ID: 1024325626

View in Genome Browser
Species Human (GRCh38)
Location 7:48107238-48107260
Sequence CATTATAGGCAGGACCTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 150}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024325623_1024325626 -10 Left 1024325623 7:48107225-48107247 CCGTTTGAGTGGTCATTATAGGC 0: 1
1: 0
2: 0
3: 4
4: 62
Right 1024325626 7:48107238-48107260 CATTATAGGCAGGACCTGGATGG 0: 1
1: 0
2: 0
3: 9
4: 150
1024325621_1024325626 -9 Left 1024325621 7:48107224-48107246 CCCGTTTGAGTGGTCATTATAGG 0: 1
1: 0
2: 0
3: 5
4: 77
Right 1024325626 7:48107238-48107260 CATTATAGGCAGGACCTGGATGG 0: 1
1: 0
2: 0
3: 9
4: 150
1024325618_1024325626 10 Left 1024325618 7:48107205-48107227 CCCAGAGTGGTTATAATGACCCG 0: 1
1: 0
2: 0
3: 3
4: 46
Right 1024325626 7:48107238-48107260 CATTATAGGCAGGACCTGGATGG 0: 1
1: 0
2: 0
3: 9
4: 150
1024325619_1024325626 9 Left 1024325619 7:48107206-48107228 CCAGAGTGGTTATAATGACCCGT 0: 1
1: 0
2: 0
3: 4
4: 32
Right 1024325626 7:48107238-48107260 CATTATAGGCAGGACCTGGATGG 0: 1
1: 0
2: 0
3: 9
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024325626 Original CRISPR CATTATAGGCAGGACCTGGA TGG Intronic
900151226 1:1180120-1180142 CACTGTGGGCCGGACCTGGAGGG + Exonic
900605822 1:3523112-3523134 CATCACAGGCAGGACCGGGAGGG + Intronic
901372978 1:8816848-8816870 CATTATTGGCTGAAACTGGAAGG - Intronic
901412603 1:9094943-9094965 CATTAAAGGAATGACTTGGATGG - Intergenic
904413146 1:30337133-30337155 CATCAAAGGAAGGAGCTGGAAGG - Intergenic
909643856 1:77895004-77895026 CACTATAGGCTGGCCATGGATGG - Intronic
912757526 1:112336825-112336847 CATTTTAGGAAGGACCCTGACGG - Intergenic
915571834 1:156749104-156749126 CGTGATAGGCAGGACCTGCCTGG - Intronic
917867778 1:179213680-179213702 CAATATAGGGAGGAAATGGATGG + Intronic
918420560 1:184360495-184360517 CAATATAGGCAAGTCCCGGATGG - Intergenic
918536940 1:185585003-185585025 CATTAGAGGCTGGAGCTGCATGG - Intergenic
918882049 1:190137472-190137494 CATTATAGACAAGAGGTGGAGGG + Intronic
920202451 1:204267897-204267919 CATAATAAGCAGGACCTGCTGGG + Intronic
920507488 1:206526690-206526712 CATTAAAGGCAGAAGTTGGAGGG + Intronic
920898741 1:210085011-210085033 CATTCTAGGCAGTGCCTGCATGG - Intronic
923276791 1:232403511-232403533 CAGCATGGGCAGGACCTGGAAGG - Exonic
1062817655 10:512617-512639 CATTATAGAAAGGAGCTGGCCGG + Intronic
1064871191 10:19938614-19938636 CATTGGAGGTAGGACCTGGTGGG - Intronic
1068420738 10:56788971-56788993 GATTATAGGCATGACCTGCCAGG + Intergenic
1069841299 10:71341080-71341102 AATGAGAGGCAGGAGCTGGAAGG - Intronic
1078613337 11:12841301-12841323 GATTATAGGCATGGCCTGGTGGG - Intronic
1078990135 11:16637844-16637866 TTTTATAGGCAAGGCCTGGAAGG + Intronic
1081969761 11:47189612-47189634 CATTCTAGGCAGGAGCTTCAGGG + Intergenic
1083023269 11:59528683-59528705 CAGTATGGGCAGAACATGGAGGG + Intergenic
1087028954 11:93682774-93682796 CATTATAGCTAGGGCATGGAGGG - Intronic
1087286559 11:96270743-96270765 CATTACAGGAAGGTACTGGAGGG - Intronic
1089817242 11:121187368-121187390 CAAAATAGGTAGGAGCTGGAGGG - Intronic
1091420018 12:329096-329118 AATAAAAGGGAGGACCTGGAGGG - Intronic
