ID: 1024342476

View in Genome Browser
Species Human (GRCh38)
Location 7:48281603-48281625
Sequence GTGGTGGGAATGAGGTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 756
Summary {0: 1, 1: 0, 2: 7, 3: 105, 4: 643}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024342476_1024342486 6 Left 1024342476 7:48281603-48281625 CCTCCCAACCTCATTCCCACCAC 0: 1
1: 0
2: 7
3: 105
4: 643
Right 1024342486 7:48281632-48281654 TCTACTCCAGCCAAATTGAACGG 0: 1
1: 0
2: 0
3: 11
4: 121
1024342476_1024342489 28 Left 1024342476 7:48281603-48281625 CCTCCCAACCTCATTCCCACCAC 0: 1
1: 0
2: 7
3: 105
4: 643
Right 1024342489 7:48281654-48281676 GCCCGTTCCTGCGCCTTTGCTGG No data
1024342476_1024342491 29 Left 1024342476 7:48281603-48281625 CCTCCCAACCTCATTCCCACCAC 0: 1
1: 0
2: 7
3: 105
4: 643
Right 1024342491 7:48281655-48281677 CCCGTTCCTGCGCCTTTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024342476 Original CRISPR GTGGTGGGAATGAGGTTGGG AGG (reversed) Intronic
900310117 1:2029434-2029456 GGGGTGGGCATGGGGGTGGGGGG + Intronic
900338286 1:2175539-2175561 GGGGTTGGAGTGGGGTTGGGTGG - Intronic
900507085 1:3035074-3035096 GAGGTGGGCATGGGGTTGGGAGG + Intergenic
900567243 1:3339557-3339579 GAGGTGGGAAGGAGCGTGGGAGG + Intronic
900762406 1:4481998-4482020 GTGGAGGGACAGAGGTGGGGTGG + Intergenic
901612215 1:10508083-10508105 GGGGAGGGAGTGGGGTTGGGGGG - Intronic
901853775 1:12031491-12031513 GGGGTAGGATTGAGGTGGGGAGG + Intronic
902550043 1:17213932-17213954 GCTGTGGGCATGAGGTTGGTGGG + Intronic
902768336 1:18631379-18631401 GAGGTGGGGTGGAGGTTGGGGGG - Exonic
902790590 1:18765260-18765282 GTGGTGGCAATGAGGTGGAGAGG + Intergenic
903023298 1:20409625-20409647 GTGGTGGGAGTGGGGTAGGGAGG + Intergenic
903024270 1:20416231-20416253 GTGGCAGGGATGAGGATGGGAGG + Intergenic
903662548 1:24987158-24987180 GTTGGTGGAATGGGGTTGGGGGG + Intergenic
903772000 1:25769959-25769981 GCGTGGGGAATGAGGTGGGGAGG + Intronic
904211637 1:28889711-28889733 GTGGTGGGAGTGAGGAGGGGAGG + Intronic
904358937 1:29960086-29960108 GTGGTTGGGATGAGGCTTGGAGG - Intergenic
904490680 1:30857154-30857176 GAGGTGGGGGTGAGGGTGGGAGG - Intergenic
904610183 1:31721528-31721550 GAGGTGGGAATGGGGTTGGGGGG - Intergenic
905241277 1:36583177-36583199 GTGGTGGGTAGGTGGGTGGGTGG - Intergenic
905395674 1:37664968-37664990 GTGATGGCAGTGAGGTTGGCAGG + Intergenic
905753443 1:40486481-40486503 GTGGTGGGAGGGAGGGAGGGAGG - Intronic
905868893 1:41391746-41391768 GAGGTGGGGCTGAGGTAGGGTGG + Intergenic
906471447 1:46133924-46133946 GGGGTGGGAATGAGTATGTGAGG - Intronic
906608283 1:47185877-47185899 GGGGTGGGCATGAGGTCAGGAGG - Intronic
907534423 1:55136764-55136786 GGGGTGGGAGTGAGGTAGTGGGG + Intronic
907775813 1:57513360-57513382 GTACTGTTAATGAGGTTGGGAGG - Intronic
908682398 1:66676800-66676822 GTGGTGTGAGTGTGGGTGGGAGG - Intronic
909531015 1:76681851-76681873 GTGGTCAGACTGAGGTCGGGTGG - Intergenic
910106645 1:83638461-83638483 GTGGTGGGAAGAAGGTGGGGAGG - Intergenic
910160500 1:84267344-84267366 TTGGTGGGGGTGAGGTTGGTGGG - Intergenic
910897932 1:92087307-92087329 ATGGGGGGAAGGAGGGTGGGAGG + Intronic
