ID: 1024323090

View in Genome Browser
Species Human (GRCh38)
Location 7:48089036-48089058
Sequence CCTCCCGGGACCTTCGCGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 66}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024323081_1024323090 18 Left 1024323081 7:48088995-48089017 CCCAGCTGCTCTGCAGAGGCGAG 0: 1
1: 0
2: 1
3: 26
4: 436
Right 1024323090 7:48089036-48089058 CCTCCCGGGACCTTCGCGGGAGG 0: 1
1: 0
2: 0
3: 10
4: 66
1024323082_1024323090 17 Left 1024323082 7:48088996-48089018 CCAGCTGCTCTGCAGAGGCGAGA 0: 1
1: 0
2: 2
3: 21
4: 241
Right 1024323090 7:48089036-48089058 CCTCCCGGGACCTTCGCGGGAGG 0: 1
1: 0
2: 0
3: 10
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024323090 Original CRISPR CCTCCCGGGACCTTCGCGGG AGG Intronic