ID: 1024342239

View in Genome Browser
Species Human (GRCh38)
Location 7:48278674-48278696
Sequence GTCCCAGACATTTCTAAGAG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 196}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024342239 Original CRISPR GTCCCAGACATTTCTAAGAG GGG (reversed) Exonic
900809801 1:4793341-4793363 ATCCCACCCAGTTCTAAGAGGGG - Intergenic
901885903 1:12222808-12222830 GTCCCAGCCATGGCTAAAAGGGG - Intergenic
903281808 1:22254537-22254559 GTCCCCTACTTTTCTAAAAGTGG - Intergenic
904631879 1:31848591-31848613 GTACCCGATATTTCTCAGAGTGG - Intergenic
905334840 1:37237522-37237544 GTCCCAGACATTGCCAAGTATGG - Intergenic
907132930 1:52112777-52112799 GTTCTACACACTTCTAAGAGCGG + Intergenic
909065591 1:70931673-70931695 GTTCCAGCCATTGCTAAAAGGGG - Intronic
909244952 1:73269699-73269721 CTCCCAGCCATTGCTAAAAGGGG + Intergenic
909810210 1:79924062-79924084 GTCCCAGCCATGACTAAAAGGGG + Intergenic
910480209 1:87650539-87650561 GTGCCAGACATTTCTGGCAGCGG + Intergenic
911122612 1:94311140-94311162 CTCCCAGACCTCTCCAAGAGAGG - Intergenic
912147343 1:106809680-106809702 GTCCCAGCCATGGCTAAAAGGGG - Intergenic
912190341 1:107331314-107331336 CTCCCAGAACATTCTAAGAGGGG - Intronic
912210106 1:107547804-107547826 GTCCCATATCTTTCTAAGATGGG + Intergenic
912565232 1:110582773-110582795 GTCCCAGACCTTTCTCAGCTTGG + Intergenic
916784154 1:168071721-168071743 GTCCCTGAGAATTTTAAGAGGGG - Intronic
919409716 1:197227997-197228019 GTCCCAGCCATTGCTAAAAGGGG - Intergenic
921282183 1:213578096-213578118 GTCCCAGCCATGGCTAAAAGGGG + Intergenic
921880484 1:220249757-220249779 GTCCCAGCCATGGCTAAAAGGGG + Intronic
923019786 1:230154461-230154483 CTCCCAGAAATTTCTCAGAAGGG - Intronic
923164526 1:231347087-231347109 GTCCCAGGCATTTCAGAGAAGGG - Intronic
923233051 1:232006931-232006953 GTCCCACACATGGCTAAAAGGGG + Intronic
924435119 1:244032664-244032686 GACTCAGACATTTCTAATAATGG - Intergenic
1064379805 10:14831194-14831216 GTCCCAGGCATTTCCAAGTTAGG - Intronic
1067510234 10:46888669-46888691 GTTCCAGGCATTTAGAAGAGAGG + Intergenic
1067652020 10:48163195-48163217 GTTCCAGGCATTTAGAAGAGAGG - Intronic
1071245055 10:83752956-83752978 GTCCCAGCCATGGCTAAAAGGGG - Intergenic
1077656518 11:4024367-4024389 GTCCTAGACAATTCAAAGATTGG + Intronic
1077994303 11:7439945-7439967 TTCCCTGACATTTCTAAGTTTGG - Intronic
1079339316 11:19598954-19598976 GACCCAGACATTTCAAATGGGGG - Intronic
1082699446 11:56409793-56409815 GTCCCAGCCATGGCTAAAAGGGG + Intergenic
1084200172 11:67551784-67551806 GCCCCAGTCATGTCTAAAAGGGG + Intergenic
1084971908 11:72776734-72776756 GTCCCAGAGACTAGTAAGAGTGG + Intronic
1085418373 11:76335041-76335063 GTCCCAGCCATGCCTAACAGGGG + Intergenic
1086669267 11:89527574-89527596 GTCCCAGATATGGCTAAAAGGGG + Intergenic
1086694895 11:89831851-89831873 ATCCAAGACATTTCTGAGGGAGG - Intergenic
1087730063 11:101768368-101768390 GTCCCAGCCATGACTAAAAGGGG - Intronic
1088282362 11:108148468-108148490 GTCACAAAAACTTCTAAGAGTGG + Intergenic
