ID: 1024340071

View in Genome Browser
Species Human (GRCh38)
Location 7:48248441-48248463
Sequence CAGTGTAAGTACATGTTTGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 134}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024340067_1024340071 26 Left 1024340067 7:48248392-48248414 CCTGAGAATGATGTCTTTTCTAG 0: 1
1: 0
2: 0
3: 12
4: 209
Right 1024340071 7:48248441-48248463 CAGTGTAAGTACATGTTTGGTGG 0: 1
1: 0
2: 1
3: 11
4: 134
1024340068_1024340071 -9 Left 1024340068 7:48248427-48248449 CCAGCTTGTCTCCACAGTGTAAG 0: 1
1: 0
2: 2
3: 14
4: 138
Right 1024340071 7:48248441-48248463 CAGTGTAAGTACATGTTTGGTGG 0: 1
1: 0
2: 1
3: 11
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024340071 Original CRISPR CAGTGTAAGTACATGTTTGG TGG Exonic
902422797 1:16294872-16294894 CAGTCTATGTATGTGTTTGGAGG - Exonic
908660769 1:66432541-66432563 CAGTGAAGGTGCATGTTTGGGGG + Intergenic
910401774 1:86844710-86844732 CAGTGTAAGTAAACTCTTGGTGG + Intergenic
913443848 1:118928570-118928592 CTGTATATGTAAATGTTTGGAGG + Intronic
913976081 1:143456812-143456834 CAGTGTATGGATGTGTTTGGAGG - Intergenic
914070478 1:144282432-144282454 CAGTGTATGGATGTGTTTGGAGG - Intergenic
914108677 1:144683922-144683944 CAGTGTATGGATGTGTTTGGAGG + Intergenic
915810196 1:158900767-158900789 CAGTTTATGGACATATTTGGGGG + Intergenic
916478910 1:165197550-165197572 CAGTGTAGGTAAAAGTATGGAGG - Intergenic
919362698 1:196614613-196614635 CAGTGTAGGTAAGTGATTGGTGG + Intergenic
919448869 1:197746067-197746089 CAGTGTAACTACACGTTTTCTGG - Intronic
920282232 1:204852863-204852885 AATTTTAAGTACATGTTTTGGGG + Intronic
923250638 1:232176914-232176936 CAGTGGAAGTACAGGACTGGAGG - Intergenic
923922856 1:238588363-238588385 TATTGTAAGAACAAGTTTGGTGG + Intergenic
924375837 1:243407610-243407632 TACTGTAAGAACATTTTTGGAGG + Intronic
1063876954 10:10489885-10489907 CTATGTGAGTACAGGTTTGGGGG + Intergenic
1065702395 10:28438096-28438118 AAATATAAATACATGTTTGGAGG - Intergenic
1066482293 10:35808729-35808751 CACCCTAAGTACATCTTTGGAGG - Intergenic
1068613243 10:59083960-59083982 CAGAGTAACAACATGTTTGAGGG - Intergenic
1069648016 10:70018989-70019011 CAGTGAAAGTATGTGTTTGGGGG - Intergenic
1072984603 10:100128795-100128817 GAGTGTAAGTGCATAATTGGGGG + Intergenic
1073441314 10:103554326-103554348 CCATGTGAGTACATGTCTGGTGG + Intronic
1074080003 10:110160258-110160280 CAGAGTAGCTACATTTTTGGAGG - Intergenic
1074948989 10:118310149-118310171 CAGTGTAACTACACGTTTACTGG - Exonic
1075819887 10:125297855-125297877 CACTGCAATTACATTTTTGGAGG - Intergenic
1085137368 11:74104500-74104522 ATGTGTATGTACATGTATGGGGG + Intronic
1089741437 11:120587295-120587317 CAGTGTGAGTACGTGATTGGAGG + Intronic
1091238269 11:134036028-134036050 CAGGGTCTGTACATGTTTGCTGG + Intergenic