1096607745 12:52778588-52778610 CATTATAAGAATGACCTGGAGGG - Intergenic
1099525773 12:83718091-83718113 CATTGCAGGAAGGACCTGGTGGG + Intergenic
1100387632 12:94118532-94118554 CCTAATGGGCAGGACCTGCAAGG + Intergenic
1101988122 12:109463164-109463186 CATCAAAGGCAGAACGTGGAAGG - Intronic
1105053149 12:133073066-133073088 CATTATAGGTAGTACATGGTAGG - Intergenic
1107121355 13:36799813-36799835 CATTATCCTCAGGAGCTGGAAGG - Intergenic
1107339723 13:39393430-39393452 CATTTTAGGCTGGACCTGAGGGG + Intronic
1111954655 13:94743100-94743122 CATTATAGGCAGAATATGGAAGG + Intergenic
1117420862 14:55543631-55543653 CAGTTTACCCAGGACCTGGAAGG + Intergenic
1117760356 14:59020897-59020919 CAGTTTAGGCAGGACATGGTGGG + Intergenic
1119064613 14:71512735-71512757 CAGGATAGGGAGGGCCTGGAAGG - Intronic
1123827605 15:24099361-24099383 CATCAAAGGCAGGACCAGCAGGG + Intergenic
1123842063 15:24258743-24258765 CATCAAAGGCAGGACCAGCAGGG + Intergenic
1123857080 15:24424821-24424843 CATCAAAGGCAGGACCAGCAGGG + Intergenic
1123861713 15:24475349-24475371 CATCAAAGGCAGGACCAGCAGGG + Intergenic
1125723252 15:41855231-41855253 GACTACGGGCAGGACCTGGAGGG - Exonic
1126121144 15:45252702-45252724 CATTATAGTCAGGAATTTGAAGG + Intronic
1128452334 15:67812860-67812882 CTTTAGAAGAAGGACCTGGAGGG - Intergenic
1128634865 15:69296749-69296771 AATCACAGGCAGGATCTGGAAGG - Intergenic
1130429561 15:83832889-83832911 TATTAGAGGCACGACCTGGTTGG + Intronic
1132065492 15:98727653-98727675 CATTATACCCAGGGGCTGGAGGG + Intronic
1134872243 16:17662428-17662450 CCTTATAGGCAAGACCTGCCAGG - Intergenic
1136279316 16:29198743-29198765 CATTGGAGGCAGGACCAGCACGG + Intergenic
1137793314 16:51193737-51193759 GTTGATAGGCAGGTCCTGGAGGG + Intergenic
1142601749 17:1056398-1056420 CAGGATAGGCAGGATTTGGAGGG - Intronic
1146558588 17:33848682-33848704 CATTCTAGGCAGTAGCTGGATGG + Intronic
1149532640 17:57407712-57407734 AATTGTAGGCTGGACCAGGAAGG + Intronic
1149720667 17:58840966-58840988 TTTTATAGGCTGGACCTGGAGGG + Intronic
1149902183 17:60490689-60490711 CATTATGGGAGGGACCTGGTGGG + Intronic
1150122669 17:62616998-62617020 CTTTATGGGGAGCACCTGGAGGG + Intergenic
1151524975 17:74658901-74658923 CATCATGGGCAGGGCCTGGGCGG + Intergenic
1153003541 18:477836-477858 GATTAGGGGCAGGACCTAGAGGG + Intronic
1153336270 18:3928872-3928894 CGTTAGAGGTAGGACCTGGTGGG + Intronic
1153768413 18:8396429-8396451 CATTAGAGGAAAGGCCTGGAAGG - Intronic
1158846966 18:61454406-61454428 CATTCCAGACAGGTCCTGGAAGG - Intronic
1163768380 19:19176235-19176257 CATCCTAGGCAGGTCCTGGGAGG + Intronic
1165716324 19:38048093-38048115 CATTAGAGGCATGAACAGGAAGG - Intronic
1166806918 19:45492995-45493017 CAGTATAGGGAGGACCCAGAGGG - Intronic
1167948046 19:53005126-53005148 CATTATGTGGAGGACCTGGATGG - Intergenic
925306938 2:2854490-2854512 CCTTGTAAGCAGGACATGGAAGG - Intergenic
925378272 2:3404544-3404566 CATTATATGCATGAACTGGGAGG + Intronic
927082798 2:19647273-19647295 CATTAGAGGCTTGGCCTGGAGGG + Intergenic
928980979 2:37134912-37134934 CATTAAAGGAATGACGTGGATGG - Intronic
929868232 2:45736348-45736370 CATGATAGGCGGGAGTTGGAAGG + Intronic