1090525348 11:127528636-127528658 GTCTCAGACATTTTCAATAGTGG - Intergenic
1095894554 12:47267350-47267372 GTCCCAGAAATTGCTAAGGAGGG + Intergenic
1099778669 12:87166137-87166159 GTCCCAGTCATGGCTAAAAGGGG - Intergenic
1100428855 12:94512402-94512424 GTGGCTGAGATTTCTAAGAGTGG - Intergenic
1101193061 12:102354659-102354681 GCTCCAGTCATGTCTAAGAGGGG - Intergenic
1104274008 12:127308334-127308356 CTCCATGGCATTTCTAAGAGGGG - Intergenic
1109097867 13:58141727-58141749 GTCCCAGCCATGGCTAAAAGAGG + Intergenic
1109576273 13:64263530-64263552 GTCCCAGCCATGACTAAAAGGGG + Intergenic
1109749556 13:66672108-66672130 GTCCCAGCCATGGCTAAAAGAGG + Intronic
1110577759 13:77079646-77079668 GTCCCAAATATTTCTAATAAAGG - Intronic
1111239645 13:85457597-85457619 GTCCCAGCCATGGCTAAAAGGGG + Intergenic
1111937269 13:94570127-94570149 GACACAGTCACTTCTAAGAGTGG + Intergenic
1112582688 13:100690262-100690284 GTCCCAGCCATGGCTAAAAGGGG + Intergenic
1112705136 13:102060193-102060215 GTCCCAGGCATTTCTGATAAGGG + Intronic
1112825060 13:103382485-103382507 GTCCCAGCCATGGCTAAAAGGGG - Intergenic
1112826613 13:103398868-103398890 GTCCCAGCCATGGCTAAAAGAGG - Intergenic
1114676508 14:24443825-24443847 CTCCCAGATTTATCTAAGAGGGG + Intergenic
1116245706 14:42408809-42408831 GTCTCAGATATTTCTATCAGTGG - Intergenic
1116789207 14:49321774-49321796 GTCCAAGACATTTTGAAAAGAGG + Intergenic
1124613003 15:31221944-31221966 CCCTCAGCCATTTCTAAGAGAGG + Intergenic
1125162542 15:36662811-36662833 GTCCCAGACATTTCAGATAAGGG - Intronic
1125816026 15:42585185-42585207 GTCCCAAGCATTTCAAAGAAGGG + Intronic
1128233062 15:66048822-66048844 GCCCCAGAAATTTCTACAAGGGG - Intronic
1134156344 16:11846510-11846532 GTCTTAAACATTTCTAAAAGTGG - Exonic
1134894743 16:17874714-17874736 CTCCCAGAAATTGCAAAGAGAGG - Intergenic
1138775458 16:59717913-59717935 GTCCCACACATTTCTGATAAAGG - Intronic
1148199355 17:45739809-45739831 TTTCCAGCCATTTCTAACAGAGG + Intergenic
1150461432 17:65356828-65356850 TTTCCAGACATTTCCAAGGGAGG + Intergenic
1153003256 18:475257-475279 TTTCCAAACATTTCTAAGTGAGG - Intronic
1155940334 18:31796094-31796116 GTCCCAGACTTTTGGGAGAGAGG + Intergenic
1157291670 18:46413987-46414009 ATAGCAAACATTTCTAAGAGAGG - Intronic
1160057081 18:75493111-75493133 ATACCAGAAATTTCCAAGAGAGG - Intergenic
1167820024 19:51919457-51919479 GTCCCAAGCATTTCTGATAGGGG + Intronic
1168397081 19:56057417-56057439 GTCCCAGACAGTGGTGAGAGCGG - Intronic
925947428 2:8878769-8878791 GTTCAAGACATTTTTAAAAGTGG - Intronic
929004322 2:37380907-37380929 TTCCCAGCCATTTTTGAGAGTGG - Intergenic
930430607 2:51270906-51270928 ATCCCAAACATTTTTAGGAGAGG - Intergenic
930536129 2:52648368-52648390 GTCCCAGCCATAACTAAAAGGGG - Intergenic
931252704 2:60548356-60548378 GTCTGACACATTTCTAAAAGTGG + Intronic
937142461 2:119613590-119613612 GTCCCAGCCATAACTAAAAGGGG - Intronic
937611574 2:123868117-123868139 ATCTCAGAAATTTCAAAGAGGGG - Intergenic