1091758055 12:3068373-3068395 CAGTGTAAGAGGATGGTTGGTGG - Intergenic
1093416051 12:18922483-18922505 CACTGTGATTAAATGTTTGGTGG + Intergenic
1103050151 12:117772112-117772134 GAGTGTATGTGCATCTTTGGGGG - Intronic
1103590062 12:121985741-121985763 CAGGTCAAGTACAGGTTTGGAGG - Intronic
1104767626 12:131340681-131340703 CAGTCTAAGGACATGTTTCGGGG - Intergenic
1105223160 13:18352940-18352962 CAGTGTATGGATGTGTTTGGAGG + Intergenic
1107730599 13:43344519-43344541 CAATGTAAGTAAAATTTTGGGGG - Exonic
1110091821 13:71460494-71460516 CAGTGTATTTACATGTTTTCTGG + Intronic
1111908503 13:94283561-94283583 CTGTGTTAGTACAGGGTTGGTGG - Intronic
1114966925 14:27973690-27973712 CAGATTAAATACATTTTTGGAGG + Intergenic
1116644195 14:47505672-47505694 CAGTGTAAGTTGAAATTTGGGGG - Intronic
1116820761 14:49625106-49625128 AATTATAAGTACATGTGTGGGGG - Intergenic
1118511460 14:66479313-66479335 TAGAGTAAATACATGCTTGGAGG - Intergenic
1122813956 14:104303217-104303239 CAGTGTCAGTCCCTGTGTGGGGG - Intergenic
1126869059 15:52968195-52968217 GAATGTAAGCACACGTTTGGTGG + Intergenic
1129940925 15:79495968-79495990 CAGTGTGAGTATATGTAAGGGGG + Intergenic
1132892973 16:2213562-2213584 CCTTGTAAGTACACGTTTGGGGG - Exonic
1135350347 16:21724110-21724132 AGGTGGAAGAACATGTTTGGGGG + Intronic
1135898998 16:26438849-26438871 CAGTGTAGGTACATGTTATGAGG - Intergenic
1139946925 16:70647993-70648015 CAGTGTGAGCAAAGGTTTGGCGG + Intronic
1143096850 17:4482852-4482874 CAGTGTAAGCAAAGGTGTGGAGG + Intronic
1143508361 17:7381836-7381858 CAGTGTATCTAGGTGTTTGGAGG + Intronic
1145240605 17:21239110-21239132 CAGTGTGAGTACATGGTCAGGGG + Exonic
1146511496 17:33453140-33453162 CAGTATGTGTACATGTTTGTGGG + Intronic
1148498215 17:48067998-48068020 CAGTGGAAAAACATGTTTGTTGG - Intergenic
1156993823 18:43442198-43442220 CAGTGTAAATACATATTTTCAGG + Intergenic
1157787027 18:50493093-50493115 CACTGTATGTACCTCTTTGGTGG - Intergenic
1158453152 18:57584842-57584864 CAGTGAAAAAAAATGTTTGGGGG + Intronic
1159797824 18:72866647-72866669 CAGTATAAGAAAATGTGTGGTGG - Intronic
1164107908 19:22125153-22125175 CAGTGAAAGTGTGTGTTTGGTGG - Intergenic
1164308996 19:24030141-24030163 CAGTGCAAATACATATTTGGGGG + Intergenic
1164551605 19:29216969-29216991 CAGGGTAGGTACCTGCTTGGTGG + Intergenic
1166937421 19:46342924-46342946 CAAGGTAAGTGCATGTCTGGAGG - Exonic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
930807740 2:55508256-55508278 CATAGTAAGGACATGTTTAGTGG + Intergenic
931580360 2:63765308-63765330 CAGTGTGTGTAAATGTTTTGAGG + Intronic
932942421 2:76183465-76183487 CTGTCTAAGTACTTTTTTGGAGG + Intergenic
934180781 2:89617803-89617825 CAGTGTATGGATGTGTTTGGAGG - Intergenic
934291080 2:91692039-91692061 CAGTGTATGGATGTGTTTGGAGG - Intergenic
937950309 2:127381535-127381557 CAGTGTTAATAAATGTTTGTTGG - Intronic
