ID: 1024341295

View in Genome Browser
Species Human (GRCh38)
Location 7:48264340-48264362
Sequence CAGTTTGTGAATTTTGTAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2103
Summary {0: 1, 1: 0, 2: 3, 3: 57, 4: 2042}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024341295_1024341296 15 Left 1024341295 7:48264340-48264362 CCTTTTACAAAATTCACAAACTG 0: 1
1: 0
2: 3
3: 57
4: 2042
Right 1024341296 7:48264378-48264400 GTACCCTTTTACACTCCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024341295 Original CRISPR CAGTTTGTGAATTTTGTAAA AGG (reversed) Intronic
Too many off-targets to display for this crispr