911178920 1:94843853-94843875 GAGGAGGGACTGAGGTGGGGCGG + Intronic
911196457 1:94999937-94999959 GGGCTGGGAATGTGGGTGGGAGG - Intronic
911479624 1:98421983-98422005 GTGATGGGAGTAAGGGTGGGAGG + Intergenic
912724965 1:112050795-112050817 GTGGAGGGAATGGGCTTGGCAGG + Intergenic
912827088 1:112915436-112915458 GTGGTAGAAATGAGGCTGGAAGG + Intronic
914800134 1:150955395-150955417 GTGGTTGGAATGACTTTGGAGGG - Intronic
915457774 1:156052113-156052135 GTGGAGGGACTGAAGCTGGGAGG - Intronic
915473494 1:156139151-156139173 GGGGTGGGCATGAGGTGAGGAGG - Exonic
915594568 1:156888725-156888747 GGAGTGGGAAGGAGGTTGTGAGG - Intergenic
915977448 1:160400525-160400547 GGGGAGGGGATGAGGGTGGGGGG - Intergenic
916413091 1:164566591-164566613 ATGGTGGTAATGGGGTTGGTGGG + Intronic
917508591 1:175650876-175650898 GGGGTAGTAATGAGGTGGGGAGG - Intronic
917508604 1:175650919-175650941 GGGGTAGTAATGAGGTGGGGAGG - Intronic
917508641 1:175651043-175651065 GGGGTAGTAATGAGGTGGGGAGG - Intronic
917508652 1:175651082-175651104 GGGGTAGTAATGAGGTGGGGGGG - Intronic
918447521 1:184630029-184630051 GTGGTGAGAAGGAGGGAGGGAGG + Intergenic
919643723 1:200070743-200070765 GTGGGGGGGATGGGGCTGGGGGG - Intronic
919756171 1:201067426-201067448 GTGATGGGAAGGAGGTGGAGAGG - Intronic
920046586 1:203136639-203136661 GTGGTGGGAGTGGGGATGGCAGG + Intronic
920868950 1:209777291-209777313 GTGTTGGGGTGGAGGTTGGGGGG - Intronic
921137483 1:212274527-212274549 GTGGTGGGTATGGGGTTTGGAGG + Intergenic
921372923 1:214443975-214443997 GTGGTGGGAGTGAGAGTGGGAGG + Intronic
921448800 1:215278448-215278470 GAGGTGGGAGTGAGGGTGAGTGG + Intergenic
921581924 1:216905326-216905348 GAGGTGGGAATGAGCTGGGGTGG - Intronic
922361795 1:224829350-224829372 GTGATGGGAATGAGGTCAAGTGG + Intergenic
923758261 1:236814158-236814180 GTGTTAAGAATGAGGTAGGGTGG - Intronic
1063615096 10:7593811-7593833 CAGGGGTGAATGAGGTTGGGTGG - Intronic
1065107311 10:22403279-22403301 GTTGTGGGATGGGGGTTGGGGGG - Intronic
1065685739 10:28282813-28282835 GTTGTGGGGGTCAGGTTGGGAGG - Intronic
1065723779 10:28650860-28650882 GTGCTAGGAAAGAGGATGGGGGG - Intergenic
1065810912 10:29442794-29442816 GAGGTGGGGGTGAGGTGGGGTGG + Intergenic
1065828011 10:29589355-29589377 GTGGTGGGAATCTGGAGGGGAGG + Intronic
1065971573 10:30810051-30810073 GTGGTGGGCAGGGGGTTGGTGGG + Intergenic
1066227941 10:33402904-33402926 GTGGTGGTAATGGGGTGGGAGGG + Intergenic
1067152727 10:43749755-43749777 TGTGTGGGAATGAGGATGGGAGG + Intergenic
1067175537 10:43943342-43943364 GTGGGGGGCATGAGGGTGGCTGG + Intergenic
1067356590 10:45534180-45534202 TTGGTGGGGGGGAGGTTGGGGGG - Intronic
1067477384 10:46575992-46576014 GTGGGGGGGATGAGAATGGGAGG + Intergenic
1067617356 10:47765792-47765814 GTGGGGGGGATGAGAATGGGAGG - Intergenic
1068571648 10:58636435-58636457 GTGTTGGGGAGGAGGTGGGGAGG - Intronic
1069515508 10:69073780-69073802 GTGGTGGGTGGGGGGTTGGGGGG + Intergenic
1069779541 10:70946040-70946062 GTGGAGGGGATGGGGTTGCGGGG + Intergenic
1069821156 10:71229556-71229578 GTGATGGGAAGGAGGGTGGATGG - Intronic
1070078229 10:73159146-73159168 CTGTTGGGAAAGAGGTTGAGTGG + Intronic
