ID: 1024312199

View in Genome Browser
Species Human (GRCh38)
Location 7:47979576-47979598
Sequence GTTTCCGGGCGGGGACACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 54}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024312199_1024312207 6 Left 1024312199 7:47979576-47979598 CCTGAGTGTCCCCGCCCGGAAAC 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1024312207 7:47979605-47979627 GCGCGAACAGTGGTTCCGCCCGG 0: 1
1: 0
2: 0
3: 0
4: 16
1024312199_1024312208 11 Left 1024312199 7:47979576-47979598 CCTGAGTGTCCCCGCCCGGAAAC 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1024312208 7:47979610-47979632 AACAGTGGTTCCGCCCGGCTCGG 0: 1
1: 0
2: 0
3: 3
4: 68
1024312199_1024312206 -4 Left 1024312199 7:47979576-47979598 CCTGAGTGTCCCCGCCCGGAAAC 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1024312206 7:47979595-47979617 AAACACGGCAGCGCGAACAGTGG 0: 1
1: 0
2: 0
3: 1
4: 29
1024312199_1024312209 12 Left 1024312199 7:47979576-47979598 CCTGAGTGTCCCCGCCCGGAAAC 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1024312209 7:47979611-47979633 ACAGTGGTTCCGCCCGGCTCGGG 0: 1
1: 0
2: 0
3: 3
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024312199 Original CRISPR GTTTCCGGGCGGGGACACTC AGG (reversed) Intronic