939965105 2:148602741-148602763 GTCCCAGACATTTCAGATAAGGG - Intergenic
942419952 2:175797324-175797346 GTCCCAGCCATGACTAAAAGGGG + Intergenic
944315024 2:198275421-198275443 TTTCCAGACTCTTCTAAGAGTGG + Intronic
946732268 2:222720939-222720961 GTCCCAGCCATGGCTAAAAGGGG - Intergenic
1170337114 20:15282074-15282096 GTCCCAGCCATGGCTAAAAGGGG - Intronic
1170735282 20:19008863-19008885 ACCCCAGACATTTCAAACAGAGG - Intergenic
1171380765 20:24732332-24732354 GGCCCAGACACTTCCAAGACAGG + Intergenic
1176874882 21:14117623-14117645 GCCCCAGTGAGTTCTAAGAGAGG + Intronic
1177242365 21:18475624-18475646 CTCCCAGTCATTTCAAAAAGAGG + Intronic
1178193922 21:30320402-30320424 TTCAAAGACAATTCTAAGAGAGG - Intergenic
1178634246 21:34288418-34288440 GCTCCAGCCATTTCTAAAAGGGG - Intergenic
1181505099 22:23349585-23349607 CTACCAGACATTTTTAAAAGAGG - Intergenic
1183045412 22:35215671-35215693 ATACCAGACATCTCTAGGAGTGG - Intergenic
1183349411 22:37326434-37326456 GTCAAAGGCATTTCTAAGATGGG - Intergenic
949920796 3:8998941-8998963 GTCCCAGACATCATTAATAGAGG + Intronic
950166910 3:10808066-10808088 GGCCCAAACATTTCTTAGAGAGG - Intergenic
951969659 3:28429760-28429782 GTCCCAGCCATGGCTAAAAGGGG + Intronic
953270734 3:41441253-41441275 TTCCCAAACTTTTCTAAAAGAGG + Intronic
954933369 3:54303915-54303937 GTCCCAGGCATCTCAAAGAGTGG - Intronic
959788378 3:110328861-110328883 GTCCCAGACATGGCTAGAAGTGG + Intergenic
959823205 3:110761556-110761578 GTCCCAGGCTTTTCTTGGAGGGG + Intergenic
961142189 3:124564964-124564986 GTGCTAGATATTTCTAGGAGAGG + Intronic
961451492 3:127004228-127004250 GGCCCAGACAATGCTCAGAGGGG - Intronic
963104131 3:141631047-141631069 CTCCCCTACATTTCTATGAGTGG + Intergenic
963437212 3:145287036-145287058 GTACCAGAAATATTTAAGAGGGG - Intergenic
963581779 3:147134878-147134900 GTCCCAGCCATGGCTAAAAGGGG + Intergenic
963581867 3:147135491-147135513 GTCCCAGCCATGGCTAAAAGGGG - Intergenic
963690622 3:148496804-148496826 TTCCCAGACATTTCTCAGAAAGG + Intergenic
963924435 3:150936621-150936643 TCACCAGACATTTCTTAGAGAGG + Intronic
964184173 3:153923041-153923063 GTACCAGATATTTCTAAGTATGG + Intergenic
964511238 3:157454426-157454448 GTACCAGACATTCCTAAGGTGGG - Intronic
967609130 3:191483145-191483167 GCCCCAGCCATTGCTAAAAGGGG + Intergenic
969521751 4:7682114-7682136 GACCCAAACATATCCAAGAGTGG - Intronic
972489541 4:39574127-39574149 GTCCCAAACAATTCCAAGTGTGG - Intronic
972692332 4:41411569-41411591 ATCCCAGCCATTTGTGAGAGAGG - Intronic
973247353 4:48023719-48023741 TTCCAAGACATTTATAATAGTGG + Intronic
973303167 4:48613005-48613027 GTCCCAAGCATTTCAAATAGGGG - Intronic
974305397 4:60131457-60131479 ATCCCAGTCATATCTAAGACAGG + Intergenic
976680786 4:87753656-87753678 GTCCCAGCCATGGCTAAAAGAGG - Intergenic
976870352 4:89785196-89785218 TCCCCAGAAATATCTAAGAGGGG - Intronic
977005035 4:91556909-91556931 GTCACAGCCATTTTTTAGAGAGG + Intronic
977093978 4:92715161-92715183 GTTCCACACATTTCTAGGACAGG + Intronic