1070226786 10:74516194-74516216 GTGGTGGCAAAGAGGCTGGTAGG + Intronic
1070712938 10:78696685-78696707 GGGGTGGGAAGGGGGTGGGGTGG + Intergenic
1070815454 10:79319907-79319929 GTGCTGGGAATGGGTCTGGGAGG + Intergenic
1070826065 10:79391281-79391303 GTGCTGGGACTGAGCTTGGCAGG + Intronic
1071014975 10:80986417-80986439 TTGGTGGGAATGGGGTGAGGAGG - Intergenic
1071447192 10:85759405-85759427 GTGGTGGGGATCAGCTTGAGTGG - Intronic
1071745054 10:88407988-88408010 CTACTGGGAATGAGGGTGGGAGG - Intronic
1071982890 10:91021771-91021793 GTGGTAGGAATGTGGTTGGCAGG + Intergenic
1072450659 10:95537099-95537121 CTGGTGGGGATGGGGATGGGTGG - Intronic
1073943912 10:108729768-108729790 GTGGAGGGAGTGAGGTGGAGGGG + Intergenic
1074066834 10:110023091-110023113 GTGTTGGCAAAGAGGTTAGGAGG + Intronic
1074159390 10:110824570-110824592 GTGTTGGGAATGAAGTGGGGAGG + Intronic
1074236505 10:111589781-111589803 GTGGTGGGAAGGTGGGAGGGGGG + Intergenic
1074425670 10:113349087-113349109 GTGGTAGAAATGAGGGTAGGAGG + Intergenic
1074959943 10:118434474-118434496 GTGGTGGGGATGGGGGAGGGGGG + Intergenic
1075081937 10:119390122-119390144 CTGGTGGGGGTGAGGATGGGTGG + Intronic
1075741488 10:124698942-124698964 GTGGTGTGAGTGAGGAGGGGAGG - Intronic
1075989763 10:126825722-126825744 GTGGTGGCAAGGAGGGTTGGTGG - Intergenic
1076118799 10:127920100-127920122 GTGGCTAGAATGATGTTGGGTGG + Intronic
1076438484 10:130462889-130462911 GTGGTGGGGGTGGGGTGGGGTGG + Intergenic
1076934060 10:133555750-133555772 GTGGAGGGGAAGAGGGTGGGAGG - Intronic
1076934540 10:133558682-133558704 GAGGTGGGAATGAGGTTGGAGGG + Intronic
1077416983 11:2428584-2428606 GTGGTGGGCATGAGGGTAGTTGG + Intergenic
1077556987 11:3230627-3230649 GGGGTGGGCATGGGGGTGGGGGG + Intronic
1077955761 11:7018982-7019004 GAGGTGGCAATGAGGATGGATGG - Intronic
1078221911 11:9358495-9358517 GTGGTGGGAATATGGGTGGTTGG - Intergenic
1078591012 11:12640967-12640989 GTGGGGGGGATGTGGTGGGGGGG - Intergenic
1078591019 11:12640981-12641003 GTGGGGGGGATGTGGTGGGGGGG - Intergenic
1078591026 11:12640995-12641017 GTGGGGGGGATGTGGTGGGGGGG - Intergenic
1079078762 11:17399360-17399382 GTGGCAGGAATTAGGTTGGCAGG - Intronic
1080426057 11:32155167-32155189 GGGGTGGCAGTGGGGTTGGGAGG + Intergenic
1080659534 11:34284865-34284887 GGGGTGTTAATGAGGCTGGGTGG + Intronic
1081345347 11:41979072-41979094 GTGATTGGAATGAGTTAGGGTGG - Intergenic
1081660741 11:44886667-44886689 GACGTGGGAATAAGGTTGTGGGG + Intronic
1082804340 11:57438043-57438065 GGGGTGGCAATGGAGTTGGGGGG - Intergenic
1083044867 11:59725139-59725161 GGGGTGGGGTGGAGGTTGGGAGG + Intronic
1083060675 11:59867543-59867565 GTGGTGGGAAGGAGATGCGGAGG + Intergenic
1083200421 11:61118135-61118157 GTGGTGGGGGTCAGGCTGGGAGG - Intronic
1083270920 11:61572100-61572122 GAGGGAGGAATGAGGTTGGGGGG + Intronic
1083911448 11:65712441-65712463 GTGGCGTGAGTGACGTTGGGGGG + Exonic
1084180927 11:67445481-67445503 GGGGTGGGAAGGAAGGTGGGTGG - Intergenic
1084316882 11:68350648-68350670 GTAGTGGGAATGAGGGTGTGGGG + Intronic
1084719198 11:70893324-70893346 GTGCTGGGTATGTGGTGGGGAGG - Intronic
1086108141 11:83169186-83169208 GGGGTTGGAATGAGGTTTGAGGG + Exonic
