ID: 1024316084

View in Genome Browser
Species Human (GRCh38)
Location 7:48018086-48018108
Sequence GTGCAACCCAGTATCTTCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 101}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024316084_1024316090 25 Left 1024316084 7:48018086-48018108 CCCAAGAAGATACTGGGTTGCAC 0: 1
1: 0
2: 0
3: 7
4: 101
Right 1024316090 7:48018134-48018156 TAAGCAGGAGATGAAGACTAAGG 0: 1
1: 0
2: 7
3: 60
4: 337
1024316084_1024316089 10 Left 1024316084 7:48018086-48018108 CCCAAGAAGATACTGGGTTGCAC 0: 1
1: 0
2: 0
3: 7
4: 101
Right 1024316089 7:48018119-48018141 TCTGTAGATTGTGTATAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024316084 Original CRISPR GTGCAACCCAGTATCTTCTT GGG (reversed) Intronic
900903967 1:5537569-5537591 GTGCTATCCAGTGTCATCTTGGG - Intergenic
901085332 1:6608122-6608144 GCCCAGCCCAGTATATTCTTAGG - Intronic
904260424 1:29284633-29284655 GTGCAGCCCAGTTTGTTCCTTGG + Intronic
908142738 1:61204002-61204024 AAACAAACCAGTATCTTCTTTGG - Intronic
908888026 1:68812432-68812454 GTGAAACCAAGAATCTACTTAGG + Intergenic
919843936 1:201629168-201629190 GGGCATCCCAGTATCCTCTGGGG + Intronic
1065997438 10:31071890-31071912 GTACAGCCCAGAAACTTCTTTGG - Intergenic
1067659882 10:48226762-48226784 GTCCAACCCAGTAACTAATTTGG + Intronic
1068123779 10:52812728-52812750 GCTTAACCCAGTATTTTCTTTGG - Intergenic
1069233392 10:66040166-66040188 GTGCAAGACAGTATCTCGTTGGG - Intronic
1073628630 10:105125028-105125050 GTGCTACATAGTTTCTTCTTAGG + Intronic
1083010414 11:59391977-59391999 GTGCCACTCAGTATTTTCTTGGG - Intergenic
1085469142 11:76745733-76745755 GTGAAAGCCCTTATCTTCTTGGG - Intergenic
1091209014 11:133841125-133841147 ATGCAACAGAGTATCTACTTTGG - Intronic
1096928246 12:55173334-55173356 GTCCAACCCAGTCTTTTCTATGG + Intergenic
1098530475 12:71536122-71536144 CTACAACCCAGTATTTTGTTTGG - Intronic
1099103898 12:78477532-78477554 GGGCAACAAAGTATCTCCTTGGG + Intergenic
1101042867 12:100774392-100774414 GAGCAACCCAATATTTTTTTAGG + Intronic
1109094798 13:58099618-58099640 GTGTGACCCTGTAACTTCTTTGG - Intergenic
1109405858 13:61899159-61899181 ATGCAACCCTGTTTCTACTTTGG + Intergenic
1117080784 14:52150297-52150319 GTGCAACCCAGTATTACCTCAGG - Intergenic
1119002204 14:70892628-70892650 GTGAAACCCAGTATTTTCCAGGG - Intergenic
1119452254 14:74721789-74721811 TTTAAACCCAGTATCTTATTAGG + Intronic
1120328832 14:83061441-83061463 ATGCAACCCATGATCTTCATGGG - Intergenic
1121937716 14:98035647-98035669 GTGCAACTCTATATCTTCTGTGG - Intergenic
1123137871 14:106046444-106046466 GAAGAAACCAGTATCTTCTTAGG + Intergenic
1127989217 15:64099078-64099100 CTGCAATCCTCTATCTTCTTTGG - Intronic
1132535054 16:474709-474731 GTGCAAACCATTATCAGCTTAGG + Intronic
1141700244 16:85639044-85639066 GTGCAACCCAGGATCAACTCAGG - Intronic