938153384 2:128905249-128905271 CAATGTTAGTACATGTGTCGAGG + Intergenic
940927497 2:159381363-159381385 CAGAGTAAGTAGATAATTGGGGG - Intronic
941662366 2:168208317-168208339 AAGTGAAAGTACACTTTTGGAGG + Intronic
943536478 2:189157686-189157708 CAGTGGAATTAAATGTTTTGTGG + Intronic
943669603 2:190648006-190648028 CAGCCTAAGTACATTTTTGAAGG + Intronic
1169383062 20:5125822-5125844 CATTGTAAGTACTTGTTGGATGG - Intronic
1171362320 20:24596677-24596699 GAGTGTAAGAAAAGGTTTGGAGG - Intronic
1173673504 20:44814105-44814127 CATTCTAAGAACAAGTTTGGGGG + Intergenic
1175565401 20:59971651-59971673 CAGTGTAAATACATCTTTAAAGG + Intronic
1176731710 21:10505358-10505380 CAGTGTATGGATGTGTTTGGAGG + Intergenic
1177779743 21:25609114-25609136 CAGAGTAAGAAAATATTTGGGGG - Intergenic
952523062 3:34181664-34181686 CAGTCTGAGTCCATGTCTGGAGG + Intergenic
953704180 3:45218913-45218935 CAGTGTCAGCACAGGCTTGGAGG + Intergenic
954461671 3:50630330-50630352 CAGGGCCAGTACATGTTTGCAGG + Intronic
954583672 3:51717304-51717326 CTGTGTAAGTGCATGTATGTGGG - Intronic
954891609 3:53935516-53935538 CAGTGTGAGTAAATGTATGTAGG + Intergenic
960338014 3:116442205-116442227 CAGTGAAGGTAAATGTTTTGGGG + Intronic
965215803 3:165863174-165863196 CAGTGTCATTAGATATTTGGTGG - Intergenic
965644794 3:170869225-170869247 CAGTGAATGTACATGGTTGCTGG - Intronic
965691791 3:171365083-171365105 AGATGTAAGTATATGTTTGGAGG + Intronic
967550567 3:190789992-190790014 TAGTGTATGGACATCTTTGGGGG - Intergenic
970419879 4:15895958-15895980 GAGAGAGAGTACATGTTTGGTGG - Intergenic
970503493 4:16702928-16702950 CAGCGTAAGTACAGGTGAGGAGG - Intronic
972711584 4:41601554-41601576 ATGTGTAAGGACATGTGTGGTGG + Intronic
972717004 4:41656606-41656628 CAGTGGCAGTAGATATTTGGAGG + Intronic
980289243 4:130824476-130824498 CAGGCCAAGTACATGTGTGGGGG + Intergenic
983332896 4:166354185-166354207 CTGTGTAAGTACATGTAGGATGG + Intergenic
984869112 4:184311189-184311211 CAGTGGAAGAACATGATTCGTGG - Intergenic
986264136 5:6178366-6178388 CAGTGAATGTACATGTTGTGTGG - Intergenic
988099518 5:26659246-26659268 CAGGATAAGGACATCTTTGGAGG - Intergenic
990651240 5:57901888-57901910 TAGAGTAAGCTCATGTTTGGTGG + Intergenic
991217401 5:64171469-64171491 TATTGCAAGTACATGCTTGGTGG + Intronic
994265873 5:97715659-97715681 CTGTGTGTGTGCATGTTTGGTGG - Intergenic
996025999 5:118646611-118646633 CAGGGTAAGGACATATGTGGCGG - Intergenic
996307454 5:122065312-122065334 CAGTGCCAGAACATGTTAGGTGG - Exonic
997104100 5:130998670-130998692 CAGTATAAGTACATATGTGTTGG - Intergenic
1000432582 5:161167899-161167921 CAGTGTAAGACCCTGTCTGGGGG - Intergenic
1002056874 5:176603223-176603245 CTGTGTGTGTACATGTTTTGGGG - Intronic
1002064268 5:176644256-176644278 CAGTGTAAGCAAAGGCTTGGAGG + Intronic