1086342132 11:85857485-85857507 TTGGTGTGGATGAGGTTGGTGGG - Intronic
1086460153 11:86997976-86997998 GGGGTGGGAATGGAGGTGGGGGG + Intergenic
1086526041 11:87727027-87727049 GGGGCGGGAATGAGGGTGGAAGG - Intergenic
1086595539 11:88566791-88566813 GTAGGGGGAGTGAGGTTGAGAGG - Intronic
1087097192 11:94330663-94330685 GTGGTGGGACTGGGGAGGGGTGG - Intergenic
1087189143 11:95233827-95233849 ATGATGGGAATGAGGGTGTGAGG - Intergenic
1087221771 11:95553889-95553911 GTGGTGTGAATGGGGTGGGGTGG - Intergenic
1088159803 11:106855266-106855288 GTGGTGGGAAAGTGGATGGCTGG + Intronic
1088472221 11:110198686-110198708 GGGCTGGGAGTGGGGTTGGGGGG - Intronic
1088907100 11:114163198-114163220 GGGGTGGGGGTGGGGTTGGGGGG - Intronic
1090198322 11:124836409-124836431 GTGGTAGGAATTAAGTTGGTAGG + Intergenic
1091194130 11:133717629-133717651 GGGGTAGGAATGAGGTGGGCAGG + Intergenic
1091797307 12:3304606-3304628 GGTGTGGGAATGGGGCTGGGTGG + Intergenic
1091818933 12:3459900-3459922 GTGCTGAGAATGAGGTTGAGAGG + Intronic
1092031759 12:5292388-5292410 GAGGTGGGAGTGATGTGGGGAGG - Intergenic
1092555091 12:9550602-9550624 GTGATGGAAATGAGGGTGGAGGG + Intergenic
1092822533 12:12365942-12365964 GTGGTGGGTATGAGGTTGTTTGG + Intronic
1092847352 12:12596082-12596104 GTGGAGAGAATGAGTTAGGGTGG + Intergenic
1092847357 12:12596123-12596145 GTGGAGAGAATGAGTTAGGGTGG + Intergenic
1093572100 12:20678175-20678197 ATGGTGGGAATGTGGATGGCTGG + Intronic
1093977440 12:25438592-25438614 TGGGTGGGAATGAGGGAGGGTGG - Intronic
1094350640 12:29521114-29521136 GAGGTGGCAATGTGGTTGGGAGG + Intronic
1094517005 12:31140072-31140094 GTGATGGAAATGAGGGTGGAGGG - Intergenic
1095493904 12:42764466-42764488 GTGGTGAGGATGAGGGTTGGAGG + Intergenic
1096037513 12:48485716-48485738 GGGGTGGGAATGGGGATGGAAGG - Intronic
1096510252 12:52123834-52123856 GTGGTGGGAGAGGGGCTGGGAGG + Intergenic
1096693142 12:53333313-53333335 GTGGTGGGGTGGAGGTCGGGAGG - Intronic
1096712083 12:53464989-53465011 CTGGGTGAAATGAGGTTGGGGGG - Intronic
1096749253 12:53748301-53748323 GTGTTGGGGATGGAGTTGGGGGG - Intergenic
1096779231 12:53982741-53982763 GGGCTTGGAAAGAGGTTGGGTGG + Intergenic
1096794010 12:54062661-54062683 GTGGGGGGAAAGAGGATGTGAGG - Intergenic
1096836564 12:54354977-54354999 GAGGTGGGACTGAGGTAGGAGGG + Intergenic
1097054360 12:56240965-56240987 GTGCTGGGAATTAGGTGGTGGGG - Exonic
1097757145 12:63419217-63419239 GTAATGGGAATGAGTTAGGGTGG - Intergenic
1098416650 12:70242933-70242955 GTGGCGGGAGTGAGGAGGGGAGG + Intergenic
1100013885 12:89985438-89985460 ATGGTGGGAAAGAGGTATGGAGG - Intergenic
1100294530 12:93248517-93248539 GTGAAAGGAATGAGGATGGGAGG + Intergenic
1101193226 12:102356230-102356252 GGGGTGGGAATGAGGTTTCTGGG - Intergenic
1101498245 12:105276578-105276600 GATGTGGAAATGAGTTTGGGAGG - Intronic
1101727387 12:107399389-107399411 ATGGAGGGAATGGGTTTGGGGGG - Intronic
1102513235 12:113429437-113429459 GAGGGGGGAATGAGGTGGGATGG + Intronic
1102660614 12:114524322-114524344 GGGGTGGGATTGAAGTTGAGAGG - Intergenic
1103039456 12:117682883-117682905 GTGGAGGTCATGAGGTTGGAGGG + Intronic
1103856427 12:123973432-123973454 GGGGTGGGAAGGAGGTGGAGTGG + Exonic