1144014645 17:11182345-11182367 GTGATACCCATTATCTTCCTTGG - Intergenic
1144157238 17:12517719-12517741 GTGCAACCAAGTTTCTGGTTCGG - Intergenic
1147226820 17:38985543-38985565 GTGCAGCCCATTAGCTTCCTCGG - Intergenic
1147713129 17:42484566-42484588 CTCCAACACAGTCTCTTCTTGGG - Intronic
1148795976 17:50196919-50196941 ATGCAACTCAGTATCTTTTGGGG + Intronic
1149419729 17:56497817-56497839 GGGCAAGCCATTAACTTCTTGGG - Intronic
1151240872 17:72756967-72756989 GTGAAACCCAGTCTCTGCTAGGG + Intronic
1154978093 18:21478809-21478831 GAGCAACCCAGCAGCTACTTGGG - Intronic
1155129755 18:22921270-22921292 CTCAAGCCCAGTATCTTCTTAGG + Intronic
1158179587 18:54698822-54698844 GTGCAACCCATTTTTTTCTAGGG - Intergenic
1160525041 18:79530869-79530891 GTGCCACCCAGTCTCTGCTCAGG - Intergenic
1166694265 19:44843831-44843853 GTGAAACCCTGTCTCTACTTGGG - Intergenic
925795609 2:7539258-7539280 CTGCAACCCAGTAGCTCCATTGG - Intergenic
937066360 2:119020823-119020845 GAGCTACCCACTATCTCCTTCGG + Intergenic
937320116 2:120956005-120956027 GTGAAAGCCAGTCTCTTCTGAGG - Intronic
939201642 2:139043078-139043100 GAGCCACCCAGTATTTTGTTAGG + Intergenic
939728294 2:145751257-145751279 GAGCAACTCAGTTTCTTCATTGG + Intergenic
946596263 2:221308955-221308977 GTGCAGCACAGTCTCTTCTCTGG - Intergenic
1170838846 20:19907575-19907597 CTGCATCTCTGTATCTTCTTTGG - Intronic
1180734106 22:18002733-18002755 GTGCATTCCAGTATCCTCATTGG - Intronic
1183028126 22:35081668-35081690 GTGGAACCAAGTTTCTTCATGGG + Intronic
1184761953 22:46549919-46549941 GTCCCACCCAGGAGCTTCTTTGG + Intergenic
1185008860 22:48301901-48301923 GGGCAAACCATTATCTTCTTGGG + Intergenic
949119048 3:363300-363322 GTAAGACCCAGCATCTTCTTCGG - Exonic
956488855 3:69750298-69750320 GTGAATCCCAGGATTTTCTTGGG + Intronic
958955970 3:100466402-100466424 GTCCAACCCAGTCTTTTCTATGG + Intergenic
959274449 3:104260363-104260385 TTCCAAACCAGCATCTTCTTTGG + Intergenic
960483774 3:118226241-118226263 GTTCAACCCATTAACTTCTTAGG - Intergenic
964229363 3:154445485-154445507 GTGCAACTGAATAGCTTCTTGGG - Intergenic
978420918 4:108532000-108532022 TTGGAACCAAGTATCTTTTTTGG + Intergenic
979014702 4:115418888-115418910 GTCCAACCCAGTCTTTTCTTTGG + Intergenic
981335500 4:143564662-143564684 TTATAACTCAGTATCTTCTTGGG + Intergenic
981953234 4:150436989-150437011 CTGCAACACAGTATCATATTGGG + Intronic
982547405 4:156751403-156751425 GTGCTTCCCAATATCTACTTAGG - Intergenic
982934090 4:161448924-161448946 GTCCAAACCAGTACCATCTTGGG + Intronic
984260910 4:177442796-177442818 GTCAAACTCAGTATATTCTTGGG + Intergenic
987632664 5:20494951-20494973 GTGAATCCCAGCAACTTCTTAGG + Intronic
990033229 5:51287547-51287569 GTGCTTCCCAGTATCCACTTTGG - Intergenic
990944193 5:61232801-61232823 GTGAAACTCAGCATCTTCCTTGG + Intergenic
992279304 5:75157375-75157397 GTGCAACCTGGTTTCTTCTTGGG + Intronic
