ID: 1024332831

View in Genome Browser
Species Human (GRCh38)
Location 7:48173410-48173432
Sequence TTGAATAAGTAAAAGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1057
Summary {0: 1, 1: 0, 2: 8, 3: 93, 4: 955}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024332827_1024332831 21 Left 1024332827 7:48173366-48173388 CCAGAACAGTGCCTGGCACACAA 0: 3
1: 19
2: 175
3: 597
4: 1645
Right 1024332831 7:48173410-48173432 TTGAATAAGTAAAAGAAGGAAGG 0: 1
1: 0
2: 8
3: 93
4: 955
1024332824_1024332831 28 Left 1024332824 7:48173359-48173381 CCAGCACCCAGAACAGTGCCTGG 0: 4
1: 61
2: 339
3: 1023
4: 2760
Right 1024332831 7:48173410-48173432 TTGAATAAGTAAAAGAAGGAAGG 0: 1
1: 0
2: 8
3: 93
4: 955
1024332826_1024332831 22 Left 1024332826 7:48173365-48173387 CCCAGAACAGTGCCTGGCACACA 0: 25
1: 285
2: 1133
3: 3101
4: 6208
Right 1024332831 7:48173410-48173432 TTGAATAAGTAAAAGAAGGAAGG 0: 1
1: 0
2: 8
3: 93
4: 955
1024332829_1024332831 10 Left 1024332829 7:48173377-48173399 CCTGGCACACAATGGATGTTCAG 0: 1
1: 1
2: 14
3: 167
4: 974
Right 1024332831 7:48173410-48173432 TTGAATAAGTAAAAGAAGGAAGG 0: 1
1: 0
2: 8
3: 93
4: 955

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024332831 Original CRISPR TTGAATAAGTAAAAGAAGGA AGG Intronic
901265022 1:7903360-7903382 ATTAATAATTAAAAAAAGGAAGG - Intergenic
901750989 1:11408367-11408389 ATGAATAAGTGAATGAATGAAGG - Intergenic
903611246 1:24615060-24615082 TTGAACAAGGAAAACAAAGAGGG - Intergenic
903756122 1:25662244-25662266 TTGAATAAGCAAATGCAGGGAGG + Intronic
904127251 1:28249786-28249808 TTGAATGAAAAAAGGAAGGAAGG + Intergenic
904273474 1:29365359-29365381 AAGAAAAAGAAAAAGAAGGAAGG - Intergenic
904535530 1:31197058-31197080 TGGAAAAAATAAAGGAAGGAGGG - Intronic
904955885 1:34283511-34283533 TAAAATAAGGAAAATAAGGAAGG - Intergenic
904973914 1:34441508-34441530 CTGAATATGAAAATGAAGGAGGG - Intergenic
904987106 1:34560992-34561014 TTGAAAAAATAAATGAATGAAGG - Intergenic
905194682 1:36266503-36266525 TTTAAAAAGTAAATGATGGAAGG + Intronic
905477406 1:38238807-38238829 ATGATTAAGTAAATGAATGACGG + Intergenic
905529088 1:38662177-38662199 ATGAAGGAGAAAAAGAAGGAAGG + Intergenic
905540668 1:38757925-38757947 CTGAATAAATGAAGGAAGGAAGG + Intergenic
905959231 1:42029620-42029642 TTTAATAAATAACACAAGGATGG + Intronic
906093600 1:43204230-43204252 TTAAATAATTAAAGGAAGGTAGG - Intronic
906399903 1:45497280-45497302 TTGAGTAAGTAAAAGGTGGTTGG - Exonic
906462337 1:46044480-46044502 AAGAATAATAAAAAGAAGGAAGG - Intronic
906905642 1:49888600-49888622 GTTAACAAGTAAAAGAAGGATGG + Intronic
907131515 1:52101603-52101625 AAGAATAACTAAAAGAAGGCTGG + Intergenic
907643542 1:56217219-56217241 TGGAAGAAAGAAAAGAAGGAAGG + Intergenic
907808707 1:57846510-57846532 TTTAATAAGTGAACAAAGGAGGG - Intronic
908165024 1:61449347-61449369 TTAAATAAATAAAGGAGGGAAGG - Intronic
908389740 1:63673661-63673683 TTGAAGAACTAAAAGAACGCCGG - Intergenic
908756565 1:67474161-67474183 ATAAATAAGTAAAAGAGGGCCGG - Intergenic
908870325 1:68603240-68603262 TTAAAGAAGTAAAGGAGGGAGGG - Intergenic
909186463 1:72492563-72492585 ATAAATAAATAAAAGAAGGAAGG + Intergenic
909282000 1:73768830-73768852 TGTAATAAGTAAGTGAAGGAAGG + Intergenic
909540068 1:76781415-76781437 TTAAATCAGAAAAGGAAGGAAGG - Intergenic
909732128 1:78905751-78905773 TTGAATAAATAAAAGGGTGAAGG + Intronic
910021792 1:82599673-82599695 ATGAATGAGGACAAGAAGGAAGG - Intergenic
911124015 1:94323448-94323470 TGGAAAAAGTGAAGGAAGGAGGG - Intergenic
911286855 1:96005484-96005506 ATAAATAAGTAAAAGGAAGATGG - Intergenic
911483655 1:98477412-98477434 CTGAAAAAGTAAGATAAGGAAGG - Intergenic
911577765 1:99598552-99598574 AGGAATAAATGAAAGAAGGAAGG - Intergenic
911786463 1:101955528-101955550 TTTAAGAAGTAGAAGATGGATGG - Intronic
912344101 1:108948060-108948082 TTTAACAAGAGAAAGAAGGAAGG + Intronic
912347583 1:108978882-108978904 TAGAATAAGTTAAAGACTGAGGG + Intronic
913329709 1:117657066-117657088 ATGAATGAATAAAGGAAGGAAGG - Intergenic
914512950 1:148350971-148350993 TTTAAAAAGAAAGAGAAGGAAGG + Intergenic
914817474 1:151073624-151073646 TTGAGAAAGTAAAGGAAGGCCGG + Intronic
914925656 1:151884101-151884123 ATAAATAAATAAAGGAAGGAAGG + Intronic
915182469 1:154074379-154074401 TTGAGGAAGGAAGAGAAGGAGGG - Intronic
915639332 1:157210760-157210782 TTGAATTATTACAAGAAGTAAGG + Intergenic
916290838 1:163164642-163164664 ATTAATAAGTAAATGAATGATGG + Intronic
916511734 1:165477937-165477959 TTGAATAAATAAATAAATGAGGG - Intergenic
916544859 1:165794373-165794395 TTGAGTCAGTAAATGAAGGAAGG + Intronic
916565294 1:165970639-165970661 TTGAAGAAGAAAAATAAGAAAGG - Intergenic
916779266 1:168007452-168007474 GTTAATAAATAAATGAAGGATGG - Intronic
916859740 1:168790185-168790207 CTAAATATGTAAGAGAAGGAAGG + Intergenic
916970364 1:170007055-170007077 TGGAAAAAGTTAAAGAAGGAGGG + Intronic
917515402 1:175703028-175703050 TTTTTTAAATAAAAGAAGGAAGG + Intronic
917694570 1:177508676-177508698 ATGAATAAATGAAAGAAAGAAGG + Intergenic
917753889 1:178080004-178080026 TTGAAAAAGGAAAATAAGAATGG + Intergenic
918032568 1:180829874-180829896 TTAAATAAGGAAAAAAGGGATGG - Intronic
918219719 1:182425945-182425967 CTGAAAAAGAAAAAGAAAGAAGG + Intergenic
918469600 1:184858237-184858259 GAGAACAAGAAAAAGAAGGAAGG + Intronic
918556111 1:185801333-185801355 TGAAATAAGTGGAAGAAGGATGG - Intronic
918598625 1:186324794-186324816 ATAAATAGGAAAAAGAAGGAAGG + Intronic
919005591 1:191895526-191895548 TTGAATATGTAACCAAAGGAAGG + Intergenic
919090228 1:192969980-192970002 TTGAATGAATAAAACAATGATGG - Intergenic
919315992 1:195970846-195970868 CTGAATAAGAAAATGAAGAAAGG + Intergenic
919592317 1:199520227-199520249 TTGAATAGGGGAGAGAAGGATGG - Intergenic
919722454 1:200853085-200853107 ATAAATAAGTAAATAAAGGAGGG - Intronic
920165721 1:204034429-204034451 CTCAATAAAAAAAAGAAGGAAGG - Intergenic
921058618 1:211563838-211563860 TTTAAAAAATAAAAGAAGAAAGG + Intergenic
921729788 1:218565003-218565025 ATAAATAAGTAAACAAAGGAAGG + Intergenic
921781141 1:219165988-219166010 TTGAAGAAGTAAATAGAGGAGGG + Intergenic
922304329 1:224330683-224330705 GTGAAAAAGAAAAGGAAGGACGG + Intergenic
923492931 1:234500195-234500217 TTCAAAAAGAGAAAGAAGGAAGG - Intergenic
924010995 1:239665206-239665228 TTGAATGAGTTAAAGAAGACAGG - Intronic
924375340 1:243402129-243402151 TTTAAAAAGTAAAAGGAGGCTGG + Intronic
924550186 1:245068879-245068901 TTGCACAAGAAAAAAAAGGAAGG + Intronic
924593667 1:245426989-245427011 TTGATGAAGTCAGAGAAGGATGG + Intronic
924600657 1:245485864-245485886 ATGAATAAATAAATGAAGGAAGG + Intronic
1062865547 10:849499-849521 TTGAATAAGTAAATAAATAAAGG + Intronic
1063100862 10:2949100-2949122 TTGAAAAAAAAAAAGAAAGAAGG + Intergenic
1064420790 10:15189097-15189119 AAGAATAAATAAAAGAATGACGG - Intergenic
1064844143 10:19632602-19632624 TTGAATAAGTGAAACAATGTTGG - Intronic
1065022609 10:21512784-21512806 TTCAAGAAGGAAAGGAAGGAAGG + Intergenic
1065963638 10:30753838-30753860 GTGAATAAGAAAAGGAAGGCAGG - Intergenic
1066283844 10:33944737-33944759 CTGAATATGTAAAAGATGGAAGG + Intergenic
1066284010 10:33946310-33946332 CTGAATATGTAAAAGAAGGAAGG + Intergenic
1067084035 10:43228869-43228891 CTGAGTAAGTGAAAGAAGGAAGG + Intronic
1067161463 10:43828396-43828418 AGGAAGAAGGAAAAGAAGGAAGG + Intergenic
1067383365 10:45795682-45795704 TTGAATGAGTGAAAGAAAGGGGG + Intergenic
1067493857 10:46743635-46743657 TTGAATAAGTAATAGAAGCCTGG - Intergenic
1067830108 10:49606870-49606892 TTGAATGAGTAGAGGAAGGAAGG - Intergenic
1067880801 10:50043104-50043126 TTGAATGAGTGAAAGAAAGGGGG - Intergenic
1068121072 10:52782499-52782521 TTGAAGAAATCACAGAAGGAGGG + Intergenic
1068121141 10:52782990-52783012 TTGAAGAAGTGAAAGAACAAAGG - Intergenic
1068238239 10:54266793-54266815 TTGAATAAGTAATAGAAGTCCGG + Intronic
1068285629 10:54930400-54930422 TTTAACAGGTAAAAGAAAGAGGG - Intronic
1068329476 10:55543873-55543895 TTGAAGAAAAAAAGGAAGGAAGG - Intronic
1068620278 10:59174831-59174853 TTGAAAAAGTAAAAGTAGGATGG - Intergenic
1068905745 10:62320005-62320027 TTGAATAAATAACAAAGGGAAGG - Intergenic
1069195301 10:65544130-65544152 CTGATTAAGAATAAGAAGGAGGG - Intergenic
1069198203 10:65581053-65581075 GTGAATGAATAAAAGAATGAAGG + Intergenic
1069244954 10:66192671-66192693 TTGAATAAATAAAGGCAGGCTGG - Intronic
1069747152 10:70722819-70722841 TAGAATAAATAAACGAAGAAGGG + Intronic
1069771098 10:70901103-70901125 TTGAGGAAGGAAAGGAAGGAGGG - Intergenic
1070057265 10:72947534-72947556 CTCAATAAGAAAAAGAAGGCTGG - Intronic
1070361449 10:75693815-75693837 TTGAATAAAAAAAAGCAGGATGG + Intronic
1070882001 10:79858899-79858921 TTGAAGGAGTAAAGGAAGCAAGG + Intergenic
1071648575 10:87375210-87375232 TTGAAGGAGTAAAGGAAGCAAGG + Intergenic
1071652341 10:87404636-87404658 TTGAATAAGTAATAGAAGCCTGG + Intergenic
1072160557 10:92762290-92762312 TTGAAGAAGTTGAAGCAGGAAGG - Intergenic
1072670360 10:97425070-97425092 TTAAAAAAGAAAAAGAAGGCCGG + Intronic
1073372517 10:103003412-103003434 TTAAAAAAGTACTAGAAGGAGGG - Intronic
1073638300 10:105221897-105221919 TTAAAGAAGAGAAAGAAGGAGGG + Intronic
1073881723 10:107989332-107989354 TTGAATAAGAAAAAGAAAGCTGG + Intergenic
1074184109 10:111086391-111086413 TTGAATGAATAAAGGAAGGAAGG - Intergenic
1074223831 10:111463856-111463878 TTAAATAGGTAAATGAATGAAGG - Intergenic
1074758800 10:116648495-116648517 AAGAAGAAGAAAAAGAAGGAAGG + Intergenic
1074805929 10:117052477-117052499 TTGAATAAGAAAAACAAAGTTGG + Intronic
1074839129 10:117330619-117330641 TTTAATAGGAACAAGAAGGAAGG - Intronic
1075323695 10:121512768-121512790 ATGAATAAATAAAGGAAGGAGGG + Intronic
