ID: 1024324277

View in Genome Browser
Species Human (GRCh38)
Location 7:48096515-48096537
Sequence CTGGGGAAGGGGAAGTGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2940
Summary {0: 1, 1: 0, 2: 23, 3: 303, 4: 2613}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024324277 Original CRISPR CTGGGGAAGGGGAAGTGGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr