ID: 1024312201

View in Genome Browser
Species Human (GRCh38)
Location 7:47979585-47979607
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 51}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024312201_1024312207 -3 Left 1024312201 7:47979585-47979607 CCCCGCCCGGAAACACGGCAGCG 0: 1
1: 0
2: 0
3: 1
4: 51
Right 1024312207 7:47979605-47979627 GCGCGAACAGTGGTTCCGCCCGG 0: 1
1: 0
2: 0
3: 0
4: 16
1024312201_1024312214 23 Left 1024312201 7:47979585-47979607 CCCCGCCCGGAAACACGGCAGCG 0: 1
1: 0
2: 0
3: 1
4: 51
Right 1024312214 7:47979631-47979653 GGGCTACGCGACTCTTACCAGGG 0: 1
1: 0
2: 0
3: 1
4: 12
1024312201_1024312209 3 Left 1024312201 7:47979585-47979607 CCCCGCCCGGAAACACGGCAGCG 0: 1
1: 0
2: 0
3: 1
4: 51
Right 1024312209 7:47979611-47979633 ACAGTGGTTCCGCCCGGCTCGGG 0: 1
1: 0
2: 0
3: 3
4: 53
1024312201_1024312213 22 Left 1024312201 7:47979585-47979607 CCCCGCCCGGAAACACGGCAGCG 0: 1
1: 0
2: 0
3: 1
4: 51
Right 1024312213 7:47979630-47979652 CGGGCTACGCGACTCTTACCAGG 0: 1
1: 0
2: 0
3: 1
4: 13
1024312201_1024312208 2 Left 1024312201 7:47979585-47979607 CCCCGCCCGGAAACACGGCAGCG 0: 1
1: 0
2: 0
3: 1
4: 51
Right 1024312208 7:47979610-47979632 AACAGTGGTTCCGCCCGGCTCGG 0: 1
1: 0
2: 0
3: 3
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024312201 Original CRISPR CGCTGCCGTGTTTCCGGGCG GGG (reversed) Intergenic