1075560306 10:123463398-123463420 ATGAGGAAATAAAAGAAGGAAGG - Intergenic
1076407826 10:130225003-130225025 ATAAACAAGTAAAAGAAGGGTGG - Intergenic
1076523340 10:131094738-131094760 TTACATCAGTAAAGGAAGGAAGG - Intronic
1076712819 10:132347921-132347943 TTGAATAAGTCACAGAGGGATGG + Intronic
1077803442 11:5565548-5565570 TTGAAAAACTAAAAGAAATATGG + Intronic
1077859995 11:6169539-6169561 GTCAATAAGGTAAAGAAGGATGG + Exonic
1078313486 11:10270695-10270717 TTTAAGAAGTAAAATGAGGACGG + Intronic
1078459306 11:11501322-11501344 ATGAATAAGTGACAGAGGGAAGG + Intronic
1079127333 11:17727278-17727300 TGGGAAAAGTAAAAGAAAGAAGG - Intergenic
1079213873 11:18488750-18488772 TTCAAAAAGCAAAAAAAGGAAGG + Intronic
1079979501 11:27134813-27134835 TTGAATAAGAAAAACAAAGCTGG + Intergenic
1080011857 11:27468072-27468094 TGGTATTAGTAAAAGAAGAAAGG + Intronic
1080185383 11:29477904-29477926 TTTAATAAATTAAAGAAGCATGG - Intergenic
1080350979 11:31385813-31385835 TTGAATAACTATATTAAGGAAGG + Intronic
1080556623 11:33422784-33422806 ATGAAAAAGAAAAAAAAGGAAGG + Intergenic
1080955229 11:37085873-37085895 TTGAATAAATAAATGAATGAGGG - Intergenic
1080997506 11:37621797-37621819 TTGAATAAAACAAAGAAGGAAGG - Intergenic
1081238203 11:40671625-40671647 CTGAATAAGGACAAGAATGAAGG - Intronic
1081444848 11:43120811-43120833 TTGAATGACTAAATGAATGAAGG - Intergenic
1082282296 11:50282921-50282943 TTTAATAAGTACTTGAAGGAAGG - Intergenic
1082860024 11:57846671-57846693 TTGAAAAAGAAAAAGAAAGTTGG + Intergenic
1084299424 11:68237093-68237115 TTGAAAAAGAAAAAGAAGATTGG - Intergenic
1084907949 11:72363164-72363186 AAGAGAAAGTAAAAGAAGGAAGG + Intronic
1085408734 11:76279190-76279212 TTGAATCAACAAAAGAAGGTGGG - Intergenic
1085655944 11:78315100-78315122 TTGAGAGAGTAAGAGAAGGAAGG + Intronic
1086480263 11:87228250-87228272 TGGAATAAATAAATGAAGGAGGG + Intronic
1086571058 11:88285130-88285152 TAGAATAAATAAAAGAAGGGTGG - Intergenic
1087256019 11:95954707-95954729 TTTAATGAATCAAAGAAGGAAGG - Intergenic
1087469471 11:98552827-98552849 TAGAATAAGTTAAAGAAAGTAGG + Intergenic
1087470128 11:98562999-98563021 TGGCATAGGTATAAGAAGGAAGG + Intergenic
1087593408 11:100221648-100221670 TTGAATGAGTAAATAAAGGAAGG - Intronic
1087665437 11:101040998-101041020 TTGGATAATTAAATGAAGAAAGG - Intronic
1088296576 11:108303369-108303391 TTGAATAAGAAAAAGGAGTGGGG + Intronic
1088751858 11:112849093-112849115 AGGAAGAAATAAAAGAAGGAAGG - Intergenic
1088768874 11:113013128-113013150 TTTAAGAAGCAAAAGAAGGCGGG + Intronic
1088939448 11:114438895-114438917 TCCCATAAGAAAAAGAAGGAAGG + Intronic
1089037368 11:115408641-115408663 ATGAATAAGTACTAGGAGGAGGG - Intronic
1089383637 11:118053509-118053531 TTGAATAAGGAATCCAAGGAAGG - Intergenic
1089790203 11:120937348-120937370 TTGACTAGGTAAAATAACGAAGG + Intronic
1089833721 11:121351389-121351411 GTGGATAGGTAATAGAAGGAGGG + Intergenic
1089900568 11:121978799-121978821 TTGAATAAATAAAATAAAAAAGG + Intergenic
1089915976 11:122156753-122156775 AAGAATAAGGAAAGGAAGGAAGG + Intergenic
1089923277 11:122230680-122230702 TTGAATGAATATAGGAAGGAAGG - Intergenic
1090361280 11:126174695-126174717 TTGAATATATAAATGAAAGATGG - Intergenic
1090929870 11:131287602-131287624 ATGAATAAGTAAATGAATGTTGG + Intergenic
1091825939 12:3512789-3512811 ATGAATAAGTAAATGAACTATGG + Intronic
1091981506 12:4867986-4868008 GTGAGTTGGTAAAAGAAGGAGGG + Intergenic
1092551119 12:9501291-9501313 CCGAAAAAGAAAAAGAAGGAAGG - Intergenic
1092924319 12:13259767-13259789 TTGGGTAGGTAAAGGAAGGAGGG + Intergenic
1093083182 12:14837390-14837412 TTGAATGAGTGAATGAATGATGG - Intronic
1093155783 12:15683480-15683502 AAGAAGAAATAAAAGAAGGAAGG - Intronic
1093250008 12:16791326-16791348 TGGAATTAGTAAGAGAAAGAAGG + Intergenic
1093429446 12:19067700-19067722 ATGAATGAATAAAGGAAGGAGGG + Intergenic
1093781757 12:23145467-23145489 GTGAATAAGTGAAAGAAAGGGGG + Intergenic
1093821807 12:23628629-23628651 TTGGATAAGAAAAAGGAGTACGG + Intronic
1093829770 12:23741163-23741185 GTGAAAATGTAAAAGAAGGTAGG - Intronic
1093844971 12:23959212-23959234 TTGCAAAAGAAAAAGAATGAGGG + Intergenic
1094034901 12:26058107-26058129 TTGAGAAAGTAAAAATAGGAGGG - Intronic
1094146155 12:27230533-27230555 TTGCATGAGAGAAAGAAGGAAGG - Intergenic
1094183520 12:27616633-27616655 TTGAAGATGTAAAAGAGTGAAGG + Intronic
1094195758 12:27748310-27748332 ATGAATAAGTAAATGAATAATGG + Intronic
1094330082 12:29281694-29281716 ATGAAGAAGTGAAAGAAAGAAGG + Intronic
1094350525 12:29519679-29519701 TTGTTGAAGTAAAAGGAGGAGGG + Intronic
1094520685 12:31185065-31185087 CCGAAAAAGAAAAAGAAGGAAGG + Intergenic
1094738744 12:33264429-33264451 AGGAATAAAGAAAAGAAGGAAGG - Intergenic
1095344803 12:41137717-41137739 TGGATTTAGTAACAGAAGGAAGG - Intergenic
1095489117 12:42714683-42714705 ATGAATAAGAAAGACAAGGACGG + Intergenic
1095563545 12:43593851-43593873 AGGAATATGTAAAAGAAGGGTGG + Intergenic
1095703557 12:45215606-45215628 GAGAATAAGCAAAAGAAGAAGGG - Intergenic
1095918149 12:47501141-47501163 TTGAATTAGTTTCAGAAGGATGG - Intergenic
1095929111 12:47608012-47608034 ATGAAGAAGGGAAAGAAGGAAGG - Intergenic
1096792977 12:54056516-54056538 TTGAGTTCTTAAAAGAAGGAAGG + Intergenic
1096850102 12:54429854-54429876 TTTAAAAAGAAAAAGAAGAATGG - Intergenic
1097028252 12:56074490-56074512 CTGAATAAATGAAAGAAGGGAGG - Intergenic
1097426607 12:59453547-59453569 TTAAAAAAACAAAAGAAGGAGGG + Intergenic
1098096109 12:66957956-66957978 TTGAATAAGCAAATAAATGAGGG - Intergenic
1098139304 12:67435456-67435478 TTGAATGATGAAAAGAAGGAAGG - Intergenic
1098497792 12:71156487-71156509 TTAAAAAAGTAAAATAAAGAAGG - Intronic
1098836651 12:75431305-75431327 TTGAATAAGTATAGGAGAGAAGG - Exonic
1099335007 12:81344408-81344430 TTGAATATTTAAACCAAGGATGG - Intronic
1099345280 12:81492251-81492273 TTGAATTAGTAAATGCATGAAGG - Intronic
1099397749 12:82162055-82162077 TTGAATAAGGAAAAGAAAATAGG - Intergenic
1099770062 12:87040931-87040953 TAAAATAAGTGAAATAAGGAGGG + Intergenic
1099883728 12:88501168-88501190 TTGGAAAATGAAAAGAAGGAGGG - Intronic
1100181932 12:92095240-92095262 TTGAATCTGTCATAGAAGGAGGG + Intronic
1100949107 12:99825439-99825461 TTGAAAAACAAAAAGAAGGCTGG + Intronic
1101071220 12:101077885-101077907 CCGGATAAGCAAAAGAAGGAGGG - Intronic
1101160367 12:101967769-101967791 TTGAGAAAGTACAAGAAGAAAGG - Intronic
1101377089 12:104180631-104180653 ATGCATAAGTAAATGAAAGAAGG - Intergenic
1101962619 12:109261265-109261287 TTGAATTAGCAAATGAATGAGGG - Intronic
1102689107 12:114746603-114746625 TTGAATGAATGAAAGAAGGTTGG + Intergenic
1103531030 12:121601895-121601917 ATAAATAAAAAAAAGAAGGAAGG - Intergenic
1103790859 12:123469870-123469892 TTAAATAAAAAAAAAAAGGAGGG + Intronic
1103861006 12:124013949-124013971 TTGAATGAAGAAAAGAATGATGG - Exonic
1104085253 12:125468751-125468773 TTGAATAAATAAATTAAAGAAGG - Intronic
1104091474 12:125521320-125521342 TGGAATAAGGAAAAGGAGAAGGG - Intronic
1104177238 12:126344714-126344736 ATGAATAAATAAAGGAAGAAAGG + Intergenic
1104183594 12:126406426-126406448 TTAAATAAGCTAAAGAAGGCAGG + Intergenic
1104226859 12:126843475-126843497 TTGAACAAGTTAAAGGAGGAAGG - Intergenic
1104232123 12:126895639-126895661 TTGAAGAAAGTAAAGAAGGAAGG - Intergenic
1104754208 12:131258703-131258725 ATGAATAAGTAAATGGAGAAGGG - Intergenic
1105539238 13:21300377-21300399 TTGAATAGGTAACAAAAGAATGG + Intergenic
1106171665 13:27293861-27293883 TTGAATGAGTGAATGAAGGAAGG + Intergenic
1106199091 13:27521299-27521321 TTTAAAAAGTAAAAGCAGGCTGG + Intergenic
1106664786 13:31840342-31840364 TTGAAAAAGAAAAAGAAACAAGG + Intergenic
1106745147 13:32695952-32695974 TTGAAAAAGTAACAGAATGGAGG + Intronic
1106834563 13:33620126-33620148 TTGTATAAATAACAGAAAGAGGG - Intergenic
1107284114 13:38770561-38770583 TTGAATAATTAAAAGTAATATGG - Intronic
1108098205 13:46927006-46927028 TAGAGTCAGTAAAAGAAGGAAGG + Intergenic
1109184834 13:59255658-59255680 TTGAATGAAAAAAAGAAGGAAGG + Intergenic
1109185770 13:59265797-59265819 ATGAAAAAGAAAAAAAAGGAAGG - Intergenic
1109224512 13:59676022-59676044 TTGAAGAAGTATAAGAAATAAGG - Intronic
1109365628 13:61352493-61352515 TTATGTAAGAAAAAGAAGGAAGG - Intergenic
1109577198 13:64274945-64274967 TTTAATAAGTGAAAGACGAAAGG - Intergenic
1109689963 13:65873566-65873588 ATGAAGAAGGAAAGGAAGGAAGG + Intergenic
1110141139 13:72131002-72131024 TAGAATAAGCATAATAAGGAAGG + Intergenic
1110744428 13:79036360-79036382 AAGAAAAAGAAAAAGAAGGAAGG + Intergenic
1110751208 13:79118666-79118688 CTAAAAAAGAAAAAGAAGGAAGG + Intergenic
1110904419 13:80867540-80867562 TTGAATCAGCAAATAAAGGATGG + Intergenic
1110933922 13:81259132-81259154 GTGAATAAGAAAAAAAAGAAAGG - Intergenic
1111191067 13:84806830-84806852 TTAAAGAAATAAAAGAAAGAAGG + Intergenic
1111454346 13:88460511-88460533 TAGCATAAGGAAAAGAAAGATGG + Intergenic
1111473278 13:88714085-88714107 TTTAAAAAGGAAAAGATGGAGGG + Intergenic
1111683592 13:91474412-91474434 TTACATAAGTAAAAGAAAAATGG - Intronic
1111961901 13:94820863-94820885 TTCAATAAAAAAGAGAAGGAAGG - Intergenic
1112539055 13:100288812-100288834 GGGAAAAAGGAAAAGAAGGAAGG - Intronic
1112593956 13:100791000-100791022 TTAAATAAATAAAATAATGAAGG - Intergenic
1112643175 13:101300331-101300353 AAGAAAAAGAAAAAGAAGGAAGG - Intronic
1113130448 13:107030941-107030963 TTGAATAAATGAAGGAAGGAAGG - Intergenic
1113725688 13:112599404-112599426 TTGAATAAATAAATAAATGAGGG - Intergenic
1114336451 14:21696120-21696142 TTGAAAAAGAAAAATAAGGTGGG + Intergenic
1114441177 14:22749331-22749353 TTGCAGAATCAAAAGAAGGAAGG + Intergenic
