ID: 1024312205

View in Genome Browser
Species Human (GRCh38)
Location 7:47979591-47979613
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 31
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 28}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024312205_1024312213 16 Left 1024312205 7:47979591-47979613 CCGGAAACACGGCAGCGCGAACA 0: 1
1: 0
2: 0
3: 2
4: 28
Right 1024312213 7:47979630-47979652 CGGGCTACGCGACTCTTACCAGG 0: 1
1: 0
2: 0
3: 1
4: 13
1024312205_1024312214 17 Left 1024312205 7:47979591-47979613 CCGGAAACACGGCAGCGCGAACA 0: 1
1: 0
2: 0
3: 2
4: 28
Right 1024312214 7:47979631-47979653 GGGCTACGCGACTCTTACCAGGG 0: 1
1: 0
2: 0
3: 1
4: 12
1024312205_1024312209 -3 Left 1024312205 7:47979591-47979613 CCGGAAACACGGCAGCGCGAACA 0: 1
1: 0
2: 0
3: 2
4: 28
Right 1024312209 7:47979611-47979633 ACAGTGGTTCCGCCCGGCTCGGG 0: 1
1: 0
2: 0
3: 3
4: 53
1024312205_1024312216 28 Left 1024312205 7:47979591-47979613 CCGGAAACACGGCAGCGCGAACA 0: 1
1: 0
2: 0
3: 2
4: 28
Right 1024312216 7:47979642-47979664 CTCTTACCAGGGTTATCTCCGGG 0: 1
1: 0
2: 0
3: 10
4: 108
1024312205_1024312215 27 Left 1024312205 7:47979591-47979613 CCGGAAACACGGCAGCGCGAACA 0: 1
1: 0
2: 0
3: 2
4: 28
Right 1024312215 7:47979641-47979663 ACTCTTACCAGGGTTATCTCCGG 0: 1
1: 0
2: 0
3: 13
4: 107
1024312205_1024312208 -4 Left 1024312205 7:47979591-47979613 CCGGAAACACGGCAGCGCGAACA 0: 1
1: 0
2: 0
3: 2
4: 28
Right 1024312208 7:47979610-47979632 AACAGTGGTTCCGCCCGGCTCGG 0: 1
1: 0
2: 0
3: 3
4: 68
1024312205_1024312207 -9 Left 1024312205 7:47979591-47979613 CCGGAAACACGGCAGCGCGAACA 0: 1
1: 0
2: 0
3: 2
4: 28
Right 1024312207 7:47979605-47979627 GCGCGAACAGTGGTTCCGCCCGG 0: 1
1: 0
2: 0
3: 0
4: 16

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024312205 Original CRISPR TGTTCGCGCTGCCGTGTTTC CGG (reversed) Intergenic