977942916 4:102877870-102877892 GTCCCAGCCATGGCTAAAAGGGG - Intronic
978982040 4:114958561-114958583 GTCACAGCCATTGCTAAAAGGGG - Intronic
981829897 4:148987304-148987326 GGCCCACACATTTCTAAGGCTGG + Intergenic
982480623 4:155905263-155905285 TTCTCAAACATTTCTAACAGAGG - Intronic
982622343 4:157723973-157723995 GTCCCAGCCATGGCTAAAAGGGG + Intergenic
983348611 4:166559165-166559187 ATCCCAGTCATGTCTAAAAGGGG + Intergenic
983873184 4:172845406-172845428 GTCCAGTACATTTCTAAGTGCGG - Intronic
985607676 5:867095-867117 GTCCCAGCCATGGCTAAAAGGGG + Intronic
987610374 5:20195889-20195911 GTCCCATACATTTTTAAGAATGG - Intronic
988038792 5:25861400-25861422 ATCCCAGCCATGGCTAAGAGAGG - Intergenic
989801840 5:45552006-45552028 GTGGCAAAAATTTCTAAGAGTGG - Intronic
990188964 5:53236902-53236924 GTGCCAGACAGTTCAAAGCGTGG - Intergenic
990350287 5:54909099-54909121 GTCACTGACATTTTAAAGAGAGG - Intergenic
991188586 5:63840841-63840863 ATCCTAGAAATTTATAAGAGAGG + Intergenic
991949263 5:71932037-71932059 CTCCCAGGCATTTCCAAAAGTGG - Intergenic
993302891 5:86235165-86235187 GTCCCTGAAATTTCTATGAGAGG + Intergenic
994096817 5:95854643-95854665 GTGCCAGACAGTGTTAAGAGGGG + Intronic
995023334 5:107391382-107391404 GTCCCAGACATGTTTATCAGAGG + Intronic
995087914 5:108136728-108136750 ATCCCAGAAATTTCTGTGAGTGG + Intronic
999940335 5:156535512-156535534 GTCCCACACATTACAAAGACAGG - Intronic
1003720132 6:8692686-8692708 GTCCCAGTCATATTTAAAAGGGG + Intergenic
1003789760 6:9532549-9532571 GTCCCAGACATTGTTGAAAGGGG + Intergenic
1006115957 6:31776367-31776389 GTCCCGGACCTTTCTAAGGAGGG + Intronic
1011211201 6:84958471-84958493 GTCCCAGCCATGGCTAAAAGGGG + Intergenic
1013110772 6:107063197-107063219 GTGCCAGACACTGCTAAGAATGG - Intergenic
1015026518 6:128539522-128539544 GTACCAGACATTTCTATGTGTGG - Intergenic
1016437134 6:144048601-144048623 GTCCCAGCCATAGCTAAAAGGGG - Intronic
1016721532 6:147304257-147304279 GTCCCAGCCATGGCTAAAAGGGG + Intronic
1016926766 6:149358140-149358162 GTCCCAAGCATTTCTAATAAGGG - Intronic
1018516133 6:164581706-164581728 GTCCCAGTCATGGCTAAAAGGGG - Intergenic
1020691496 7:11360278-11360300 GTCCCAGACATTTCAGATAAGGG - Intergenic
1021479756 7:21103190-21103212 GTCCCAGACAATTCTCTAAGAGG - Intergenic
1021550817 7:21869248-21869270 GTTCCAGATATCTCTAAGTGAGG - Intronic
1021994112 7:26163166-26163188 ATCCCAGACATTTCTTAGCAAGG + Intronic
1022306411 7:29150701-29150723 GACCTAGACACTTCCAAGAGGGG - Intronic
1022352279 7:29577506-29577528 GTCCCAGGCATGGCTAAAAGGGG + Intergenic
1024342239 7:48278674-48278696 GTCCCAGACATTTCTAAGAGGGG - Exonic
1025167350 7:56724230-56724252 ATTCCAGACATTTCAAACAGTGG - Intergenic
1025957881 7:66196607-66196629 GTCCTAGACTTGCCTAAGAGGGG + Intergenic
1026333102 7:69370334-69370356 GACCCAGACATTTTTAACTGTGG - Intergenic
1028934034 7:96445665-96445687 GTCCTAGACTTTTCTAAGAATGG + Intergenic
1029167183 7:98600664-98600686 GACCCAGACACTTCTCACAGTGG - Intergenic