1114642869 14:24236091-24236113 TTGAATTTGTAAAAGATGTACGG + Exonic
1114895870 14:26990618-26990640 TAGAATAGGGAGAAGAAGGAAGG + Intergenic
1115024625 14:28728821-28728843 ATGAAAAAATAATAGAAGGAAGG + Intergenic
1115064205 14:29236625-29236647 TTGAAGAAGAAAAGGAAGGTTGG + Intergenic
1115065863 14:29258720-29258742 TTGAATAAGTAAAGAAATGGTGG - Intergenic
1115078894 14:29426353-29426375 TTTAAGAAGGAAAAGAAGGAAGG + Intergenic
1115440014 14:33423907-33423929 TTGAAGAAGGAAAAAATGGAGGG - Intronic
1115467110 14:33727623-33727645 AAGAAAAAGAAAAAGAAGGAAGG + Intronic
1115630143 14:35236708-35236730 TTTAAGGAGTAAGAGAAGGAAGG - Intronic
1115655451 14:35439290-35439312 TTGAATGAGGAAAGGGAGGAGGG - Intergenic
1115919702 14:38359034-38359056 TAGACTAAGCAAAAAAAGGATGG + Intergenic
1115952312 14:38734966-38734988 CTAAAGAAGAAAAAGAAGGAGGG + Intergenic
1116109765 14:40562860-40562882 ATGAATGAGTAAAATAAGTATGG - Intergenic
1116558351 14:46342986-46343008 TTGAATAAGTAAATAAATGTGGG - Intergenic
1116608899 14:47040346-47040368 TTTAATCAGTAAAAAAAAGAGGG - Intronic
1116709660 14:48351051-48351073 ATCAGTAAGTAAAATAAGGATGG + Intergenic
1116898435 14:50339496-50339518 TTGAAGAAGGAAGAGAGGGAGGG + Intronic
1117293267 14:54354022-54354044 TTTAATAAGTGAAAGAAGAGAGG + Intergenic
1117354813 14:54913524-54913546 TTGAAAAAGAAAAAGAAAAATGG + Intergenic
1117925303 14:60772846-60772868 CTGAATAAGCAAATGAAGTAAGG + Intronic
1118205599 14:63720324-63720346 GAGAAAAAGGAAAAGAAGGATGG + Intronic
1118333151 14:64829882-64829904 TTGAAGAACTGAAAGAAGGCTGG - Intronic
1118529079 14:66682212-66682234 TTGAGTTAGAAAAAGAAAGATGG - Intronic
1118847459 14:69558486-69558508 TTCAAAAAAAAAAAGAAGGAAGG - Intergenic
1119039476 14:71259927-71259949 TAGAATAATAAAATGAAGGATGG + Intergenic
1119491430 14:75037220-75037242 TTAACTAAGTAAAGAAAGGAGGG - Intronic
1119531886 14:75367557-75367579 ATGAAGAAGGAAAAAAAGGAAGG + Intergenic
1119698450 14:76733623-76733645 TTGAAGAAGAAAAAGAAAGTTGG - Intergenic
1119838934 14:77776302-77776324 TTGAATAAGGAGAACAAGGTGGG - Intergenic
1119882724 14:78113827-78113849 CTAAAGAAGTAAAACAAGGAGGG - Intergenic
1120060323 14:79975209-79975231 TCTAATAAGTCAAAGGAGGAAGG - Intergenic
1120242976 14:81971611-81971633 AAGAAGAAGAAAAAGAAGGAAGG - Intergenic
1120254613 14:82103289-82103311 TTGAATAGGGCAAAGAAGGATGG + Intergenic
1120360315 14:83493101-83493123 TTGTATACGTAAAACAAGAAAGG + Intergenic
1120499171 14:85272696-85272718 TTGAATAAATAAATGAACAATGG + Intergenic
1121023468 14:90597293-90597315 TTGAATTAGTATTGGAAGGAGGG + Intronic
1121046140 14:90789424-90789446 TTAAAAAAGGAAAAGAAGGCAGG + Intronic
1121399979 14:93667110-93667132 TTGAAAAAAAGAAAGAAGGAAGG + Intronic
1121882627 14:97514469-97514491 GTTAACAAGTAAATGAAGGAAGG - Intergenic
1121918327 14:97856528-97856550 TTGAAAAAGGAAATGAAGGCTGG + Intergenic
1121927145 14:97938126-97938148 TTGAATAACTAGAAGTAGGAAGG + Intronic
1121956618 14:98219290-98219312 TTGAATAAATGAAGGAATGATGG + Intergenic
1122164339 14:99810294-99810316 TTGAACAAAGAAATGAAGGAAGG - Intronic
1122570170 14:102692748-102692770 AAGAAAAAGAAAAAGAAGGAAGG - Intronic
1122995068 14:105258816-105258838 TTAAATAAGAAAAAGAATAAAGG + Intronic
1124389032 15:29236870-29236892 TGAAATAAAAAAAAGAAGGAAGG + Intronic
1124419101 15:29503601-29503623 CTCAATAATTAAAAGAAGTAAGG + Intronic
1124643450 15:31415930-31415952 TTGAACAAGAAAAAAAAAGAGGG + Intronic
1124902862 15:33840590-33840612 TTGAGTAAGTTATAGAAGGGAGG + Intronic
1125079003 15:35654958-35654980 TTGAATGATGAAAAGAATGAGGG + Intergenic
1125182500 15:36893745-36893767 CTGCATTAGTAAAGGAAGGAAGG + Intronic
1125196441 15:37052698-37052720 TCGAATAAGTGAAAGAAGGAAGG - Intronic
1125398352 15:39273839-39273861 TTGAAAAAGAAAAAGAAAAATGG - Intergenic
1125406690 15:39359619-39359641 TCAAATAAGTAAAAGAGGGAAGG - Intergenic
1125634273 15:41174157-41174179 TTAAAAAAGTAAAGGAAGGCTGG + Intergenic
1126118916 15:45233696-45233718 TTGAAGAAATCAAAGAATGAAGG - Intergenic
1126347708 15:47714689-47714711 TTAAATGAGTAAAAGAAGGAAGG - Intronic
1126370542 15:47941246-47941268 TGGAAGAAGGAAAGGAAGGAAGG + Intergenic
1126612563 15:50544426-50544448 TAGAGTAAGTAAAAGTGGGAAGG - Intronic
1126765115 15:52003808-52003830 TTGAATGAGTAAAATAGGGATGG + Intronic
1126878821 15:53072579-53072601 CTGAATAATTGAATGAAGGAAGG - Intergenic
1127203640 15:56687993-56688015 TTATATAAGGAAAAGAAGGAAGG - Intronic
1127302936 15:57675332-57675354 TTGAATGAATGAAGGAAGGAAGG - Intronic
1127322554 15:57861746-57861768 TTTAAAAAGGAAAGGAAGGAAGG + Intergenic
1127360725 15:58242802-58242824 TTTAATACCAAAAAGAAGGAAGG - Intronic
1128071730 15:64801507-64801529 TTAAAAAAGTAAAAAAAGGTCGG - Intergenic
1128782764 15:70373894-70373916 TTAAAAAAGCAAAAGAAGAAAGG + Intergenic
1129003321 15:72351940-72351962 ATAAATAAGTGAAGGAAGGAAGG - Intronic
1129359413 15:75015242-75015264 CTGAATAAACAAAGGAAGGAGGG - Intronic
1129496565 15:75987881-75987903 TTCAATAATCAAAAGCAGGAAGG + Intronic
1129592053 15:76924780-76924802 TTGAAGAAGAAAAAGAATGTGGG - Intergenic
1129860290 15:78855306-78855328 GTGAGTAAGTACAAGAAGAAAGG - Intronic
1129915165 15:79263515-79263537 TTGACTAAGTGAAAAAAGCATGG + Intergenic
1130071939 15:80654842-80654864 TTTAATGTGGAAAAGAAGGAGGG - Intergenic
1130238054 15:82156772-82156794 TTTAAAAACAAAAAGAAGGAAGG + Intronic
1130414394 15:83677986-83678008 TTTAATAAGATAAAGCAGGAAGG - Intronic
1130897865 15:88184638-88184660 CTGAATAGGAAAAAGAAAGAAGG - Intronic
1131105652 15:89732468-89732490 TTCAATAAGTAAAATAAAGGAGG - Intronic
1131663391 15:94543066-94543088 GTGAAGAAGTGAAGGAAGGAAGG + Intergenic
1131744725 15:95434853-95434875 AGGAAGAAGAAAAAGAAGGAAGG - Intergenic
1131913149 15:97231469-97231491 ATGAAGAAATAAAAGAAGAAAGG + Intergenic
1132134489 15:99321899-99321921 TTAAATAAGTAAATGCAGGGAGG + Intronic
1133093343 16:3422889-3422911 TTGAATGAGGAAAAGCAGGATGG - Intronic
1133263594 16:4569266-4569288 TAGAATAACTAAGATAAGGAAGG - Intronic
1133389301 16:5396337-5396359 CTGAATAGATGAAAGAAGGAGGG + Intergenic
1133590854 16:7241763-7241785 TTGAAAGAGAAAAAGAAGGGGGG - Intronic
1133797778 16:9060175-9060197 TTAAATATGGAGAAGAAGGAAGG + Intergenic
1134324525 16:13194853-13194875 TTGAACAAGTAACAAATGGATGG + Intronic
1134841854 16:17407888-17407910 TTGCAGAACTAATAGAAGGAGGG - Intronic
1136085685 16:27883244-27883266 GTAAATAAATAAAAGATGGAGGG + Intronic
1136524420 16:30819646-30819668 TTGAATAAGAATAATAAGAATGG + Intergenic
1136926448 16:34379737-34379759 TTTGATAAGTAGAAGGAGGAGGG - Intergenic
1136978126 16:35032070-35032092 TTTGATAAGTAGAAGGAGGAGGG + Intergenic
1137948892 16:52762937-52762959 TTGAAGAAAAAAAAGAATGATGG - Intergenic
1138029205 16:53546432-53546454 CTGAATAAGTAATTGTAGGATGG - Intergenic
1138318345 16:56089681-56089703 AAGAATAAGTAAAGGAATGAAGG + Intergenic
1138494502 16:57399432-57399454 ATAAATAAGTAAAAAAAAGAAGG - Intergenic
1138644753 16:58416441-58416463 CTAAATAAGTAAAAGAAGTCAGG - Intergenic
1139012548 16:62649952-62649974 TTTATTGAGTAACAGAAGGAAGG - Intergenic
1139026680 16:62826516-62826538 TTTAATAAGTTATAGAAGGTGGG - Intergenic
1139074468 16:63427268-63427290 GTGAATAAATAAATGAAGGGAGG + Intergenic
1139712739 16:68789014-68789036 ATGAATAAATAAAAGAAAGTTGG + Intronic
1140482617 16:75270035-75270057 TTGAATAAATAAATAAATGAGGG - Intergenic
1140611443 16:76604022-76604044 ATGATTAAGTAAAAAAAGGAAGG + Intronic
1140779234 16:78279123-78279145 TTGAATAAGTAGAAAAACCATGG + Intronic
1140861254 16:79020151-79020173 TTGAAACAGTCAAAGGAGGAAGG + Intronic
1140905875 16:79408639-79408661 GTGAAAAAAGAAAAGAAGGATGG - Intergenic
1140919246 16:79521566-79521588 TTGACTATGTAGAAGAAGGAGGG - Intergenic
1141260534 16:82449520-82449542 TTGAATAAACAAATGAATGAAGG + Intergenic
1141581860 16:85004713-85004735 GTGAATAAGTAAGGGAAGGAGGG + Intronic
1141803878 16:86329820-86329842 ATGAAGAAGGGAAAGAAGGAAGG - Intergenic
1143082080 17:4389199-4389221 TTGAATGGGCAAAAGAAGGCGGG + Intergenic
1144188296 17:12817410-12817432 ATTAAGAAGTAAAAGAAGAATGG + Intronic
1144741624 17:17586176-17586198 AAGAAAAAGAAAAAGAAGGAAGG + Intronic
1145099417 17:20061739-20061761 TTGAATAAATGAAAGAAAAATGG - Intronic
1145764671 17:27450174-27450196 TTGAATAAACAAATGAGGGAGGG - Intergenic
1145828559 17:27896680-27896702 GAGAATAAGTAAAAGTAGAAGGG + Intergenic
1146674501 17:34764047-34764069 ATGAATGAGTAAAAGCAGCAGGG + Intergenic
1146921335 17:36714574-36714596 GTGAATAAATAAAAGAGGGCCGG - Intergenic
1147142590 17:38467737-38467759 ATGAATGAACAAAAGAAGGAGGG - Intronic
1148255310 17:46126096-46126118 TTGAAAAAGTAAAAGTCGGCCGG + Intronic
1148710857 17:49679579-49679601 ATAAATAAATAAAGGAAGGAAGG + Intergenic
1148764004 17:50027080-50027102 TTGAATAAATAAATGATGGATGG - Intergenic
1148832930 17:50447237-50447259 TTGTATGATTAAAATAAGGATGG + Intronic
1149046241 17:52248968-52248990 TTGAAAAAGTAAAATAATGGGGG + Intergenic
1149131812 17:53311285-53311307 ATAAATAAATAAAAGAAAGATGG + Intergenic
1149499689 17:57142831-57142853 TTGAATAAATAAATGAAGCTGGG - Intergenic
1149520106 17:57312331-57312353 TTGAAAAAGAAAAATTAGGAAGG - Intronic
1149913093 17:60584148-60584170 TAGAAAAAGTAAAAGAGAGAGGG - Intronic
1150631377 17:66882726-66882748 TTGAATAATTGATAGATGGATGG + Intronic
1150985060 17:70186522-70186544 TTGTATAAGTAAAATATGAAAGG + Intergenic
1151017450 17:70573051-70573073 CTGAATCAGTAAATGAATGAAGG - Intergenic
1151024944 17:70667453-70667475 ATGCATAAGTTAAATAAGGAAGG - Intergenic
1151379845 17:73718137-73718159 GTGAAAAAGTAAAAGCAAGATGG - Intergenic
