1024312207 7 Left 1024312198 7:47979575-47979597 CCCTGAGTGTCCCCGCCCGGAAA 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1024312207 7:47979605-47979627 GCGCGAACAGTGGTTCCGCCCGG 0: 1
1: 0
2: 0
3: 0
4: 16
1024312198_1024312209 13 Left 1024312198 7:47979575-47979597 CCCTGAGTGTCCCCGCCCGGAAA 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1024312209 7:47979611-47979633 ACAGTGGTTCCGCCCGGCTCGGG 0: 1
1: 0
2: 0
3: 3
4: 53
1024312198_1024312206 -3 Left 1024312198 7:47979575-47979597 CCCTGAGTGTCCCCGCCCGGAAA 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1024312206 7:47979595-47979617 AAACACGGCAGCGCGAACAGTGG 0: 1
1: 0
2: 0
3: 1
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024312198 Original CRISPR TTTCCGGGCGGGGACACTCA GGG (reversed) Intronic