1104051337 12:125195832-125195854 GAGGTGGGAATGTGCTTGGCAGG + Intronic
1104475405 12:129066846-129066868 GTGGTGGGCGTGAGGGTGGGTGG + Intergenic
1104747609 12:131219915-131219937 ATGGTGGGACTGAGGCTGGTGGG - Intergenic
1104753394 12:131254117-131254139 ATGGTGGGGAGCAGGTTGGGAGG - Intergenic
1104926508 12:132316731-132316753 GTGATGGGAAGGAGGCTGGGTGG - Intronic
1105205464 13:18219656-18219678 CTTGTGGGAATGAGGATGTGGGG + Intergenic
1105970178 13:25421991-25422013 CTGGTGGGACTGAGGTAGGGAGG - Intronic
1106027928 13:25973046-25973068 TTGGTGGGAGTGGGGTGGGGTGG + Intronic
1106100847 13:26694408-26694430 CTTGTGGGAATGAGCCTGGGAGG - Intergenic
1106231782 13:27826244-27826266 TTTGTGGGATTGGGGTTGGGTGG + Intergenic
1106506655 13:30376350-30376372 GTGGAGGGAAGGGGGTTAGGGGG + Intergenic
1107149080 13:37091161-37091183 GAGGTGGGAAGGCGGTGGGGAGG + Intergenic
1107428787 13:40319866-40319888 GTGCTGGGAATGGGGAGGGGTGG + Intergenic
1107541530 13:41393727-41393749 GTGATCGGAATGAGTTAGGGTGG - Intergenic
1108066124 13:46579035-46579057 GTGGTGGGAGTGAAGTAGAGGGG + Intronic
1108492381 13:50994247-50994269 GTGGTGGGAAGGAGAAAGGGAGG - Intergenic
1111838148 13:93414629-93414651 CTGGTGGGAATGAGTATGTGTGG + Intronic
1112004950 13:95245881-95245903 TTGTTGGGAATGAGGTGGGTGGG - Intronic
1112538883 13:100286470-100286492 GTGATCGGAATGAGTTAGGGTGG + Intronic
1112752669 13:102597567-102597589 GTGGAGGGAAGGAGCCTGGGGGG - Intronic
1113481731 13:110626373-110626395 GTGGTGGAAACGGGCTTGGGTGG + Intronic
1114507122 14:23225659-23225681 GTAGTGGGGATGGGGTGGGGAGG + Intronic
1114537511 14:23432355-23432377 GAGATGGGCACGAGGTTGGGGGG + Intronic
1115363255 14:32527531-32527553 GTAGTGGGAATGCAGTTTGGTGG - Intronic
1116897503 14:50331502-50331524 GTGTTGTGTATGAGGCTGGGAGG - Exonic
1116897852 14:50334741-50334763 GTTTTGGGCAGGAGGTTGGGTGG - Exonic
1116982693 14:51188470-51188492 TAGATGGGAATTAGGTTGGGGGG - Intergenic
1117006380 14:51425199-51425221 GGGCAGGGAATGAGATTGGGTGG - Intergenic
1117076153 14:52106747-52106769 GTGGTGGGCAGGAGGTAGTGGGG + Intergenic
1117428760 14:55630251-55630273 TAGGTGGGGATGAGGTAGGGAGG + Intronic
1117547575 14:56805712-56805734 GGGGTGGGGATGGGGGTGGGGGG - Intronic
1118592785 14:67413637-67413659 CAGGTGGGAGTGGGGTTGGGGGG - Intergenic
1119416900 14:74477021-74477043 GTGTTGGGAATGGGGCTGGGGGG - Intronic
1119416912 14:74477100-74477122 GTGTTGGGAATGGGGCTGGGGGG - Intronic
1119531000 14:75361325-75361347 GTGGTAGGGATGGGGTTGGTCGG + Intergenic
1120259728 14:82167267-82167289 ATGGTGGGAGTGAGGATTGGAGG + Intergenic
1120467416 14:84877344-84877366 TTGCAGGGAATGAGGGTGGGTGG + Intergenic
1120732785 14:88021740-88021762 ATGGTGGGAATGAGGTTTTCAGG + Intergenic
1120827351 14:88967976-88967998 TTGCTGGGTATGAGGGTGGGGGG - Intergenic
1120969872 14:90198378-90198400 GGGGTGGGAGTGGGGTCGGGAGG - Intergenic
1121295156 14:92814531-92814553 GATGGGGGAATGAGGTTGGGAGG + Intronic
1121326809 14:93024916-93024938 GTGCAGGGATTGAGGCTGGGGGG + Intronic
1121605458 14:95236874-95236896 GTTGTGGGAATGGTGTGGGGAGG + Intronic
