ID: 1024328052

View in Genome Browser
Species Human (GRCh38)
Location 7:48128305-48128327
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024328051_1024328052 14 Left 1024328051 7:48128268-48128290 CCTGGAAAAACTTAAAATTTTTT No data
Right 1024328052 7:48128305-48128327 AGATATATGTTAAACTACTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024328052 Original CRISPR AGATATATGTTAAACTACTT AGG Intergenic
No off target data available for this crispr