1151754778 17:76067777-76067799 TTGAACAACTAAAACATGGAGGG + Intronic
1151764131 17:76123366-76123388 CTGAAAAAGAAAAAGAAGGAAGG - Intergenic
1152673083 17:81620666-81620688 TTTAATAATTAAAAAGAGGAGGG + Intronic
1153182523 18:2451086-2451108 GGGAAGAAGAAAAAGAAGGAAGG + Intergenic
1153195045 18:2585755-2585777 TTAACTAAGTAAAAAATGGAAGG + Intronic
1153581369 18:6577305-6577327 TTGAATAAGTTAAAGCAGAGGGG + Intronic
1153697510 18:7659358-7659380 TTGAATAAGTGAATGAATGGTGG + Intronic
1154050607 18:10952918-10952940 TAGAATGAAAAAAAGAAGGAAGG - Intronic
1154279338 18:12989007-12989029 TTCAATAGGTAAAAGAGGGCCGG + Intergenic
1154969315 18:21391620-21391642 TTTAATATGTAAATGAAAGAAGG - Intronic
1155218745 18:23665693-23665715 TTGAATTAGTAAAAGAGTCAGGG + Intergenic
1155821402 18:30382469-30382491 TTTTATACGTAATAGAAGGAAGG + Intergenic
1156566937 18:38202320-38202342 TTGCATAACTTAGAGAAGGAAGG - Intergenic
1156713920 18:39983018-39983040 TGGAAGAAGGAAGAGAAGGAGGG + Intergenic
1156753741 18:40494699-40494721 AAGAAAAAGAAAAAGAAGGAAGG + Intergenic
1157386898 18:47264944-47264966 TTGAAAAAGAAATAAAAGGAAGG - Intergenic
1157600513 18:48890336-48890358 ATGAATAAGTAAACCAATGAAGG + Intergenic
1157635852 18:49153688-49153710 TTGAATAAGTAAATACACGAGGG + Intronic
1157829741 18:50846273-50846295 GAGAAAAAGAAAAAGAAGGAAGG - Intergenic
1158397908 18:57094275-57094297 TAAAATCAGTAAAAGAGGGAAGG + Intergenic
1158537440 18:58320835-58320857 TTTAATAAATGAAAAAAGGAAGG + Intronic
1158971750 18:62674602-62674624 CTGAAGAACTAAAAGCAGGAAGG - Intergenic
1158979665 18:62747522-62747544 TTGAAGAAGGAAGCGAAGGAAGG - Intronic
1159193647 18:65083219-65083241 TTGAAAAGGTAAAAGAGAGAGGG - Intergenic
1159743002 18:72196504-72196526 CTGAATAAGGAAAAGGGGGAGGG + Intergenic
1159925424 18:74264760-74264782 TTTAATATGTGAAACAAGGATGG + Intronic
1160264594 18:77329314-77329336 TTGAGAAAGAAAAAGAAAGATGG + Intergenic
1160284818 18:77532128-77532150 ATAAATAAATAAAAGAAGAAGGG - Intergenic
1161462280 19:4405083-4405105 TGGAATGAGTAAAAGTAGGGAGG - Intronic
1161934599 19:7363919-7363941 ATGGATAAATAAAAGAATGAAGG + Intronic
1161937746 19:7382612-7382634 GTGAATAAGTAAGACAGGGAAGG + Intronic
1162131358 19:8527921-8527943 TTATATAAGAAACAGAAGGAGGG + Intronic
1162274567 19:9642576-9642598 TTAAATATGTAAAAGAATAAAGG - Intronic
1163060477 19:14757427-14757449 TTGAAGAAGAACAAGAAGGTTGG + Intronic
1163222214 19:15929768-15929790 TTGAATAGGTAAACTGAGGAAGG + Intronic
1163587703 19:18173065-18173087 TTGAACGATGAAAAGAAGGAAGG + Intronic
1163912233 19:20206520-20206542 TTGAAGAAGTAGAATCAGGAAGG + Intergenic
1164345978 19:27257604-27257626 CTAAATAATTAAAAGAAGTAAGG + Intergenic
1164434304 19:28215930-28215952 ATGAATGAGTAAAGGAAGGCAGG + Intergenic
1164775473 19:30850222-30850244 TATAAAAAGGAAAAGAAGGAGGG + Intergenic
1164936513 19:32219090-32219112 ATGAATGAATAAATGAAGGAAGG + Intergenic
1165398492 19:35581916-35581938 TTGAAAAAGTAAAATAAAGTTGG + Intergenic
1166965086 19:46524985-46525007 CAGAAAAAGAAAAAGAAGGAAGG - Intronic
1167062983 19:47162692-47162714 TTTAAGAAGTAAAATAAGGCTGG + Intronic
1167067453 19:47197208-47197230 GGGAATAAGAAAAAGAAGGCAGG - Intronic
1167281911 19:48574279-48574301 TTGAATGAGTGTAGGAAGGAAGG - Intronic
1168080661 19:54007925-54007947 TTGAATTAGGAAAGGAATGAAGG + Intronic
1168223569 19:54978539-54978561 TTAAATAATTTAAAGAAGGCCGG - Intronic
1168326985 19:55543486-55543508 TGGAAGGAATAAAAGAAGGAAGG - Intronic
1168476349 19:56678237-56678259 CTGATTAAGTAAATGAAGCATGG - Intergenic
925441034 2:3885466-3885488 ATGAAGAAGTGAAAGGAGGAAGG - Intergenic
925915818 2:8604986-8605008 TTTAATAAGTAGAAGGAGGCAGG - Intergenic
926001082 2:9333231-9333253 ATGAATAACTTAATGAAGGATGG - Intronic
926270120 2:11359246-11359268 TTTCATAAGTAAAGAAAGGAGGG - Intergenic
926623864 2:15073180-15073202 TTTAAGAAGTAAAATAAGGATGG + Intergenic
926828785 2:16937170-16937192 AAGAAGAAGAAAAAGAAGGAAGG + Intergenic
926942426 2:18152446-18152468 TAGGAAAATTAAAAGAAGGAAGG - Intronic
926975055 2:18506447-18506469 TTGAATAAGGAAGAAAGGGAGGG - Intergenic
927017347 2:18978980-18979002 ATAAATAAATAAAAGGAGGAGGG - Intergenic
927408026 2:22794593-22794615 TTGAATGAGTAAATAAATGAAGG - Intergenic
927599479 2:24428116-24428138 TGGAAAAATTAAAAGCAGGATGG - Intergenic
927686431 2:25174529-25174551 AGGAATAAATGAAAGAAGGAAGG + Intergenic
927804677 2:26136258-26136280 TTAAAAAAGGAAAAGCAGGAAGG + Exonic
928745477 2:34408765-34408787 TTGACTAAATAAAAGCAGAATGG - Intergenic
928859384 2:35838324-35838346 ATGAATAAGTAGAAGAATAAAGG - Intergenic
929891786 2:45924368-45924390 TTGAATAGGAAAATGAAGGATGG + Intronic
929899672 2:45989628-45989650 TTAAACAAGGAAAGGAAGGAAGG - Intronic
930242807 2:48953758-48953780 TAATATAAGTAAATGAAGGAGGG - Intergenic
930445013 2:51459219-51459241 TTGAATAATTTCAAAAAGGATGG + Intergenic
930684086 2:54289215-54289237 GTGACAAAGTAGAAGAAGGAAGG - Intronic
930756487 2:54978902-54978924 TTGAAAAAGTAAAAAAAGAATGG + Intronic
931064161 2:58565708-58565730 ATAAATAAGTAAAAAAAGGAAGG - Intergenic
931080707 2:58766903-58766925 TTAGAAAAGAAAAAGAAGGAGGG - Intergenic
931175208 2:59847508-59847530 TGGAATAAATAAATGAAAGATGG + Intergenic
931479629 2:62628005-62628027 TTGAATAAGAAAAACAAAGTTGG - Intergenic
931642079 2:64390698-64390720 TAGTATTAGAAAAAGAAGGAAGG - Intergenic
932281495 2:70496718-70496740 TTGAGTGAGTAAATGAATGAAGG - Intronic
932559450 2:72854612-72854634 TTGAATAAGTAAATGGGGGGTGG - Intergenic
932609086 2:73185411-73185433 TTGAAGAAGCCAAGGAAGGAAGG - Intergenic
932724957 2:74171369-74171391 TTTGATAAGTTAAAGGAGGATGG + Intronic
933215188 2:79621594-79621616 TTGAATAAATAAATAAATGAGGG + Intronic
933376218 2:81482537-81482559 TTGAATAAATAAAATAGAGAAGG - Intergenic
933409279 2:81904523-81904545 TTGAATAAATAATAGATGGAAGG + Intergenic
933444595 2:82363694-82363716 TTGAATGAAGAAAAGAAGAAAGG - Intergenic
934155017 2:89190828-89190850 TTGAATAAATAAAATGAGGTAGG - Intergenic
934212298 2:89991896-89991918 TTGAATAAATAAAATGAGGTAGG + Intergenic
934928579 2:98400435-98400457 TTGAATAAATAAATTAATGAGGG + Intergenic
935001694 2:99023835-99023857 TTGAAAAAGAAAAAGAAAGTTGG - Intronic
935081311 2:99798432-99798454 TTGGATAAATAAAAACAGGATGG - Intronic
935295783 2:101648116-101648138 TAGAATTAGGAAAATAAGGATGG - Intergenic
935482312 2:103606862-103606884 TAGAATGAGTATAAAAAGGAAGG + Intergenic
936368981 2:111886862-111886884 TTGCAAAAGCAAATGAAGGAGGG + Intergenic
936958855 2:118051801-118051823 TGGAAAAAGGAAAACAAGGAAGG - Intergenic
937179371 2:119976426-119976448 TTTATTAAGTAAAAAAAGCAAGG - Intronic
938161197 2:128986121-128986143 TTAAATGAGTGAAGGAAGGAAGG + Intergenic
938237149 2:129715138-129715160 TTGAAAAAGAAAAAAAAGCAAGG + Intergenic
938275190 2:130014314-130014336 ATGAAGGAGTGAAAGAAGGAAGG - Intergenic
938326149 2:130405038-130405060 ATGAAGGAGTGAAAGAAGGAAGG - Intergenic
938363790 2:130716421-130716443 ATGAAGGAGTGAAAGAAGGAAGG + Intergenic
938440173 2:131322966-131322988 ATGAAGGAGTGAAAGAAGGAAGG + Intronic
938637216 2:133241702-133241724 TGGGATATGTGAAAGAAGGAGGG - Intronic
939007593 2:136807286-136807308 TTGAATAAATAAATAAATGAAGG - Intronic
939062122 2:137435012-137435034 TTAAAAAAGAAAAAGAAAGATGG - Intronic
939203890 2:139074785-139074807 ATGAAAAAGAAAAAGAAGCAGGG - Intergenic
939204188 2:139078794-139078816 ATGAAAAAGCAAAAGAAGGAGGG - Intergenic
939384100 2:141474131-141474153 TGGAAAAAGGAAAAGAAGAAAGG - Intronic
939674609 2:145056392-145056414 TAGAATAAGTAATATAAGGCCGG + Intergenic
939905813 2:147912960-147912982 TTGAATAAATTATAGTAGGAGGG + Intronic
940139177 2:150474550-150474572 TTGAGTCACTGAAAGAAGGAAGG + Intronic
940492004 2:154374514-154374536 TTGAGTAAGGAAAAAAAGGATGG + Intronic
940633356 2:156266080-156266102 TTGAGTGAGTAAATGAATGAAGG + Intergenic
940813280 2:158269753-158269775 TTGAAAGAGTCAAACAAGGAAGG - Intronic
940888191 2:159009067-159009089 TTGAATAACTAAGAGCAGGTTGG + Intronic
941118335 2:161498169-161498191 TTGAAAAAGAAAAAGAAAGTTGG - Intronic
941253807 2:163201740-163201762 ATGAATGAGAAAAAGAATGAGGG - Intergenic
941293080 2:163700372-163700394 TTGAAGAAGAGAAAGAAGGAAGG + Intronic
941594066 2:167453783-167453805 TCAAATATGTAAAAGGAGGAAGG + Intergenic
941699127 2:168585263-168585285 ATGAATGAGTGAAGGAAGGAGGG - Intronic
941825047 2:169885857-169885879 GTGAATAGGTAAAAGAAAAAAGG + Intronic
942169224 2:173273615-173273637 ATGACTAAATTAAAGAAGGAAGG + Intergenic
942308700 2:174633919-174633941 TTGTGTTAGTAAAAGAAGGAAGG + Intronic
942360007 2:175162835-175162857 TTTAATAAATAAAAGCAGGCTGG + Intronic
942462966 2:176182021-176182043 TTGAAAAAATAAAAGAAGTCGGG + Intergenic
942485056 2:176430148-176430170 ATGAATAAATAAAATAAAGATGG + Intergenic
942601844 2:177648607-177648629 TTGAAAAAGAATAATAAGGAAGG + Intronic
942775328 2:179574865-179574887 TTTAAGAAGTTCAAGAAGGAAGG - Intronic
943305321 2:186254600-186254622 TTGAATATTTAGAAGAAGCAGGG - Intergenic
943588615 2:189769711-189769733 TTTAATAAGTAAATAAAGAAGGG + Intergenic
943989826 2:194673825-194673847 TTGAATTATGAAGAGAAGGATGG + Intergenic
944130504 2:196342490-196342512 TGGAATATATAGAAGAAGGAAGG - Intronic
944186825 2:196958172-196958194 TTGGCTAAGGAGAAGAAGGAAGG - Intergenic
944914102 2:204340181-204340203 TTGAAAACTTAAAAGAATGAAGG + Intergenic
945261863 2:207851184-207851206 TTGATTGAGAATAAGAAGGAAGG - Intronic
945619900 2:212122576-212122598 TGGAAAAAGTAAGATAAGGAGGG - Intronic
945882146 2:215336527-215336549 TTCAAAAGGTAACAGAAGGATGG - Intronic