1121738313 14:96234282-96234304 GAGGGGGGAAGGAGGTAGGGAGG - Intronic
1121818598 14:96947078-96947100 GAGGTGGGAAAGAGCTTGGCAGG + Intergenic
1122202044 14:100128592-100128614 GAGGTGGGACTGGGGGTGGGGGG - Exonic
1122466682 14:101938534-101938556 GGGGCGGGAAGGAGGTTGGTGGG - Intergenic
1122690818 14:103531484-103531506 GGGCTGGGAGTGAGGTTGGAGGG + Intronic
1123665875 15:22609162-22609184 GTAGTGGGAATGTGCCTGGGCGG - Intergenic
1123998108 15:25733156-25733178 GTGGTGTGAAGGAGGTTACGGGG + Intronic
1124000684 15:25757825-25757847 GTGGTCGGAATGAGTTAGGGTGG - Intronic
1124000690 15:25757853-25757875 GTGGTCGGAATGAGTTAGGGTGG - Intronic
1124000696 15:25757881-25757903 GTGATAGGAATGAGTTAGGGTGG - Intronic
1124000701 15:25757909-25757931 GTGGTCGGAATGAGTTAGGGTGG - Intronic
1124000707 15:25757937-25757959 GTGGTCGGAATGAGTTAGGGTGG - Intronic
1124000713 15:25757965-25757987 GTGATCGGAATGAGTTAGGGTGG - Intronic
1124000718 15:25757993-25758015 GTGATAGGAATGAGTTAGGGTGG - Intronic
1124000723 15:25758021-25758043 GTGATCGGAATGAGTTAGGGTGG - Intronic
1124000728 15:25758049-25758071 GTGGTCGGAATGAGTTAGGGTGG - Intronic
1124000734 15:25758077-25758099 GTGGTCGGAATGAGTTAGGGTGG - Intronic
1124000740 15:25758105-25758127 GTGGTCGGAATGAGTTAGGGTGG - Intronic
1124000746 15:25758133-25758155 GTGATAGGAATGAGTTAGGGTGG - Intronic
1124000751 15:25758161-25758183 GTGGTCGGAATGAGTTAGGGTGG - Intronic
1124000757 15:25758189-25758211 GTGGTCGGAATGAGTTAGGGTGG - Intronic
1124000763 15:25758217-25758239 GTGGTCGGAATGAGTTAGGGTGG - Intronic
1124000769 15:25758245-25758267 GTGGTCGGAATGAGTTAGGGTGG - Intronic
1124000775 15:25758273-25758295 GTGGTCGGAATGAGTTAGGGTGG - Intronic
1124000781 15:25758301-25758323 GTGGTCGGAATGAGTTAGGGTGG - Intronic
1124000787 15:25758329-25758351 GTGGTCGGAATGAGTTAGGGTGG - Intronic
1124000793 15:25758357-25758379 GTGATTGGAATGAGTTAGGGTGG - Intronic
1124000798 15:25758385-25758407 GTGGTCGGAATGAGTTAGGGTGG - Intronic
1124000804 15:25758413-25758435 GTGATCGGAATGAGTTAGGGTGG - Intronic
1124000809 15:25758441-25758463 GTGATAGGAATGAGTTAGGGTGG - Intronic
1124000814 15:25758469-25758491 GTGGTCGGAATGAGTTAGGGTGG - Intronic
1124000820 15:25758497-25758519 GTGATAGGAATGAGTTAGGGTGG - Intronic
1124000825 15:25758525-25758547 GTGGTCGGAATGAGTTAGGGTGG - Intronic
1124000831 15:25758553-25758575 GTGGTCGGAATGAGTTAGGGTGG - Intronic
1124000837 15:25758581-25758603 GTGATCGGAATGAGTTAGGGTGG - Intronic
1124000842 15:25758609-25758631 GTGGTCGGAATGAGTTAGGGTGG - Intronic
1124000848 15:25758637-25758659 GTGGTCGGAATGAGTTAGGGTGG - Intronic
1124000854 15:25758665-25758687 GTGGTCGGAATGAGTTAGGGTGG - Intronic
1124000860 15:25758693-25758715 GTGATCGGAATGAGTTAGGGTGG - Intronic
1124000871 15:25758745-25758767 GTGATCGGAATGAGTTAGGGTGG - Intronic
1124000876 15:25758773-25758795 GTGGTCGGAATGAGTTAGGGTGG - Intronic
1124000882 15:25758801-25758823 GTGGTCGGAATGAGTTAGGGTGG - Intronic
1124000888 15:25758829-25758851 GTGATCGGAATGAGTTAGGGTGG - Intronic
1124055116 15:26235126-26235148 GTGGTGGGAGGGAGGCGGGGTGG - Intergenic
1124141342 15:27079923-27079945 GAGCTGGGAGTGATGTTGGGAGG - Intronic
