ID: 1024326613

View in Genome Browser
Species Human (GRCh38)
Location 7:48114231-48114253
Sequence AGGTGCCTCTGCAGGGCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024326613_1024326623 20 Left 1024326613 7:48114231-48114253 CCAGAAGCCCTGCAGAGGCACCT No data
Right 1024326623 7:48114274-48114296 GGGTTCCCTGCAGGGCCCCACGG No data
1024326613_1024326622 12 Left 1024326613 7:48114231-48114253 CCAGAAGCCCTGCAGAGGCACCT No data
Right 1024326622 7:48114266-48114288 ACAAGGCAGGGTTCCCTGCAGGG No data
1024326613_1024326620 0 Left 1024326613 7:48114231-48114253 CCAGAAGCCCTGCAGAGGCACCT No data
Right 1024326620 7:48114254-48114276 TGCAGAGTCTGGACAAGGCAGGG No data
1024326613_1024326621 11 Left 1024326613 7:48114231-48114253 CCAGAAGCCCTGCAGAGGCACCT No data
Right 1024326621 7:48114265-48114287 GACAAGGCAGGGTTCCCTGCAGG No data
1024326613_1024326617 -5 Left 1024326613 7:48114231-48114253 CCAGAAGCCCTGCAGAGGCACCT No data
Right 1024326617 7:48114249-48114271 CACCTTGCAGAGTCTGGACAAGG No data
1024326613_1024326619 -1 Left 1024326613 7:48114231-48114253 CCAGAAGCCCTGCAGAGGCACCT No data
Right 1024326619 7:48114253-48114275 TTGCAGAGTCTGGACAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024326613 Original CRISPR AGGTGCCTCTGCAGGGCTTC TGG (reversed) Intergenic
No off target data available for this crispr