945925768 2:215802438-215802460 TTGAAAAAGACAAAGTAGGAGGG + Intergenic
946781873 2:223199810-223199832 TAGAATAAATGAAGGAAGGAAGG + Intergenic
947359487 2:229333086-229333108 TAGAAAAAGAAAAGGAAGGAAGG + Intergenic
947678775 2:232010519-232010541 TTGATTAAGAAAAAAAAAGAGGG - Intronic
948361135 2:237421525-237421547 TTGAGTAAGTGAAGGAATGAAGG - Exonic
948361674 2:237425900-237425922 TTGAATGAGTTAAAGAATGATGG - Intergenic
948488314 2:238295350-238295372 GAGAAGAAGTAGAAGAAGGAGGG - Intergenic
948582642 2:238998299-238998321 ATAAATAAATAAATGAAGGAAGG - Intergenic
1169008044 20:2225335-2225357 TTGAATAAATGAATGAAGAATGG + Intergenic
1169668924 20:8072711-8072733 TTTTAAAAGTAGAAGAAGGAGGG + Intergenic
1170129644 20:13005342-13005364 ATGGATAAGTAAAACCAGGAAGG + Intergenic
1170305748 20:14935946-14935968 TGGAAAAAAGAAAAGAAGGAAGG - Intronic
1170372008 20:15659446-15659468 TTGAAGAACTAAAAGAAGGTGGG - Intronic
1170397590 20:15944288-15944310 AAAAATAAGCAAAAGAAGGAAGG + Intronic
1170551423 20:17480680-17480702 TTGGAGATGTAAAATAAGGAAGG + Intronic
1170594878 20:17797719-17797741 TTAAATAAGAAACAGATGGATGG - Intergenic
1170726372 20:18931040-18931062 TTGAACTAGAAAGAGAAGGATGG + Intergenic
1171133844 20:22678790-22678812 TTGAATAAGCAAAAGCCTGATGG - Intergenic
1171312138 20:24153084-24153106 TTTAAGAAATAAAAGAAGGGGGG - Intergenic
1171890919 20:30714192-30714214 TTGGAAAATTCAAAGAAGGAAGG + Intergenic
1172042110 20:32052811-32052833 TTAAAAAAGAAAAAGAAGGAAGG + Intronic
1172498939 20:35411301-35411323 TTGAATAAATGAATGAAGTAAGG - Intronic
1172582575 20:36059997-36060019 TTAAATAAATAAATGAGGGAGGG + Intergenic
1172670938 20:36633986-36634008 TCAAAAAAATAAAAGAAGGAAGG - Intronic
1172873668 20:38151169-38151191 TTTTCTAATTAAAAGAAGGATGG - Intronic
1173049700 20:39547306-39547328 TTGTGTAAGTAAAAGAAGGGGGG - Intergenic
1173202928 20:40967252-40967274 TGGAATAAGTAAAATAATAAAGG + Intergenic
1173305908 20:41849241-41849263 TTGATTAAGAAAAAGAAATAAGG - Intergenic
1173500109 20:43547076-43547098 TTAAAAAAGGAAAAAAAGGATGG - Intronic
1173613499 20:44387913-44387935 TTGAATAATTGAGAGAAGGTGGG + Intronic
1173714056 20:45186626-45186648 TTGAGTAAGTAAATAAATGAGGG - Intergenic
1173791382 20:45829905-45829927 TTGAATAAACAAAAGAACAAAGG - Intronic
1174267395 20:49341519-49341541 TTGAGTAAAGAAAAGAAGGCTGG - Intergenic
1174619224 20:51861507-51861529 GTGAATAAATGATAGAAGGAAGG - Intergenic
1174868501 20:54161671-54161693 TTGAAAAAATAAAAGAATAATGG + Intronic
1174874905 20:54216964-54216986 TAGAATGAGTAAAAAAAGAAAGG - Intronic
1174899958 20:54488809-54488831 TTTAATAATAAAAGGAAGGAAGG - Intronic
1175076490 20:56379280-56379302 TTGAATAAGTAAAAGGATGGTGG + Intronic
1175852429 20:62100713-62100735 TTGAATGAGTGAAGGAAGGCCGG - Intergenic
1177362996 21:20098648-20098670 TTGGAAAAATAAAAGAATGATGG - Intergenic
1177410434 21:20723114-20723136 ATAAATAAGTAAAAAAAGGAGGG - Intergenic
1178024836 21:28454347-28454369 TTTAATAAATAAAAGACAGATGG - Intergenic
1179424601 21:41265168-41265190 TTGAAAAAAAAAAAAAAGGAAGG - Intronic
1180023187 21:45142226-45142248 TTGAAAAACAAAAAGAAGGCAGG - Intronic
1181525936 22:23487308-23487330 TTGAAAAAGAAAAAAAAGAATGG - Intergenic
1181716985 22:24738158-24738180 AAGAAAAAGAAAAAGAAGGAAGG + Intronic
1181737494 22:24893200-24893222 ATGAATGAATAAAGGAAGGAGGG + Intronic
1182190955 22:28460160-28460182 TTGAATAAGCAAAAGAAGCCAGG + Intronic
1182408960 22:30165346-30165368 TTGAATAAGAAAAACAAAGTTGG - Intronic
1182739599 22:32558135-32558157 TTGAATGAAAAAAAGAAAGAAGG + Intronic
1182931394 22:34177503-34177525 TAGATTAAGTAAATGAAGGAGGG - Intergenic
1183009832 22:34935740-34935762 TTCAAGAACTAAAAGAAGGTTGG - Intergenic
949153278 3:796814-796836 TTGAAATAGAAAAAAAAGGATGG + Intergenic
949250291 3:1975556-1975578 TAAAAGAAGTAAAAGAAAGAGGG + Intergenic
949634670 3:5969525-5969547 ATAAATAAATAAAGGAAGGAAGG + Intergenic
950243047 3:11388728-11388750 ATGAATAAAAAAAAGAAAGAAGG - Intronic
950907358 3:16551533-16551555 GTGAGGAAGGAAAAGAAGGAAGG + Intergenic
950985806 3:17365043-17365065 GTGAATAATTTAAAGAGGGAAGG - Intronic
951048076 3:18063444-18063466 TTGAATAAATGAATGAATGATGG - Intronic
951240844 3:20284478-20284500 ATGAATAAATAGAAGACGGATGG - Intergenic
951362574 3:21742068-21742090 GTGAATTAGTAAAAGAAGTGGGG - Intronic
951504422 3:23427118-23427140 TTCAAAAAGTTAAAGAAGTATGG + Intronic
951517370 3:23576008-23576030 TTAAATAAATAAAATATGGAAGG + Intronic
951700994 3:25496661-25496683 TTGAATAGGTATAACATGGAAGG + Intronic
952044279 3:29299164-29299186 TTGCTTAAGTAACAGCAGGAAGG + Intronic
952734531 3:36675665-36675687 TCAAGTAAGTAAAAGCAGGAAGG - Intergenic
952900070 3:38105920-38105942 TTTAAAAAGTAAAAGAAACATGG - Intronic
953040253 3:39249982-39250004 TTGAATTAGAAATAGAAGGGAGG + Intergenic
953156827 3:40383168-40383190 TTGAAAAACTGAAAGAAGGCTGG + Intergenic
953429229 3:42823425-42823447 TTGAATAAATTATAGAATGAAGG - Intronic
953459594 3:43072014-43072036 GTGAATGAATATAAGAAGGAAGG - Intergenic
953503060 3:43456667-43456689 TTAAATAAGTGAAAGGTGGAAGG + Intronic
953540500 3:43813669-43813691 TTGAATGAGTGAATGAAAGAAGG - Intergenic
953735459 3:45490433-45490455 TTCAATAAGTAGAAGGAGAATGG + Intronic
953771029 3:45778856-45778878 TTGAACCAGGGAAAGAAGGAGGG + Intronic
954477599 3:50762890-50762912 TTAAAAAAATAAAAAAAGGAAGG - Intronic
955035970 3:55268271-55268293 TTGAAAAAAAAAAAAAAGGATGG - Intergenic
955326879 3:58015458-58015480 TTGAATGAGGAAAGGAAGAAAGG - Intronic
955731873 3:61995763-61995785 AAGAAAAAGAAAAAGAAGGAGGG - Intronic
956033933 3:65069787-65069809 TTGAAAAGGTAAAGGAAGAATGG + Intergenic
956357338 3:68408633-68408655 CTGAATAATGAAAGGAAGGAAGG - Intronic
956955581 3:74335361-74335383 TAGAATAGGTACAAAAAGGAGGG + Intronic
957016821 3:75074890-75074912 TTGAATCAGTAAGAGAAGTTGGG + Intergenic
957216212 3:77323224-77323246 TTGAGTATGTAAAGGTAGGAGGG - Intronic
957832486 3:85540966-85540988 TTAAATAAGTAAAAAAAGAAAGG - Intronic
957911854 3:86629198-86629220 TTTAAGAAGAAAAAGAAGGAAGG - Intergenic
958111983 3:89159940-89159962 AGGAAGAAGGAAAAGAAGGAAGG - Intronic
958139178 3:89539335-89539357 TTAAAGAAGTAAAAGAAAAATGG - Intergenic
958786284 3:98599721-98599743 TACAATAAGAAAAAGAAGGGAGG - Intergenic
958868716 3:99532173-99532195 CTGAAAGAGTAAATGAAGGAAGG + Intergenic
959304745 3:104647682-104647704 ATGAATTAGTAAAACAAGTATGG - Intergenic
959364404 3:105438870-105438892 TAAAATAAATAAATGAAGGAAGG + Intronic
959411303 3:106025951-106025973 ATGAAAAAGAAAGAGAAGGAAGG + Intergenic
960325621 3:116292121-116292143 TGAAATAAATAAAAGAAGTAGGG - Intronic
960438395 3:117655998-117656020 TTTAGTAAGTAAAAGATGTAGGG + Intergenic
961070993 3:123926701-123926723 TTGGAGAAGGAAAAGAAAGAGGG + Intronic
961697007 3:128712381-128712403 CTGAATAAATAAATGAAAGATGG + Intergenic
961766495 3:129215646-129215668 TTGAAAAAGTTAAAATAGGACGG + Intergenic
961885420 3:130093742-130093764 TTGAAAAATTAAAAGAAGCTTGG - Intronic
962107131 3:132402039-132402061 TTAAATAAATAAATAAAGGATGG + Intergenic
962375660 3:134856909-134856931 GTAAAAAAGGAAAAGAAGGAAGG + Intronic
962736977 3:138334097-138334119 TTGAAAAAGAAAAACAAGGTTGG - Intergenic
962980654 3:140486324-140486346 TTAAAGAAATGAAAGAAGGAAGG - Intronic
963201479 3:142590781-142590803 AAAAATAAGTAAAAGAAGGCTGG - Intergenic
963431286 3:145207685-145207707 ATGAAAAAGAAAAAGAAGGAGGG + Intergenic
963672122 3:148264440-148264462 TTAAATAAATTATAGAAGGAAGG - Intergenic
963990063 3:151642714-151642736 TTGAATAAGTACATGGAGGTTGG - Intergenic
964330983 3:155602417-155602439 TTAAATCAGTAAGAGTAGGAAGG + Intronic
965164082 3:165172468-165172490 TTAAATAAATAAAAGATGTAAGG + Intergenic
965350097 3:167600583-167600605 TTGAAAATGTAAAATAGGGATGG - Intronic
965552349 3:169980171-169980193 TTGAATAAGGAAGAGAGAGATGG + Intronic
965582009 3:170278658-170278680 ATAAATAAATAAATGAAGGAAGG + Intronic
965738100 3:171843568-171843590 TTGAGAAAATAAAAGAAGGTGGG + Intronic
965762191 3:172091104-172091126 GGAAATAAGTAAAACAAGGACGG + Intronic
965888287 3:173476960-173476982 CTGATTAAGATAAAGAAGGAAGG + Intronic
965898451 3:173608754-173608776 TTGAATGTGTTAAAGAAAGAAGG - Intronic
966058882 3:175731832-175731854 TTAAAAAAGAAAAAGGAGGAGGG - Intronic
966213602 3:177478207-177478229 TTGAATAATTAATATAAGTATGG - Intergenic
966334785 3:178856044-178856066 TTTATTAAGTAAAAGAAGCAAGG + Intergenic
966444761 3:179989362-179989384 TTGAATATGTAAACTAAGCATGG - Intronic
966544455 3:181129657-181129679 ATGAAAAAGTAAAAAAAGAAGGG + Intergenic
966549846 3:181193040-181193062 ATGAATATGTAAAAGAAGGTAGG + Intergenic
967370471 3:188739261-188739283 TGGAAAAAGAAAAGGAAGGAAGG + Intronic
967403811 3:189094377-189094399 TGGAATGAGGAAGAGAAGGAGGG - Intronic
967532302 3:190562812-190562834 TTGAATAAATGAAAGACTGATGG + Intronic
967574081 3:191069786-191069808 CTGAAGAAGAAAAAGAAGAATGG + Intergenic
967617600 3:191590861-191590883 TTGCAATTGTAAAAGAAGGATGG - Intergenic
968017066 3:195346043-195346065 TTCAATTAGTAAAAGAATGGAGG - Intronic
968804880 4:2765971-2765993 TTGAGGAAGTAAAAGAATTACGG - Intergenic
969255909 4:6001663-6001685 TTTATTAAGTAAAAGGAGGAAGG - Intergenic
969513715 4:7634563-7634585 TTGAATGAGTAAACAATGGAGGG + Intronic
969545341 4:7822892-7822914 TTGAAAAAAAAAAAGAAAGAGGG - Intronic
970263026 4:14249477-14249499 GTGAATAAATGAAAGAATGAAGG + Intergenic
970307510 4:14748904-14748926 GTGAATGAGTAAACGAATGAAGG - Intergenic
971345521 4:25808751-25808773 TTGAAAAAGAAAAAGAAAGCAGG - Intronic