993174662 5:84468514-84468536 TTGCAACTCAGTTTCTACTTTGG - Intergenic
997133273 5:131298570-131298592 AGGCATCCCAGTATCTTTTTGGG + Intronic
998116720 5:139543449-139543471 GTGCAATCCAGGATCTACGTGGG - Intronic
999101903 5:149032420-149032442 ATGCAACCCAGTAGCTTCTAAGG - Intronic
1000324012 5:160158327-160158349 GTGCATCTCAGGATGTTCTTTGG - Intergenic
1001456512 5:171865354-171865376 GTCCAACCCTTTATCATCTTTGG - Intronic
1003889864 6:10554591-10554613 GAGTAATTCAGTATCTTCTTTGG - Intronic
1008164937 6:48124964-48124986 GTGAAAGCCAATGTCTTCTTTGG - Intergenic
1008249208 6:49217043-49217065 GTGTAACCCATAATCATCTTTGG - Intergenic
1008778345 6:55069162-55069184 GGGCAACCCAGTGCCTTCTCTGG + Intergenic
1009735922 6:67675506-67675528 GTCCAACCCAGTTTTTTCTATGG - Intergenic
1010991436 6:82484718-82484740 GTCCAACCCAGTCTTTTCTGTGG + Intergenic
1014950349 6:127547345-127547367 TACCAACCCAGTAACTTCTTGGG + Intronic
1015283077 6:131454869-131454891 GTGCAAACCTGACTCTTCTTAGG - Intergenic
1015813736 6:137186447-137186469 GTCCAACCCAGTCTTTTCTATGG - Intergenic
1017559948 6:155615942-155615964 GTTCAACCCAGTCTTTTCTATGG - Intergenic
1021503061 7:21350977-21350999 GTGCAAGCCTGTAGCTACTTAGG - Intergenic
1024316084 7:48018086-48018108 GTGCAACCCAGTATCTTCTTGGG - Intronic
1025027837 7:55532753-55532775 GTGCTTCCCAGTACCTTCCTGGG - Intronic
1030957555 7:115873619-115873641 CTGCAAACCAGGAACTTCTTTGG - Intergenic
1032095507 7:128936574-128936596 GTGAAACCCCGTCTCTACTTGGG + Intergenic
1033068514 7:138179880-138179902 GTGCAAAGCAGTATCTTCAGAGG - Intergenic
1033590095 7:142801720-142801742 GTGCATCCCATTCTCTTCTGGGG + Intergenic
1034697839 7:153069719-153069741 GTGCCACCCAGATTCCTCTTTGG - Intergenic
1035897144 8:3415906-3415928 ATGCAACTCAAAATCTTCTTTGG - Intronic
1040112205 8:43571560-43571582 GTGGAACCCAGCCCCTTCTTTGG + Intergenic
1040718383 8:50287102-50287124 GGGGAACCCAGTATTTTATTAGG - Intronic
1045781306 8:105866319-105866341 GAGAAACTCAGTATCTTCTTAGG - Intergenic
1048512723 8:135077482-135077504 TAGCAACCCAGAATCTTTTTAGG - Intergenic
1052367678 9:27631435-27631457 GTTCAAGCCAACATCTTCTTTGG - Intergenic
1055975539 9:81951166-81951188 GTGCAACCTATGATCTTCATGGG + Intergenic
1056096966 9:83264861-83264883 GTTTAACCCTTTATCTTCTTAGG - Intronic
1187960057 X:24559753-24559775 GTGCAACCCGGTCTCTGCCTGGG + Intronic
1188212819 X:27444161-27444183 GTCCAACCCAGTCTTTTCTATGG - Intergenic
1191254652 X:58274511-58274533 GGGCACCCCAGCCTCTTCTTTGG + Intergenic
1193651834 X:84145284-84145306 GTGCTACTCATTATTTTCTTAGG - Intronic
1197064280 X:122220505-122220527 GTCCAACCCAGTCTTTTCTATGG + Intergenic
1198081416 X:133243568-133243590 GTGCAACACTGTGTTTTCTTTGG - Intergenic
1200410565 Y:2856719-2856741 GTGAAACCCTGTCTCTACTTGGG - Intronic
1202130146 Y:21601920-21601942 GTGCACTCCACTATCATCTTGGG - Intergenic