1002155107 5:177271668-177271690 CAGTTTAAGCACATGGTTGGGGG + Intronic
1002720318 5:181256067-181256089 CAGTGAAAGTTCATGCTTGGTGG + Exonic
1005505246 6:26463782-26463804 CAGTGTAAGGACCTTATTGGGGG - Intronic
1006336400 6:33423186-33423208 CAGAGAAGGTACACGTTTGGGGG - Intronic
1009701111 6:67182661-67182683 CACTGTAAGGAGATTTTTGGGGG - Intergenic
1010946782 6:81984081-81984103 CAGAATATGTCCATGTTTGGTGG + Intergenic
1011128325 6:84030021-84030043 CAGTGCCACTGCATGTTTGGAGG + Intergenic
1011412671 6:87082209-87082231 CAGAGTAAGCACAGGTTTGAGGG - Intergenic
1015692049 6:135936454-135936476 AAGTGTGAGTACATATTTGTTGG + Intronic
1019540523 7:1549162-1549184 GAGTGTACATACATGTGTGGTGG + Intronic
1019902048 7:4028597-4028619 CAGTGAAAACACACGTTTGGAGG + Intronic
1020688527 7:11326103-11326125 CAGTGCAAGTACATGTTTCCAGG + Intergenic
1021199115 7:17707728-17707750 AAGTGTAAGTTCAAGTTTTGAGG + Intergenic
1022150587 7:27599826-27599848 AATTGTAAGTAAATGTTTGTTGG + Intronic
1022206269 7:28167041-28167063 CAGTGTTATAACATGTGTGGGGG + Intronic
1024340071 7:48248441-48248463 CAGTGTAAGTACATGTTTGGTGG + Exonic
1024632501 7:51261542-51261564 CAGTGTGATGACATGTTTGGTGG + Intronic
1025982553 7:66418716-66418738 CAGTGTCAGTAGAGGTTGGGTGG - Intronic
1031958699 7:127969127-127969149 CAGTGGAAGTAAATAGTTGGTGG + Intronic
1033760659 7:144433252-144433274 CAGTGTAAGAACAAGGTTTGAGG - Intergenic
1035588593 8:796181-796203 CAGTGTGAGCACAGCTTTGGGGG + Intergenic
1038680378 8:29661807-29661829 CAGGATGAGAACATGTTTGGGGG - Intergenic
1041386262 8:57307283-57307305 CAGAATAACTGCATGTTTGGTGG + Intergenic
1043986838 8:86703545-86703567 CAGTGTGAGTGCATGTTTATGGG + Intronic
1044268421 8:90210435-90210457 CAGTGCAAGTATATTTTGGGAGG + Intergenic
1045315017 8:101036137-101036159 CAGTGTAAATAAATGTTAAGAGG - Intergenic
1045634058 8:104162140-104162162 CAGTGCATGGACATCTTTGGGGG + Intronic
1045854353 8:106746666-106746688 CTCTGTAAGTAGGTGTTTGGAGG + Intronic
1048399666 8:134052698-134052720 CAATGGAAGTAAAAGTTTGGTGG + Intergenic
1049256432 8:141616517-141616539 GAGTGCACTTACATGTTTGGGGG + Intergenic
1049594513 8:143477229-143477251 CAGTGTAAGTACAAGCACGGCGG + Intronic
1059792517 9:117655532-117655554 CAGTGGAAATACTTGTTTGCAGG - Intergenic
1192367603 X:70487347-70487369 CAGTGTAAGCAAAGGTCTGGAGG - Intronic
1192892136 X:75401496-75401518 AAGTGTAATTACATGTGTGATGG - Intronic
1193385208 X:80862202-80862224 CAGTCTATGTACATGTTTTTAGG + Intergenic
1194690556 X:96979426-96979448 CAGTCTAAGTACATTTTAGTGGG - Intronic
1195670681 X:107467319-107467341 GAGTGCAAGCACATGTGTGGTGG + Intergenic
1198401076 X:136268931-136268953 CAGTGTAAGCAGATGTTTGGAGG - Intergenic
1198455083 X:136809153-136809175 CATTGGAAATACGTGTTTGGAGG + Intergenic
1200649643 Y:5826021-5826043 CAGTCTGAGTTCAGGTTTGGAGG - Intergenic