971422310 4:26484893-26484915 TTTATTAAATAAAAGAAGGCCGG + Intronic
972164560 4:36266619-36266641 TTGAAGAATAAAAAGAGGGAAGG - Intergenic
972191098 4:36592135-36592157 TTGAATAAATAAAAGAACTGGGG + Intergenic
972221186 4:36957377-36957399 TTGAATAAATAAATAAATGAGGG - Intergenic
972696569 4:41452203-41452225 TTACATAAATAAAATAAGGAAGG - Intronic
972834514 4:42853512-42853534 TTTAATAAGTGAACAAAGGAGGG + Intergenic
973088970 4:46107541-46107563 AGCAATAAGAAAAAGAAGGAGGG - Intronic
973167212 4:47092532-47092554 ATGAATAAATAAAGGAAAGAAGG + Intronic
973243435 4:47983826-47983848 TTGAAGAAGAAAATGAAGGCTGG + Intronic
974035846 4:56817496-56817518 TTGACTAAGAAAAAAAAGGTTGG + Intronic
974152698 4:58029882-58029904 TTGCATAAATGAAAGAATGAGGG - Intergenic
974224387 4:59019524-59019546 TTACATAAGTATAAGAAGCAAGG - Intergenic
974277888 4:59749592-59749614 TGGAATATGTATAAGAATGATGG + Intergenic
974413189 4:61568481-61568503 TTGAAGCAGTAGAAGAAGAAAGG + Intronic
974484517 4:62489852-62489874 TTGAATACGAAAAAGAAAAAGGG - Intergenic
974595289 4:64006676-64006698 TTTACTAAGTAAAAAAAGCAAGG + Intergenic
974863894 4:67556573-67556595 TTGAAAAATGAAAAGAAGCAAGG - Intergenic
974991673 4:69099223-69099245 AGGAATAGGTAAAAGAATGACGG + Intronic
974999985 4:69212017-69212039 AGGAATAGGTAAAAGAATGAAGG - Intronic
975014192 4:69392147-69392169 AGGAATAGGTAAAAGAACGACGG + Intronic
975015449 4:69411533-69411555 AGGAATAGGTAAAAGAACGACGG + Intronic
975320064 4:73000054-73000076 TTAAATAAGTAATGGAAGCAGGG - Intergenic
975344573 4:73279462-73279484 TTGAACCAGTAAAAGCTGGAAGG - Intergenic
975503030 4:75108581-75108603 CTGAAAAAGCAAAAGAAGAAAGG + Intergenic
975797417 4:78022750-78022772 TTTAACATGTCAAAGAAGGAAGG - Intergenic
975992595 4:80273702-80273724 TTTAAAAAGGAAAAGAAGGAAGG - Intronic
976114108 4:81708555-81708577 TTGATAAAGGAAATGAAGGAAGG + Intronic
976147407 4:82055599-82055621 TTGAAGAAGTAAGACAAGGAAGG + Intergenic
976230186 4:82834569-82834591 CTGAATAAGTTAAAGGAGGGTGG + Intronic
976842744 4:89451001-89451023 TTGCATAAGATGAAGAAGGAAGG + Intergenic
977124318 4:93145345-93145367 TTGACTAGATAAATGAAGGAGGG + Intronic
977312977 4:95410384-95410406 GTGCATAAGTAAGAGAAGGCAGG - Intronic
977345001 4:95806725-95806747 TCGAATGAATAAAGGAAGGAAGG - Intergenic
977405612 4:96594150-96594172 TTGAGTAAGTTAAAGAAAAAAGG + Intergenic
977471596 4:97450267-97450289 CAGAATAAATAAAAGAAGGAGGG - Intronic
977532571 4:98217466-98217488 TAGAAAAAGTAAAACAAGGCTGG + Intergenic
977933754 4:102777493-102777515 TTAAAAAAAGAAAAGAAGGAAGG - Intergenic
978205451 4:106075009-106075031 GTGAATAAGGTAAAAAAGGATGG + Intronic
978278606 4:106982260-106982282 TTGAGTATGTGTAAGAAGGAAGG + Intronic
978300414 4:107263703-107263725 TTAAAAAAATGAAAGAAGGAAGG + Intronic
978878179 4:113667298-113667320 CTGAATAAATGAATGAAGGATGG + Intronic
978988246 4:115043794-115043816 TTGAATAAATGAAATAAAGAAGG + Intronic
979079561 4:116317792-116317814 TTAAAAAAGTAAAAGCTGGAGGG + Intergenic
979172881 4:117624091-117624113 TTGAATCAGTGAAAGAAGGATGG - Intergenic
979590629 4:122475681-122475703 TTGAACAAGAAAAAGATAGATGG - Intergenic
979665125 4:123302990-123303012 TTGAATAAATGAAAGAATAAGGG + Intronic
979823879 4:125208689-125208711 ATGAAGAAGTATAAGAAAGAGGG + Intergenic
979935515 4:126689813-126689835 TATAACAAGTAAAAGCAGGACGG + Intergenic
980097094 4:128502262-128502284 TTAAATAAGTAAAAGGATGATGG - Intergenic
980520593 4:133928105-133928127 TTGAATAGGTAAATGAAATATGG - Intergenic
980581492 4:134760008-134760030 TGGAATAAGTAAAGGAATAAAGG - Intergenic
980639074 4:135550654-135550676 CTGAATAAATAAAGGTAGGATGG - Intergenic
980838271 4:138224785-138224807 AGGAAGAAGGAAAAGAAGGAAGG + Intronic
981141997 4:141279304-141279326 TTGAAAAAGAAAACTAAGGAAGG - Intergenic
981218379 4:142200096-142200118 CTGAATAAGTAAATGAATGGAGG - Intronic
981250162 4:142591468-142591490 TTGAATAAATAAATGGAGAAAGG + Intronic
981253287 4:142629264-142629286 TTGAATAAGTAAATGAAAACTGG - Intronic
981458457 4:144983624-144983646 ATTAAAAAGTAAAAGAATGAGGG + Intronic
982649416 4:158068008-158068030 TTGAGAAAGTAAAATATGGAAGG - Intergenic
982806428 4:159770960-159770982 ATGAATAAATAAAGGAAGTAAGG + Intergenic
982936500 4:161484232-161484254 GAGAATAAGAAAAAGAAGGAAGG - Intronic
982946873 4:161635660-161635682 AGAAATAAGTAAAAGAGGGATGG + Intronic
983008953 4:162521584-162521606 TGAAAAAAATAAAAGAAGGAAGG + Intergenic
983366096 4:166791696-166791718 TTAAATAAGTAAAACACAGAAGG - Intronic
983557724 4:169073306-169073328 TTCAAAAAGAAAAAGAAGGTGGG - Intergenic
983640759 4:169942127-169942149 TTGAAAAAGCAGAAGCAGGAAGG + Intergenic
983706955 4:170673305-170673327 TTGAATAAGTGAATGGATGATGG + Intergenic
984139454 4:175985040-175985062 CTGAAAAAGAAAAAGAAGGTGGG - Intronic
984452326 4:179918573-179918595 TTGAATAAGTAAAAAAAAAGGGG + Intergenic
984516819 4:180751561-180751583 TTGGATAAGTAAAAAACAGATGG + Intergenic
984847641 4:184121181-184121203 TAGAATAGGGAAAAGGAGGAGGG - Intronic
985240187 4:187922929-187922951 ATGAATGAGTAAAGGAAGGAAGG - Intergenic
985867494 5:2525249-2525271 ATCAAGAAATAAAAGAAGGAAGG + Intergenic
986828598 5:11549917-11549939 TTCACTAAATAAAAGAAAGAAGG + Intronic
986835468 5:11632063-11632085 TTGAACAATTAAGAGAAGAATGG + Intronic
986947780 5:13045884-13045906 TAGAATAATGAAAAGAAAGAAGG - Intergenic
987176624 5:15317819-15317841 TTGAATAAATTAAATGAGGATGG - Intergenic
987526364 5:19055355-19055377 TTGAATAATTAAAACCAGTATGG + Intergenic
987580863 5:19790338-19790360 TTAAATATATAAAGGAAGGAAGG - Intronic
988334971 5:29895356-29895378 TAGATTAAGTAAAACAAGCAAGG - Intergenic
988443175 5:31255365-31255387 TTAAATATGTGAAAGAAGAAGGG - Intronic
989079710 5:37605012-37605034 TTTAAAAAAAAAAAGAAGGAGGG - Intronic
989204351 5:38796743-38796765 TGGAAAAAGTCAAAGAAGGGTGG - Intergenic
989377675 5:40781809-40781831 ATGTATAAGAGAAAGAAGGAAGG + Intronic
990620391 5:57552835-57552857 TTATATAAGTAAGAAAAGGAAGG + Intergenic
990683034 5:58267411-58267433 GTGAATAAATGAAGGAAGGAAGG + Intergenic
990934396 5:61132289-61132311 ATGAATAAGTGAAAGAAAGAGGG + Intronic
990966481 5:61454051-61454073 TTGAATAAATAAATGGGGGAAGG - Intronic
991021690 5:61985883-61985905 TTGAATGAGGAAGGGAAGGAAGG + Intergenic
991266196 5:64721058-64721080 TTGATTAAGGATAAGAATGAGGG - Exonic
991487539 5:67153134-67153156 ATGATAAAATAAAAGAAGGATGG - Intronic
991964160 5:72074382-72074404 CTGAATAAGCAAGGGAAGGAAGG - Intergenic
992014800 5:72565020-72565042 TTGAAGAAGAAAAAGAAGTCTGG + Intergenic
992116854 5:73546880-73546902 TTGAAAAAAAAAAAGAATGAAGG - Intergenic
992133615 5:73720344-73720366 TTGAAAAAGAAGAAAAAGGAAGG + Intronic
993199800 5:84800755-84800777 AAGAAAAAGAAAAAGAAGGAAGG + Intergenic
993232562 5:85255578-85255600 TTGAACAAACAAAAGAGGGAGGG - Intergenic
993238376 5:85345761-85345783 TTGAATAAGTAAATAAATGAGGG + Intergenic
993482063 5:88436009-88436031 TTGAAAAAGTGATAGAAGCAGGG - Intergenic
993671578 5:90766904-90766926 TTTAATAATCAAAAGAAGGTGGG + Intronic
993766957 5:91871852-91871874 TTGAAAAAGTAAGAGAAAGAAGG - Intergenic
993827983 5:92716383-92716405 TTGAATATGTAGCACAAGGAAGG + Intergenic
993996971 5:94734809-94734831 TTAAATAAGAAAAAAAAGCATGG - Intronic
994892812 5:105660137-105660159 GTAAATAAGTGAAAGAATGAAGG + Intergenic
995295323 5:110514235-110514257 TTAAATAACTAGAAGCAGGAAGG + Intronic
996104586 5:119484490-119484512 TTGCATAAGTAAATAAAGGTAGG - Intronic
996631092 5:125633598-125633620 TTTAAAAAGAAAAAGAAAGAAGG + Intergenic
996652285 5:125893805-125893827 TTGTATAGGTAACATAAGGATGG - Intergenic
996795993 5:127348326-127348348 TAGAATCAGAAAAAGAAGGCAGG - Intronic
997084266 5:130778491-130778513 TTTAAAAAGAAAAAGGAGGAAGG + Intergenic
997201935 5:132015650-132015672 TTGAATGAATAAATGAATGATGG + Intergenic
998075278 5:139231465-139231487 TTTAACAAGCAAAAGAAGGCCGG + Intronic
998305781 5:141075492-141075514 TTGAATAAGTAATGGAATAAAGG + Intergenic
999040958 5:148411405-148411427 TTGAATAAATAAAAGCATGTTGG - Intronic
999104358 5:149057392-149057414 AAGAAAAACTAAAAGAAGGATGG - Intronic
999160936 5:149498125-149498147 TTTAAAAAGTAAAAGAAGCTGGG - Intronic
999339723 5:150759525-150759547 TTCAATAAGTATGAAAAGGAGGG + Intergenic
999376859 5:151092806-151092828 GTGCATCAGTAAAATAAGGAGGG - Intronic
999750063 5:154621530-154621552 TTCAACAAGTAAGAAAAGGATGG - Intergenic
999876586 5:155813296-155813318 TTGAAAAAGTAAAGAAAGAAAGG + Intergenic
1000193278 5:158934247-158934269 TTGAATGAATGAATGAAGGAAGG - Intronic
1000660164 5:163928493-163928515 TTTAACAAGTAAAGGAATGATGG - Intergenic
1000686509 5:164256061-164256083 TTGAATAAATGAATGAATGAAGG - Intergenic
1000982878 5:167835456-167835478 TTGAATAAGTAAAGGATTAAAGG - Intronic
1001284559 5:170413078-170413100 TTGAATGAGTGAATGAAGGAAGG + Intronic
1001564922 5:172693773-172693795 TTGAATAAAGAAAAAAAGGTAGG + Intergenic
1001763330 5:174225302-174225324 CTGTACAAGTAAAAGAAGCACGG - Intronic
1002827389 6:785719-785741 ATGAATAAGTACAAGAAAAAAGG - Intergenic
1002972397 6:2037212-2037234 TTGTACAAGTAAAAGAAGGTGGG + Intronic
1003099230 6:3164393-3164415 TTTAATAACTGAAAGAAAGAAGG + Intergenic
1003724471 6:8744874-8744896 CAGAATAAGTTAAAGAGGGAGGG + Intergenic
1003813133 6:9806595-9806617 TTTAAAAAGTAAAAATAGGATGG + Intronic
1003823092 6:9922414-9922436 TTGTATAAGTGAAACAAGGATGG + Intronic
1003830030 6:9998427-9998449 CTGAATAAGTGAAAGAAAGGAGG + Intronic
1004079108 6:12373437-12373459 ATGAATAAGTGAATGAATGAAGG - Intergenic
1004237414 6:13886597-13886619 TTCAATAAGGGAAAGAAAGAAGG + Intergenic