932942203 2:76180766-76180788 CATTCTAGGGAGGACTTGTATGG + Intergenic
934046510 2:88177128-88177150 CATTAAATGCTGGACCTGAAGGG + Intronic
936479213 2:112869340-112869362 CATGACAGGCAGCACCAGGAAGG - Intergenic
938069995 2:128303253-128303275 CAGTAAAGGCAGGGCCAGGAGGG + Intronic
938207569 2:129437339-129437361 CATTGAAGGAAGGGCCTGGAGGG + Intergenic
942299237 2:174546591-174546613 CAATTTGTGCAGGACCTGGAGGG - Intergenic
943589020 2:189775093-189775115 CATTATAGGATAGACCTGGGTGG - Intronic
945659724 2:212671022-212671044 CATTATAGGCAGTGAATGGAAGG - Intergenic
947199933 2:227606032-227606054 AAGTATAGGCAGGACTTAGAGGG + Intergenic
948474216 2:238206296-238206318 CATTAAAGGAATGACGTGGATGG + Intergenic
948981944 2:241498942-241498964 CCTTCTAGACAGGACGTGGAGGG - Intronic
1169916749 20:10691012-10691034 AACAATAGGCAGGACCAGGAAGG - Intergenic
1170921899 20:20687020-20687042 GACTATAGGCAGGGCTTGGATGG - Intronic
1171381605 20:24737981-24738003 GATTCCAGGAAGGACCTGGAAGG + Intergenic
1178041144 21:28642298-28642320 CTTCATGGGCAGGAACTGGAGGG + Intergenic
1180905633 22:19409062-19409084 AATTCCAGGCAGCACCTGGAAGG - Intronic
1184483478 22:44761994-44762016 CATTATGGGAGGGACCTGGTGGG - Intronic
1184769239 22:46588154-46588176 CAGGATAGGCAGGCCCTGGGGGG + Intronic
951184502 3:19696997-19697019 TATTACAGGTAGGACCTGGTGGG + Intergenic
956049146 3:65228910-65228932 AGCTATAGACAGGACCTGGATGG + Intergenic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
956374220 3:68596906-68596928 CCCTATAGGAAAGACCTGGAAGG + Intergenic
958126417 3:89361998-89362020 AATTATAATCAGGACCTTGAGGG - Intronic
959856268 3:111162318-111162340 CATCATGGGAAGGACCTGGTGGG + Intronic
961368948 3:126418096-126418118 CCTTCTAGCCAGGACCTGAATGG - Intronic
962277638 3:134028385-134028407 CATTTTTGGCCAGACCTGGATGG - Intronic
967371108 3:188747174-188747196 CATTATAGGAAGGATTTGGTTGG - Intronic
970761041 4:19487058-19487080 CATTATAAGCAGGAACGGCAAGG + Intergenic
978273973 4:106926445-106926467 TTTTATAGGCAGGAACTGAAAGG - Intronic
978611767 4:110549133-110549155 CATTACAGGAAGGTCCGGGATGG + Intronic
979046532 4:115873356-115873378 GATGATATGCAGGACCAGGAAGG + Intergenic
979633407 4:122929134-122929156 CACAAGAGGCTGGACCTGGATGG - Exonic
980223460 4:129949315-129949337 CACTATAGGTAAGAGCTGGATGG + Intergenic
982388569 4:154839025-154839047 CATTAGAGGCTGGAGCTGCATGG - Intergenic
985575254 5:670813-670835 GAGAATAGGCAGGGCCTGGAGGG - Intronic
985583396 5:712210-712232 CTCTACAGGCAGGACCTTGATGG + Exonic
985596909 5:796508-796530 CTCTACAGGCAGGACCTTGATGG + Exonic
985884835 5:2669887-2669909 CAGCATAGGCATGACTTGGAAGG - Intergenic
987764166 5:22203664-22203686 CATTATAGGCAAGAGTAGGAAGG - Intronic
989189117 5:38652887-38652909 CATTATAGGAAGGATCTGGTTGG + Intergenic
991385810 5:66087732-66087754 TCTTAAAGGCAAGACCTGGAAGG + Intergenic
991898897 5:71436748-71436770 CATTATAGGCAAGAGTAGGAAGG - Intergenic
993296971 5:86153200-86153222 CAAACTAGGCAGGAACTGGAGGG + Intergenic
995379370 5:111514721-111514743 GATTATAGTCAGGACTTGGCAGG - Intergenic