1124427348 15:29572823-29572845 TTGGTGGGGGTGGGGTTGGGGGG - Intergenic
1125217670 15:37295263-37295285 GTGGTGGGAATGAAGAGGAGAGG + Intergenic
1125463977 15:39933376-39933398 GTGGGAGGAAGGAGGGTGGGGGG + Intergenic
1126178485 15:45761702-45761724 GAGGAGGGAATCAGGTTTGGTGG - Intergenic
1127308861 15:57733562-57733584 GTGGTGGGGAAGGGGGTGGGAGG + Intronic
1127381639 15:58435473-58435495 GGGGTGGGAGTGGGGTGGGGAGG + Intronic
1127533849 15:59871253-59871275 TTGGTGTGTATGTGGTTGGGGGG + Intergenic
1128306314 15:66601210-66601232 TTGGTGGGGATGGGGTTGGGTGG - Intronic
1128319238 15:66681289-66681311 GGGGTGGGAGTGAGGTAGGGTGG + Intronic
1128326315 15:66726216-66726238 ATGTTGGGAATGAGGCTTGGGGG + Intronic
1129244694 15:74272160-74272182 GTGGTGGGTGTGAGGCAGGGAGG - Intronic
1129295237 15:74596505-74596527 GTGGGGAGCATGAGGTTTGGCGG - Exonic
1129377185 15:75141215-75141237 TTGGTGGGTAAGAGCTTGGGAGG - Intergenic
1129378754 15:75152422-75152444 GTGGGGGGGCAGAGGTTGGGGGG + Intergenic
1129851518 15:78796542-78796564 GTGGCGGGGATGGTGTTGGGGGG - Intronic
1130912898 15:88283176-88283198 GAGGATGGAATGAGGTTTGGGGG - Intergenic
1131085839 15:89575300-89575322 GTGGAGGGAGTGACGGTGGGCGG - Intergenic
1131279588 15:91009707-91009729 GTGGTGGGGGTGGGGTGGGGGGG + Intronic
1131832746 15:96364647-96364669 GTGGTGGGGGTGGGGTGGGGTGG + Intergenic
1132478101 16:152697-152719 CTGGTGGGACTGGGGTTTGGGGG - Exonic
1132652797 16:1029116-1029138 GTGGTGAGCAAGAGGATGGGTGG - Intergenic
1132939437 16:2499623-2499645 GGGCTGGCAATGAGGGTGGGCGG - Intronic
1132988328 16:2779594-2779616 GTGGTGGGAATGGGGTCAGGAGG + Intergenic
1133396123 16:5448966-5448988 GTGGTGGGAAGGAGGACGGTGGG - Intergenic
1134914564 16:18059098-18059120 GTGGTGGGTTTTAGGTTGTGGGG + Intergenic
1135664914 16:24327509-24327531 ATGGGGGGGCTGAGGTTGGGGGG + Intronic
1136091704 16:27925386-27925408 GTGGTGGGAGGGAGGAGGGGTGG + Intronic
1137253552 16:46757581-46757603 GCGCTGGGAATGAGGTGGGCTGG + Intronic
1137535596 16:49321998-49322020 ATGGGGGGAGTGAGGTTAGGTGG + Intergenic
1138117842 16:54374445-54374467 GTGGTGGGAATGGGGGCTGGGGG + Intergenic
1138554620 16:57764256-57764278 GTGGTGGGAGGGAGGCTGGTGGG + Intronic
1139581657 16:67877427-67877449 GTGGTGGGACTGAAGAAGGGTGG + Intronic
1139715824 16:68812240-68812262 GTGGTGGGATTGAAGATCGGAGG - Exonic
1140635399 16:76907208-76907230 GTCCTGGGATTGAGGTTGAGAGG - Intergenic
1140732726 16:77871229-77871251 GTGGTGGGGTGGAGGGTGGGAGG - Intronic
1140877482 16:79166236-79166258 GTGAGGGGAATGAGGTGGGGAGG - Intronic
1141028322 16:80568404-80568426 GAGGTGGGGATGTGGTTGAGTGG - Intergenic
1141028344 16:80568472-80568494 GAGGTGGGAGTGTGGTTGAGTGG - Intergenic
1141028391 16:80568608-80568630 GTGGTGGGGATGTGGCTGAGTGG - Intergenic
1141028450 16:80568778-80568800 GAGGTGGGAGTGTGGTTGAGTGG - Intergenic
1141028749 16:80570585-80570607 GTGGTGGGAGTGGGGTTGAGTGG - Intergenic
1141028762 16:80570619-80570641 GTGGTGGGGGTGAGGTTGAGCGG - Intergenic
1141028798 16:80570719-80570741 GTGGTGGGGGTGGGGTTGAGTGG - Intergenic
1141028812 16:80570752-80570774 GTGGTGGGGGTGGGGTTGAGTGG - Intergenic