1004878544 6:19982003-19982025 TTGAAAAACTAAAACAATGATGG - Intergenic
1004990623 6:21133822-21133844 TTGAAGAATTAAGAGAAAGAAGG + Intronic
1005827614 6:29644244-29644266 CTGAATAATTATAAGTAGGATGG + Intergenic
1006279099 6:33033002-33033024 TTGAGTAAGAAAAAAAAGAAAGG - Intergenic
1006416576 6:33907731-33907753 TCCAAGAAGTGAAAGAAGGAAGG + Intergenic
1006822307 6:36907048-36907070 TGGAAGGAGGAAAAGAAGGAGGG - Intronic
1007393238 6:41562539-41562561 TGGAAAAAGAGAAAGAAGGAAGG - Intronic
1007401841 6:41607223-41607245 ATCAATAAATAAAAGAAGAATGG + Intergenic
1007722915 6:43896074-43896096 TTCCAAAAGTAAATGAAGGAGGG + Intergenic
1008316083 6:50042994-50043016 TTGAGGAAGGAAAAGAAGAATGG - Intergenic
1008962145 6:57276943-57276965 TCAAATAAGTCAAAGAAGCATGG + Intergenic
1009179885 6:60504082-60504104 ATGAAAAAGTAAAAGAATCATGG - Intergenic
1009291673 6:61890222-61890244 TTGAATAAATAAAAGCAAGTGGG + Intronic
1009329934 6:62405569-62405591 TTGAAATAGTAAAAAAATGAAGG - Intergenic
1009615995 6:66008262-66008284 GTCAATAAGAAAAAGAAAGAAGG - Intergenic
1009803984 6:68578702-68578724 AGGAAAAAGAAAAAGAAGGAAGG + Intergenic
1010245336 6:73656898-73656920 TTGAATAAGTAAATAAATGTAGG - Intergenic
1010276874 6:73978650-73978672 TTGAATAAGGAAAAGACTTAAGG - Intergenic
1010288608 6:74109179-74109201 TTGAATGAATGAATGAAGGAAGG + Intergenic
1010561913 6:77361430-77361452 TTGGAAAAGTAAAACAAGAAAGG + Intergenic
1010970960 6:82262968-82262990 TCGAAAAAAAAAAAGAAGGAAGG + Intergenic
1011113783 6:83867335-83867357 TTGGAGAATTATAAGAAGGAAGG + Intronic
1011985544 6:93439530-93439552 TTGAATGAATAAAATAAAGATGG - Intergenic
1012426837 6:99124135-99124157 ATAAATAAATAAAAGAAGGCAGG - Intergenic
1012578588 6:100834133-100834155 ATGAATAAGTAATAAAAGGAGGG + Intronic
1012651406 6:101758238-101758260 TTAAATAAATAAATGAATGAAGG + Intronic
1012707142 6:102545920-102545942 TTAAATAAATAAAATAAGGTTGG - Intergenic
1012784752 6:103609636-103609658 TGGAATAAGTAAAATAATGCAGG + Intergenic
1012997147 6:105985358-105985380 TTGAATAAATGAAACAAGGTTGG + Intergenic
1013034661 6:106369309-106369331 TTAAATGAGTAAAAGTAGGTTGG + Intergenic
1013255985 6:108386117-108386139 ATAAATAAATAAAAGAATGAAGG + Intronic
1013424945 6:110003160-110003182 AAGAATAAGCAGAAGAAGGAAGG + Intergenic
1013841343 6:114398125-114398147 TGGAAGAATGAAAAGAAGGAAGG - Intergenic
1013842186 6:114409955-114409977 TTGAATAATTAAATAAAAGAAGG - Intergenic
1013989138 6:116233337-116233359 ATGAATGAAGAAAAGAAGGAGGG - Intronic
1014038802 6:116799825-116799847 TTGAATAAGTGAAAGAGGTTGGG + Intronic
1014491349 6:122065547-122065569 TTGAATAAATATACGAAGGAAGG + Intergenic
1014573046 6:123035099-123035121 TTGCATCATTAAAAGAAGTAGGG + Intronic
1014605586 6:123470107-123470129 TTTAATAAATAAAAGAATAAGGG - Intronic
1014714069 6:124843158-124843180 TTGAATAAGAAAGATAAGAAAGG - Intergenic
1014811141 6:125887117-125887139 TGGATTAGGTAAAAGAAGAAAGG + Intronic
1014933384 6:127359898-127359920 TTGAATAAAGAAAATAAGGCCGG - Intergenic
1015245420 6:131068860-131068882 TTAAAAAAAGAAAAGAAGGAAGG - Intergenic
1015387996 6:132648219-132648241 ACAAATAAGTAAAAGAAAGAAGG - Intergenic
1015563654 6:134543120-134543142 TTGAATAAATACAAGAAGCTTGG + Intergenic
1015672626 6:135707650-135707672 TGGAATAAGTAATGGAAGAATGG - Intergenic
1016457861 6:144249838-144249860 TTGAGCAAGGAAAAAAAGGAAGG - Intergenic
1016565431 6:145447174-145447196 AGGAAGAAATAAAAGAAGGAAGG + Intergenic
1016589258 6:145726323-145726345 TTGAATAGGTAAATAAATGAGGG + Intronic
1017229548 6:152057940-152057962 TTGAAAAAGGACAAGAAGAAAGG + Intronic
1017268100 6:152474853-152474875 TGGAATAAGAAAAATGAGGAAGG + Intronic
1017315572 6:153027543-153027565 TTGAGTAAGTAAGTGAAAGAAGG - Intronic
1017325863 6:153140740-153140762 GTGAATAATTTAAAAAAGGATGG + Intergenic
1017439054 6:154445818-154445840 TAGAATTTTTAAAAGAAGGAAGG + Intronic
1017533519 6:155321886-155321908 TCACATAAGTAAAAGGAGGATGG - Intergenic
1017868804 6:158468839-158468861 TAGAATGAGTAAAAGCAGGGAGG + Intronic
1018473514 6:164117887-164117909 TTGAATCAGTCATAGAAGGAGGG - Intergenic
1019515244 7:1437001-1437023 GTGAATAAGTGAATGAAGGAAGG + Intronic
1019574017 7:1727550-1727572 TTGAATGAGGAAATGAAGGGAGG - Intronic
1019971119 7:4541684-4541706 TTGAAGAAGGAAAACAAGGAAGG - Intergenic
1020257406 7:6509825-6509847 TTAAAAAAGAAAAAGAAAGAAGG - Intronic
1020314453 7:6895119-6895141 AGGAAGAAGGAAAAGAAGGAAGG + Intergenic
1020463183 7:8446518-8446540 TTGAATAAGTAAAGGAATAGAGG + Intronic
1020646117 7:10816254-10816276 TAGAGTAACTAAAAGGAGGATGG + Intergenic
1020828426 7:13062219-13062241 TTGGAAAAATAAAATAAGGAAGG + Intergenic
1020878685 7:13730648-13730670 GTGTATAAGAAAAAGAAGGAGGG - Intergenic
1021075163 7:16294528-16294550 TTGAATTAGTAAAAGCAGGAAGG - Intronic
1021182340 7:17521551-17521573 TTTAAAAACTAAATGAAGGAAGG + Intergenic
1021225405 7:18020629-18020651 ATGAATAGGCAAAAGAAGGTTGG - Intergenic
1021543630 7:21788913-21788935 TTAAATAAGTAAAATAATGGTGG + Intronic
1022116108 7:27262179-27262201 TGGAATAATTAAAGGAAGAAAGG - Intergenic
1022507802 7:30917363-30917385 TGGAGTTAGGAAAAGAAGGAGGG + Intronic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1022718363 7:32919606-32919628 TTGAAAAAAAAAAAAAAGGATGG + Intergenic
1022867859 7:34441143-34441165 TTAAATAAGAAAAATAAGGGGGG + Intergenic
1023070184 7:36422662-36422684 TTGAATAAATTGAAGAACGAAGG + Exonic
1023372176 7:39522576-39522598 TTCAAAAAAAAAAAGAAGGAAGG + Intergenic
1023468511 7:40486719-40486741 TTGAAAAAAAAAAAAAAGGAAGG - Intronic
1023763799 7:43491945-43491967 TTGAAAAAGTAAAAAAGTGATGG - Intronic
1024332831 7:48173410-48173432 TTGAATAAGTAAAAGAAGGAAGG + Intronic
1025195832 7:56932213-56932235 TTGAAAAAGAAAAACAAGGTTGG - Intergenic
1025287906 7:57683398-57683420 ATAAATAAATAAAAGAAAGAAGG - Intergenic
1025676117 7:63644722-63644744 TTGAAAAAGAAAAACAAGGTTGG + Intergenic
1026159302 7:67854514-67854536 CTGACTAAGTGAAAGGAGGAAGG - Intergenic
1026296598 7:69058275-69058297 TAGAATGAATAAAGGAAGGAAGG + Intergenic
1026333078 7:69370121-69370143 TTGAATGAATAAATGAAGGAAGG - Intergenic
1027738834 7:81973543-81973565 TTGAAAAACAAAAAGAAGGGAGG + Intronic
1027854286 7:83488966-83488988 TTGTAGAAGTAAAGGAAAGAAGG + Intronic
1028698122 7:93741363-93741385 CTGAATAAGTAAATGAATGGAGG - Intronic
1028839519 7:95412840-95412862 TTGAATCAGTGGGAGAAGGATGG - Intronic
1028873562 7:95795227-95795249 TTGAATAAGTAAACACTGGAAGG + Intronic
1029575495 7:101400866-101400888 ATGAACAAGTGAAGGAAGGAAGG - Intronic
1029594335 7:101528843-101528865 TTTAAAAAAGAAAAGAAGGATGG - Intronic
1029835633 7:103306737-103306759 TTAAATAAATAAAAGAAAGCTGG - Intronic
1030154778 7:106443172-106443194 TTGAATAAATAAATAAATGAGGG + Intergenic
1030757155 7:113300924-113300946 TTGAATAAGTAAATGGATGGTGG - Intergenic
1030889461 7:114981486-114981508 AAGAAAAAGTAAAAGAGGGAGGG - Intronic
1030903549 7:115153635-115153657 TGGAATAAGAAAAAGAAAGAAGG - Intergenic
1030949401 7:115770622-115770644 TTGAAGAAATAAAGGAAGAAAGG - Intergenic
1030981359 7:116188294-116188316 TTAAATATGTAAAAGAACTAAGG + Intergenic
1031061947 7:117061644-117061666 TTGAATTAGTAATTAAAGGAAGG + Intronic
1031072406 7:117176675-117176697 AGGAATAAGTAAAAATAGGAAGG + Intronic
1031137832 7:117904504-117904526 TTGAATAAGAAAGGGCAGGAAGG + Intergenic
1031445845 7:121852665-121852687 ATGAATAAATAAATAAAGGAAGG + Intergenic
1031561006 7:123238175-123238197 AAGAACAAATAAAAGAAGGATGG - Intergenic
1031657505 7:124376192-124376214 TTAAATAAGAAAAAGAAAAAAGG + Intergenic
1032072972 7:128820942-128820964 TGGCATAGGTAACAGAAGGATGG - Intronic
1032654133 7:133909161-133909183 TTGAATGAGTAACAGATTGAAGG - Intronic
1032720606 7:134548147-134548169 TTAAAAAAGTAAAATCAGGAAGG + Intergenic
1032824257 7:135553863-135553885 GTGAATAAGGAAGGGAAGGAAGG + Intergenic
1032873265 7:136009594-136009616 TTGAACGAGTAAATGAATGAAGG + Intergenic
1033060806 7:138105161-138105183 GAAAAAAAGTAAAAGAAGGATGG - Intronic
1033516442 7:142111357-142111379 TTTAATAAGTAAGTGAAAGAAGG - Intergenic
1033593938 7:142840852-142840874 TTCAATAAGTCCAAGAATGATGG - Intergenic
1033629755 7:143146131-143146153 TTGAATAAGTAATAAATGAATGG + Intergenic
1033832587 7:145271469-145271491 AGGAAGAAGAAAAAGAAGGAAGG + Intergenic
1034733917 7:153411878-153411900 TTTAGTAAGGAATAGAAGGAAGG + Intergenic
1035053628 7:156019098-156019120 ATGTTTAAGTAAATGAAGGAAGG + Intergenic
1035278888 7:157765154-157765176 TTGGATGGATAAAAGAAGGATGG - Intronic
1035482393 7:159197944-159197966 AGGAATAAATAAAGGAAGGAAGG - Intergenic
1037297683 8:17418408-17418430 GTGAAAAAGGAAGAGAAGGATGG - Intergenic
1037563613 8:20097389-20097411 CTGAATAAGAAGAATAAGGAGGG - Intergenic
1038092092 8:24266215-24266237 TTTAAAAAGTAAGAGAAAGAAGG + Intergenic
1038195543 8:25363570-25363592 TTAAATATGTAAAGCAAGGAAGG - Intronic
1038312922 8:26458768-26458790 ATGAATAAATAAAAAAAGAAAGG + Intronic
1038415101 8:27389396-27389418 TTGAAGAACTAAGAGAAGAATGG + Intronic
1038883547 8:31639851-31639873 ATAAATAAATAAAAGGAGGAGGG + Intronic
1039142741 8:34411146-34411168 AGGAAGAAGGAAAAGAAGGAAGG + Intergenic
1039194579 8:35016589-35016611 TTAAATATGTAAAAGAAAAATGG + Intergenic
1040599006 8:48866033-48866055 AAGAATATGTAAGAGAAGGAAGG + Intergenic
1041577481 8:59416022-59416044 TTGAATATATAAATGAAGCAGGG - Intergenic
1041854922 8:62440675-62440697 AAGAAGAAGAAAAAGAAGGAAGG - Intronic
1042230724 8:66551721-66551743 TTGAAGAAGCAAAAGAAGTCTGG - Intergenic
1042345348 8:67721071-67721093 TTGAATAAATCAAAGCAGGCTGG + Intronic