995420503 5:111961659-111961681 CATTATATGCAGGAACTATAGGG - Intronic
997613178 5:135229347-135229369 GCGTATGGGCAGGACCTGGAAGG + Intronic
997677443 5:135723649-135723671 GCTTACAGGCAGGCCCTGGAAGG - Intergenic
998127759 5:139635825-139635847 CATTCTAGACAGGACCTTTAGGG + Intergenic
1004554869 6:16686278-16686300 CCTTTTAGGAAAGACCTGGAAGG - Intronic
1005033153 6:21530163-21530185 CATTTTCTGCAGGAGCTGGAAGG - Intergenic
1006040665 6:31251836-31251858 CATTAGAGGTGGGACCTGCAGGG + Intergenic
1008578753 6:52886168-52886190 CATGACAGGGAGGACCAGGAAGG + Intronic
1013959128 6:115876825-115876847 CATTTTAGTTAGGACCTTGAGGG + Intergenic
1015191196 6:130474349-130474371 CATTTTGGGCAAGATCTGGAAGG - Intergenic
1015407328 6:132852627-132852649 CTTGATATGCAGGCCCTGGATGG + Intergenic
1023577755 7:41647535-41647557 CATTTTAGCCAGGACCTTCAGGG + Intergenic
1024325626 7:48107238-48107260 CATTATAGGCAGGACCTGGATGG + Intronic
1026181768 7:68047882-68047904 CATTCTGGGCAGAACCTGGTAGG + Intergenic
1028416686 7:90587947-90587969 CATTCTAGGTAGGGACTGGAAGG - Intronic
1028984829 7:97001671-97001693 CAAACCAGGCAGGACCTGGATGG - Intergenic
1029140316 7:98404823-98404845 CATGATTGGCTGTACCTGGATGG - Intergenic
1029269114 7:99365904-99365926 CATTATCCGGAGGCCCTGGATGG - Exonic
1030804456 7:113898013-113898035 CATTATAGTCAATACTTGGAAGG + Intronic
1032440205 7:131936983-131937005 CATTGTGGGAAAGACCTGGAGGG + Intergenic
1033258354 7:139821080-139821102 CTTCATAGGCAGGACCAGCAGGG + Intronic
1033310962 7:140261480-140261502 CGTTGGAGGCAGGACCTGGTGGG - Intergenic
1034384608 7:150729746-150729768 TGTTAGAGGCAGGACCTGGTGGG + Intronic
1035311978 7:157975193-157975215 CAGTGTTGGCAGGAACTGGAGGG - Intronic
1035765973 8:2105712-2105734 CACTTTAGGGAGGACCTGGAGGG - Intronic
1038494947 8:27994773-27994795 AAGTATAGGAATGACCTGGAGGG + Intergenic
1046645094 8:116777200-116777222 CTCTAGAGGCAGGATCTGGAAGG + Intronic
1047356777 8:124129570-124129592 CATTCTAGGAAGCACCCGGATGG + Intergenic
1049076159 8:140397942-140397964 CATTGTAGGAGGGACCTGGTGGG + Intronic
1061569588 9:131468849-131468871 CATTAAAGGCGGTCCCTGGAAGG - Intronic
1203771432 EBV:51846-51868 AATTTTCTGCAGGACCTGGACGG - Intergenic
1203435147 Un_GL000195v1:130925-130947 CATCTCAGGAAGGACCTGGAAGG + Intergenic
1185914261 X:4018024-4018046 TATTGTGGGAAGGACCTGGAGGG - Intergenic
1187255610 X:17639184-17639206 CATTATAGCCAGAGCCTTGAGGG + Intronic
1188981803 X:36733512-36733534 CAGTCTAGGGAGAACCTGGAAGG - Intergenic
1189120971 X:38394639-38394661 CATTAAAGGGAGGCCATGGAGGG - Intronic
1189614546 X:42769893-42769915 CATTAAAGGAATGACGTGGATGG - Intergenic
1190214787 X:48472737-48472759 CAGTAGAGGCAGGCCCTGGGAGG - Intergenic
1191634734 X:63363393-63363415 CATTAGAGGCTGGAGCTGTATGG - Intergenic
1192409650 X:70922047-70922069 CATTTCAGGCAGTAGCTGGAGGG - Intergenic
1193238957 X:79143771-79143793 TATTATAGGGAATACCTGGAGGG - Intergenic
1194036254 X:88876041-88876063 CATTATGGGAGGGACCTGGCGGG + Intergenic
1196119294 X:112031300-112031322 CATTCAAGGCAGGGACTGGAGGG - Intronic
1196978892 X:121189870-121189892 CATTTTAGGCATGACTTGGGTGG + Intergenic