ID: 1024312207

View in Genome Browser
Species Human (GRCh38)
Location 7:47979605-47979627
Sequence GCGCGAACAGTGGTTCCGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 17
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 16}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024312205_1024312207 -9 Left 1024312205 7:47979591-47979613 CCGGAAACACGGCAGCGCGAACA 0: 1
1: 0
2: 0
3: 2
4: 28
Right 1024312207 7:47979605-47979627 GCGCGAACAGTGGTTCCGCCCGG 0: 1
1: 0
2: 0
3: 0
4: 16
1024312203_1024312207 -5 Left 1024312203 7:47979587-47979609 CCGCCCGGAAACACGGCAGCGCG 0: 1
1: 0
2: 0
3: 2
4: 28
Right 1024312207 7:47979605-47979627 GCGCGAACAGTGGTTCCGCCCGG 0: 1
1: 0
2: 0
3: 0
4: 16
1024312202_1024312207 -4 Left 1024312202 7:47979586-47979608 CCCGCCCGGAAACACGGCAGCGC 0: 1
1: 0
2: 0
3: 2
4: 52
Right 1024312207 7:47979605-47979627 GCGCGAACAGTGGTTCCGCCCGG 0: 1
1: 0
2: 0
3: 0
4: 16
1024312198_1024312207 7 Left 1024312198 7:47979575-47979597 CCCTGAGTGTCCCCGCCCGGAAA 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1024312207 7:47979605-47979627 GCGCGAACAGTGGTTCCGCCCGG 0: 1
1: 0
2: 0
3: 0
4: 16
1024312204_1024312207 -8 Left 1024312204 7:47979590-47979612 CCCGGAAACACGGCAGCGCGAAC 0: 1
1: 0
2: 0
3: 2
4: 32
Right 1024312207 7:47979605-47979627 GCGCGAACAGTGGTTCCGCCCGG 0: 1
1: 0
2: 0
3: 0
4: 16
1024312199_1024312207 6 Left 1024312199 7:47979576-47979598 CCTGAGTGTCCCCGCCCGGAAAC 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1024312207 7:47979605-47979627 GCGCGAACAGTGGTTCCGCCCGG 0: 1
1: 0
2: 0
3: 0
4: 16
1024312201_1024312207 -3 Left 1024312201 7:47979585-47979607 CCCCGCCCGGAAACACGGCAGCG 0: 1
1: 0
2: 0
3: 1
4: 51
Right 1024312207 7:47979605-47979627 GCGCGAACAGTGGTTCCGCCCGG 0: 1
1: 0
2: 0
3: 0
4: 16

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024312207 Original CRISPR GCGCGAACAGTGGTTCCGCC CGG Intergenic