1042742707 8:72068563-72068585 TTTAATGACTAAAAGGAGGAAGG - Intronic
1043017441 8:74957725-74957747 TTGAAGAAGTAAATGAATCAGGG + Intergenic
1043017743 8:74961734-74961756 TTGAATAAATAAATAAATGAGGG - Intergenic
1043187354 8:77170989-77171011 TTGAATATGTAAAAAAGGGATGG - Intergenic
1043282251 8:78482738-78482760 TTGGATAAGTAAATGAACTAAGG + Intergenic
1043538721 8:81234948-81234970 TTGAAAATGTAAGAGAATGAAGG + Intergenic
1043689236 8:83129676-83129698 GTGGATGAGTAAAATAAGGAAGG + Intergenic
1043721992 8:83556693-83556715 TGGTATAATTAAAAGAAAGAGGG - Intergenic
1043728841 8:83649618-83649640 TTGAATGAAAGAAAGAAGGAGGG - Intergenic
1043764238 8:84109399-84109421 ATGAAAAAGAAAAATAAGGAAGG - Intergenic
1044411693 8:91891346-91891368 GTGAAAAAGCAAAAGAAGGGTGG + Intergenic
1044626784 8:94241868-94241890 TGGAATAAGGACAAGAAGGAAGG + Intergenic
1045141439 8:99289053-99289075 ATGAATGAATGAAAGAAGGAAGG + Intronic
1045375168 8:101565268-101565290 TTTAAAAATTAAAAGATGGAAGG + Intronic
1045695189 8:104801249-104801271 ATGAATGAGTAAATGAATGAAGG - Intronic
1045756064 8:105543736-105543758 TTGAATACACAAAAGAAGGAAGG - Intronic
1045783366 8:105894579-105894601 TTGAATAAATAAATGTAGAAGGG + Intergenic
1045846544 8:106643677-106643699 TTGCTTGAGTAAAAGATGGAGGG + Intronic
1046061379 8:109143989-109144011 TGGAAAATGGAAAAGAAGGAAGG - Intergenic
1046293390 8:112191851-112191873 TTAATTAAATAAAACAAGGAGGG - Intergenic
1046341303 8:112859834-112859856 TTTATTAAGTAGAAGAAAGATGG - Intronic
1046858523 8:119064286-119064308 TTTATTGAGTAAAAAAAGGAGGG + Intronic
1047920297 8:129628454-129628476 TTTAAGAAGAAAAAGAAGAAAGG + Intergenic
1048003180 8:130396444-130396466 TTAAATACATAAAGGAAGGAAGG - Intronic
1048015972 8:130498336-130498358 ATAAATAAATAAAAGGAGGAGGG - Intergenic
1048053871 8:130845830-130845852 TTGAATTAATAAAAGAAGGAAGG + Intronic
1048156192 8:131955777-131955799 TTGCAGAAGGAGAAGAAGGAGGG - Exonic
1048250942 8:132866457-132866479 TAGAAGAAAGAAAAGAAGGAAGG + Intergenic
1048365676 8:133736315-133736337 TTTAAAAATTAAAGGAAGGAAGG - Intergenic
1049752850 8:144293736-144293758 GGGAATAAGAAAAAGAAGAAGGG - Intronic
1050176263 9:2872348-2872370 TTGTATAAGTCAAAGATGGATGG + Intergenic
1050181649 9:2929180-2929202 TTGAAAAAAGAGAAGAAGGAAGG + Intergenic
1050193511 9:3055487-3055509 TAGAATAAGATAAAGAAGGGAGG + Intergenic
1050228377 9:3488170-3488192 TTGAAAGAGAAAAAGAGGGAAGG + Intronic
1050600424 9:7244898-7244920 ATTAATAAGTAAATGAATGAGGG - Intergenic
1050668258 9:7966528-7966550 TTGAACAAGTGAATAAAGGAAGG + Intergenic
1050838802 9:10119859-10119881 TTGAATCAGAAAACGTAGGAGGG + Intronic
1051014908 9:12462995-12463017 TGGAAGAAGGAAAGGAAGGATGG - Intergenic
1051097847 9:13487019-13487041 AAAAATAAGTAAAAGGAGGAAGG + Intergenic
1051250248 9:15151879-15151901 TTGAAAAAGGAAAAGAGGGTTGG + Intergenic
1051354754 9:16231424-16231446 TGGGAAAAGGAAAAGAAGGAAGG - Intronic
1051714614 9:19969252-19969274 ATGAAAAAGGAAAAGAATGAAGG - Intergenic
1051908486 9:22125220-22125242 CTGAAGAAGTAAAAAAAGAATGG + Intergenic
1052027298 9:23587846-23587868 AGGAAGAAGTAAAAGAAGGAGGG + Intergenic
1052029371 9:23610968-23610990 TTGAAGAATGAAAGGAAGGAAGG + Intergenic
1052873695 9:33535018-33535040 TTGAAAAATTCAAAGGAGGAAGG - Intronic
1053486893 9:38465354-38465376 AAGAAAAAGAAAAAGAAGGAAGG + Intergenic
1053502396 9:38609745-38609767 TTGAAAAATTCAAAGGAGGAAGG + Intergenic
1053618791 9:39795310-39795332 TTAAATAAGTTAATGAATGAGGG + Intergenic
1053876968 9:42554672-42554694 TTAAATAAGTTAATGAATGAGGG + Intergenic
1053895706 9:42740035-42740057 TTAAATAAGTTAATGAATGAGGG - Intergenic
1054234730 9:62547050-62547072 TTAAATAAGTTAATGAATGAGGG - Intergenic
1054265363 9:62912119-62912141 TTAAATAAGTTAATGAATGAGGG - Intergenic
1054756392 9:68962997-68963019 TTTCAAAAGTAAAAGAAGGGTGG - Intronic
1054800739 9:69345902-69345924 TTTAATAAGAATAAGAAGGTAGG - Intronic
1054845597 9:69793695-69793717 TTGAGAAAGAAACAGAAGGAAGG - Intergenic
1054957600 9:70930497-70930519 TTAAATAAGTAAAACAAAGTAGG - Intronic
1055204729 9:73714276-73714298 CTGAATAAATAAACAAAGGAAGG - Intergenic
1055692715 9:78850801-78850823 TAGAATAAGAAAAAGAGGGCAGG - Intergenic
1056421961 9:86437114-86437136 TTTAAAAAGTAAAAGAAGCCAGG - Intergenic
1057048461 9:91903834-91903856 TTAAATACGTAAAATAAGTATGG - Intronic
1057077661 9:92147357-92147379 TTACATCAGTAAAGGAAGGAAGG - Intergenic
1057153695 9:92819877-92819899 TTGAAAAATTCAAAGGAGGAAGG - Intergenic
1057681797 9:97194184-97194206 TTGAAAAATTCAAAGGAGGAAGG + Intergenic
1057882662 9:98804872-98804894 GTAAATAAGCAAAAAAAGGAAGG - Intergenic
1057943155 9:99302418-99302440 TTAAAAAAGTAAAAGAATAAAGG - Intergenic
1057992182 9:99781891-99781913 TAGAATAAGTAAAAGAAAGTTGG + Intergenic
1058242850 9:102587922-102587944 TTGAAGAAGAAAATAAAGGATGG - Intergenic
1058606077 9:106724849-106724871 TTGAAAAAGTATAAGCAGGCTGG + Intergenic
1058663675 9:107289184-107289206 TTGAAAAAGGAAGGGAAGGAAGG - Intronic
1058677834 9:107415707-107415729 TTGAATAAATAAATGAATGGGGG - Intergenic
1058696595 9:107564275-107564297 ATGAAAAAGGAAAAGAGGGAAGG + Intergenic
1058944739 9:109845849-109845871 CTCAATAAGTAAATGAATGATGG - Intronic
1059222513 9:112638202-112638224 TTGAAAAAGAAAAATAAAGAAGG + Intronic
1059483421 9:114609717-114609739 AAGAAAAAGAAAAAGAAGGAAGG + Intergenic
1059538471 9:115106855-115106877 TTGTATAAGTAAGGAAAGGAGGG + Intronic
1059739746 9:117138193-117138215 TGGAAGAAGTTAAAAAAGGAGGG + Intronic
1059850701 9:118335690-118335712 TTGAATGGGGAAAAGAAGAAAGG + Intergenic
1059935979 9:119311224-119311246 AGGATTAAATAAAAGAAGGAAGG + Intronic
1060045494 9:120337026-120337048 TGGAAGAAAGAAAAGAAGGACGG + Intergenic
1060720863 9:125976387-125976409 TTGAATAAATAGATGAAGGGAGG + Intergenic
1061137486 9:128743410-128743432 ATAAATAAATAAAAGAAGGCTGG - Intronic
1061350517 9:130061086-130061108 TTGAATGAGTAAGAGACAGAAGG - Intronic
1062695095 9:137870712-137870734 TCAAAAAAGAAAAAGAAGGAAGG - Intergenic
1186059244 X:5685984-5686006 GTGCAAAAGTAAAAGAAGCATGG - Intergenic
1186369040 X:8927750-8927772 TTAAATAAATAAAAGAAAGAGGG - Intergenic
1186430151 X:9498267-9498289 TTTTATAAGTCAGAGAAGGAAGG + Intronic
1186909515 X:14147095-14147117 TTGAATAACTAAATGACGGAAGG + Intergenic
1187084928 X:16032170-16032192 TAGAATAACTAAAAGTAGAAGGG - Intergenic
1187730370 X:22246899-22246921 TTGAGTAAGAAATAGAAGGGGGG + Intronic
1187777620 X:22780274-22780296 TGGAATAAAGAAAAGAAAGAGGG + Intergenic
1188006920 X:25021890-25021912 TTGAACAAGTCAAAGAGGGTTGG - Intergenic
1190139984 X:47834511-47834533 ATGAATAAATGAAAGAAGAATGG - Intergenic
1190762496 X:53448213-53448235 TTGAAGAAATAAAAGGAGGCCGG - Intergenic
1190969854 X:55337969-55337991 TTGAATCAGTAAATGATTGAAGG - Intergenic
1192329322 X:70161972-70161994 TTGAATAAGTAAATAAATGAGGG + Intronic
1192549532 X:72042866-72042888 TTGAATAAATAAATGAAGGAAGG + Intergenic
1192747454 X:73953573-73953595 TTGAATAAGGAAGATAAGAATGG - Intergenic
1193585887 X:83320431-83320453 TTACATAAGGAAAAGAAGAAAGG + Intergenic
1194052184 X:89083019-89083041 TTGAAGAAATAAAAGAATGATGG + Intergenic
1194352017 X:92832788-92832810 TTGAAGAAGACAAAGAATGATGG - Intergenic
1194363776 X:92988654-92988676 CTGAAGAAAAAAAAGAAGGAAGG - Intergenic
1194388897 X:93292168-93292190 ATCAAGAAGTAAATGAAGGAGGG + Intergenic
1194564361 X:95465607-95465629 TTGAAAAAGTTTTAGAAGGATGG - Intergenic
1194582230 X:95689101-95689123 TTGAATAAGTGAAAGGATGCTGG + Intergenic
1194779253 X:98003538-98003560 TTGAAGAAGTGAAAGATTGAAGG - Intergenic
1194785073 X:98073259-98073281 TTAACTTAGTAAAAGATGGAAGG + Intergenic
1195169213 X:102249526-102249548 TTGAAGAAATAAATGAATGAGGG - Intergenic
1195189644 X:102437562-102437584 TTGAAGAAATAAATGAATGAGGG + Intronic
1195298853 X:103507690-103507712 TTGAATAATTATCAGAATGATGG + Intronic
1195370837 X:104170666-104170688 TTGAAAATATAAAAGAAGGTGGG + Intronic
1195781259 X:108467440-108467462 TGGAAAAAGTAAAAGAAAGCTGG - Intronic
1196313858 X:114199645-114199667 AGGAAAAAGAAAAAGAAGGAGGG + Intergenic
1196349522 X:114709730-114709752 AGGAATAAGAAAAGGAAGGAAGG - Intronic
1197140251 X:123109992-123110014 TGGAAAAATCAAAAGAAGGAAGG - Intergenic
1197317046 X:124979770-124979792 AAGAAAAAATAAAAGAAGGAAGG + Intergenic
1197730289 X:129803988-129804010 TTTATTAAGGAAAAGAAAGAGGG + Exonic
1197827918 X:130610606-130610628 TTGAGTGAGTAAATGAATGAAGG + Intergenic
1197857593 X:130933292-130933314 TTGAATAAATAAATAAATGAGGG + Intergenic
1197880630 X:131163399-131163421 TTGACGAATTAAAAGAAGTAGGG - Intergenic
1197905429 X:131419861-131419883 TTGAAGAAGAAAAATAATGAAGG + Intergenic
1198006905 X:132504064-132504086 ATGAATAAATGAAGGAAGGAAGG + Intergenic
1198201159 X:134420150-134420172 TTTAAAAAATAAAAGAAGGCCGG + Intronic
1198523981 X:137481287-137481309 ATGAATAATTGAAAGAAGTATGG - Intergenic
1198702508 X:139413498-139413520 TTGGAAAAGTAAGAGAAGAATGG - Intergenic
1199086632 X:143635643-143635665 TTGAATAATTACAGGATGGAGGG + Intronic
1199313424 X:146348185-146348207 TTGAATATGCAAAAGAGAGAAGG + Intergenic
1199517208 X:148691345-148691367 TTGAATAAGTAAATGAAAGTAGG - Intronic
1199704886 X:150415509-150415531 TTGCATAAGCAAAAAGAGGAAGG + Intronic
1199707809 X:150445872-150445894 TTCAATAAGAAAAATGAGGAAGG + Intronic
1200660325 Y:5949474-5949496 TTGAAGAAGACAAAGAATGATGG - Intergenic
1200672008 Y:6104893-6104915 CTGAAGAAAAAAAAGAAGGAAGG - Intergenic
1201226354 Y:11822634-11822656 TAGAATAAGTCAAATAAGGTAGG - Intergenic
1201312646 Y:12610866-12610888 TTTAATAAGCGAAAGAAGAAAGG + Intergenic