ID: 1024312207

View in Genome Browser
Species Human (GRCh38)
Location 7:47979605-47979627
Sequence GCGCGAACAGTGGTTCCGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 17
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 16}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024312199_1024312207 6 Left 1024312199 7:47979576-47979598 CCTGAGTGTCCCCGCCCGGAAAC 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1024312207 7:47979605-47979627 GCGCGAACAGTGGTTCCGCCCGG 0: 1
1: 0
2: 0
3: 0
4: 16
1024312202_1024312207 -4 Left 1024312202 7:47979586-47979608 CCCGCCCGGAAACACGGCAGCGC 0: 1
1: 0
2: 0
3: 2
4: 52
Right 1024312207 7:47979605-47979627 GCGCGAACAGTGGTTCCGCCCGG 0: 1
1: 0
2: 0
3: 0
4: 16
1024312201_1024312207 -3 Left 1024312201 7:47979585-47979607 CCCCGCCCGGAAACACGGCAGCG 0: 1
1: 0
2: 0
3: 1
4: 51
Right 1024312207 7:47979605-47979627 GCGCGAACAGTGGTTCCGCCCGG 0: 1
1: 0
2: 0
3: 0
4: 16
1024312198_1024312207 7 Left 1024312198 7:47979575-47979597 CCCTGAGTGTCCCCGCCCGGAAA 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1024312207 7:47979605-47979627 GCGCGAACAGTGGTTCCGCCCGG 0: 1
1: 0
2: 0
3: 0
4: 16
1024312205_1024312207 -9 Left 1024312205 7:47979591-47979613 CCGGAAACACGGCAGCGCGAACA 0: 1
1: 0
2: 0
3: 2
4: 28
Right 1024312207 7:47979605-47979627 GCGCGAACAGTGGTTCCGCCCGG 0: 1
1: 0
2: 0
3: 0
4: 16
1024312203_1024312207 -5 Left 1024312203 7:47979587-47979609 CCGCCCGGAAACACGGCAGCGCG 0: 1
1: 0
2: 0
3: 2
4: 28
Right 1024312207 7:47979605-47979627 GCGCGAACAGTGGTTCCGCCCGG 0: 1
1: 0
2: 0
3: 0
4: 16
1024312204_1024312207 -8 Left 1024312204 7:47979590-47979612 CCCGGAAACACGGCAGCGCGAAC 0: 1
1: 0
2: 0
3: 2
4: 32
Right 1024312207 7:47979605-47979627 GCGCGAACAGTGGTTCCGCCCGG 0: 1
1: 0
2: 0
3: 0
4: 16

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024312207 Original CRISPR GCGCGAACAGTGGTTCCGCC CGG Intergenic
1077637955 11:3856042-3856064 GGTCCAACAGTGGGTCCGCCGGG - Exonic
1111473561 13:88718076-88718098 ACGCGGACAGGAGTTCCGCCAGG + Intergenic
1131492160 15:92872605-92872627 GGGAGAACACTGGTTCTGCCTGG + Intergenic
1146052673 17:29566267-29566289 CCGCGAACAGCGGCGCCGCCGGG + Exonic
1161050938 19:2163900-2163922 GCGGGGCGAGTGGTTCCGCCCGG + Intronic
1161063545 19:2226925-2226947 GCGCGAACTGCGGTCCCGGCGGG - Exonic
1167383169 19:49150048-49150070 GAGCGAGCAGCGGTTCAGCCTGG - Intronic
1167501653 19:49851610-49851632 GCCCGAAGGGTGGTCCCGCCCGG + Intronic
938125031 2:128665145-128665167 GCCCTCCCAGTGGTTCCGCCTGG - Intergenic
938663159 2:133507559-133507581 GCCCAAAAAGTGGTTCCTCCTGG - Intronic
1171810866 20:29743548-29743570 GCGCGAGCGGTGGTTGTGCCCGG - Intergenic
952163924 3:30725044-30725066 GCAGGAACAGTGGTTTTGCCTGG - Intergenic
958963657 3:100534974-100534996 GCGAGAACAGTGGTTCCTATTGG - Intronic
1024312207 7:47979605-47979627 GCGCGAACAGTGGTTCCGCCCGG + Intergenic
1034188419 7:149196118-149196140 TCGCGGGCAGTGCTTCCGCCCGG + Intronic
1036123854 8:6045365-6045387 GCGGGAACAGGGGTTGCACCCGG - Intergenic
1061945258 9:133905131-133905153 GCCAGAACAGTGGCTCAGCCGGG + Intronic