1029939473 7:104464678-104464700 ATCCCAGCCATGGCTAAGAGGGG - Intronic
1030784772 7:113645833-113645855 GTCCCAGCCATGGCTAAAAGGGG - Intergenic
1031608226 7:123794551-123794573 GCTCCAGCCATGTCTAAGAGGGG + Intergenic
1032646723 7:133833385-133833407 CTCCCAGATATTTCTTATAGAGG + Intronic
1032909448 7:136412992-136413014 GTCTCACACATTTCTATGTGTGG + Intergenic
1032925820 7:136603804-136603826 GTCCCAGCCATGTCTAAAATGGG + Intergenic
1034356077 7:150451503-150451525 TTCCCAGACATCTATGAGAGTGG + Intronic
1035139876 7:156749094-156749116 ATACCAGACATTTCTCAAAGTGG + Intronic
1037234443 8:16701477-16701499 GGACAAGACATTTCTAAGAAGGG - Intergenic
1039305909 8:36262492-36262514 GTGCTAGACATCTCTAAGACTGG - Intergenic
1039505620 8:38050300-38050322 TTCCCACACATTTCTGAGAAAGG - Intronic
1040375498 8:46820898-46820920 GTCCCAGACTCTGCCAAGAGAGG + Intergenic
1040835981 8:51731822-51731844 GTCCCAGCCATGGCTAAAAGGGG - Intronic
1044083591 8:87915705-87915727 GTCCCAGAATTTTCGATGAGGGG + Intergenic
1046552110 8:115730727-115730749 GTCCCAGCCATGGCTAAAAGGGG + Intronic
1048849807 8:138634316-138634338 GTCCCAGACCTTGCAAGGAGAGG - Intronic
1055133635 9:72804631-72804653 GTCATAGGCATTTCTAAAAGTGG + Intronic
1055719659 9:79157665-79157687 GTGCCAGACAGTGCTAGGAGTGG + Intergenic
1058478867 9:105370460-105370482 CTCACAGAAATTTCTCAGAGGGG + Intronic
1058940489 9:109808853-109808875 GTCCCAGCCATGGCTAAAAGAGG + Intronic
1060140394 9:121204526-121204548 GTCCCAGAATTTTCAAAGTGAGG + Intronic
1061877546 9:133552248-133552270 GTACCAGACATCTCTTTGAGAGG - Intronic
1061925736 9:133805258-133805280 GACCCAGACCCTTCCAAGAGTGG + Intronic
1062682441 9:137789023-137789045 GTCCAAGAAAGCTCTAAGAGTGG - Intronic
1186613135 X:11158274-11158296 TTCCCTGAGACTTCTAAGAGAGG + Intronic
1186768758 X:12796815-12796837 GTCCCAGGCATTTCTGATAAGGG - Intronic
1188115007 X:26232043-26232065 GTCCCAGCCATGGCTAAAAGGGG - Intergenic
1188162331 X:26819358-26819380 GTCCCAGCCATGGCTAAAAGGGG + Intergenic
1189277399 X:39797066-39797088 GTACCAGACCTTTCTGAGCGTGG - Intergenic
1189454209 X:41169824-41169846 GTCCCAGACATTTCATATAAGGG + Intronic
1189870359 X:45375496-45375518 GTCCCAGACATTTCTTTGCTGGG - Intergenic
1190132421 X:47761316-47761338 GTCCCAGAGGTTTTTAAAAGTGG + Intergenic
1191211477 X:57889515-57889537 GTCCCAGCCATGGCTAAAAGGGG - Intergenic
1196605665 X:117654621-117654643 GTCCCAGCCATGGCTAAAAGGGG - Intergenic
1196895771 X:120334159-120334181 GTTCCAGACATTTCTGATATTGG + Intergenic
1198090967 X:133329531-133329553 GTCCCAGACATCTATGAGGGTGG + Intronic
1198851872 X:140973543-140973565 GTCCCAGAAATGTCAATGAGAGG + Intergenic
1199025950 X:142938176-142938198 GTCTCAGAATTTTCTAAAAGGGG - Intergenic
1199147042 X:144380689-144380711 GTCCCAGCCATAGCTAAAAGGGG + Intergenic
1199200849 X:145087651-145087673 ATCCCAGTCATGGCTAAGAGGGG + Intergenic
1199930492 X:152514127-152514149 CTCCCAGAAATCTCTAAGAAAGG + Intergenic
1200016682 X:153169998-153170020 GTCCCAGCCATGGCTAAAAGCGG + Intergenic