1141028826 16:80570786-80570808 GTGGTGGGGGTGGGGTTGAGTGG - Intergenic
1141181181 16:81754261-81754283 GGGGAGGGAATGAGATGGGGAGG - Intronic
1141181223 16:81754362-81754384 GGGGTGGGGAGGAGGTGGGGAGG - Intronic
1141181245 16:81754404-81754426 GGGGTGGGGAGGAGGTGGGGAGG - Intronic
1141181256 16:81754425-81754447 GAGGTGGGGAGGAGGTGGGGAGG - Intronic
1141181261 16:81754436-81754458 GTGGTGGGGAGGAGGTGGGGAGG - Intronic
1141181267 16:81754450-81754472 GGGGTGGAAATGAGGTGGTGGGG - Intronic
1141828500 16:86497007-86497029 GTGGGGGGAACGAGGTGAGGGGG + Intergenic
1142024403 16:87804750-87804772 GTGGTGGGAACGTGGTGGGGAGG - Intergenic
1142262752 16:89050425-89050447 GTGGGGGGTGAGAGGTTGGGGGG + Intergenic
1142521940 17:510970-510992 GGTGTGGGTATGAGGTTGTGGGG + Exonic
1143158344 17:4853006-4853028 GTGGGGGGAGTGTGGTTGGTGGG + Intronic
1143158384 17:4853122-4853144 GTGGGGGGAGTGTGGTTGGTGGG + Intronic
1143158408 17:4853190-4853212 GTGGGGGGAGTGTGGTTGGTGGG + Intronic
1143158429 17:4853261-4853283 GTGGGGGGAATGTGGTTGGTAGG + Intronic
1143158483 17:4853442-4853464 GTGGGGGGAGTGTGGTTGGTGGG + Intronic
1143622845 17:8090946-8090968 GGGGAGGGAAAGGGGTTGGGTGG + Intergenic
1143648516 17:8248081-8248103 GGGGTGGGGATGGGGGTGGGGGG + Intronic
1144267456 17:13585065-13585087 ATGCTGGTAATGAGGATGGGAGG - Intronic
1144426107 17:15143857-15143879 GTGGAGGGAATCATGGTGGGTGG + Intergenic
1144484734 17:15655365-15655387 AGGGTGGGAATGAGATAGGGAGG - Intronic
1144572415 17:16407923-16407945 GGGGTGGGAGGCAGGTTGGGGGG + Intergenic
1144575980 17:16429746-16429768 GTGGAGGTGAGGAGGTTGGGAGG + Intronic
1144921203 17:18766067-18766089 GTAGTGGGGATGAGAGTGGGTGG - Intronic
1145103157 17:20093583-20093605 GTGGTGGGAAGTGGATTGGGAGG + Intronic
1146456719 17:33014648-33014670 GTGGTGGGTGGGAGGCTGGGAGG + Intronic
1146693524 17:34892710-34892732 GAGGTGGGAGTGGGGTGGGGAGG - Intergenic
1146808479 17:35884559-35884581 GTGGTGGGACAGAGGTTGGGTGG + Intergenic
1147327181 17:39675084-39675106 GGGGCGGGAATGAGGTGGGTGGG + Intronic
1147446415 17:40477782-40477804 CTGGTGGGAATGGGGTGGTGGGG + Intronic
1147772546 17:42877897-42877919 GGGGTGGGAGTAAGGTGGGGAGG + Intergenic
1148326023 17:46783956-46783978 GTGCTGGGAAAGCGGCTGGGAGG + Intronic
1148681693 17:49477767-49477789 GTTGTGGGGATGGGGGTGGGGGG + Intergenic
1148874308 17:50677627-50677649 GTGGTGGGAGTGAGGCTGGCTGG + Intronic
1148890798 17:50805824-50805846 GTGGGGGGAATGACATGGGGTGG + Intergenic
1149435224 17:56628275-56628297 GTGGCTGGAATGAGATGGGGAGG + Intergenic
1149666800 17:58370663-58370685 GTGATGGGAAGGAGGTGGGATGG + Intronic
1151181014 17:72328733-72328755 TGGGTGGGGATAAGGTTGGGAGG - Intergenic
1151632172 17:75318511-75318533 GTCGTGGGAAGGGGTTTGGGTGG + Exonic
1151655556 17:75494288-75494310 CTGGTGGGAATGGGGTGGCGTGG - Intronic
1152999859 18:444629-444651 GAGGTGGGGGTGAGGTAGGGAGG + Intronic
1153016758 18:589637-589659 GTGGTGGTAATGTGGGAGGGTGG + Intergenic
1153045030 18:848154-848176 GTGGTGGAAATGAGGTAGAAGGG - Intergenic
1154002514 18:10494517-10494539 GTGTGGGGAAGGAGGATGGGAGG - Intergenic
1156637007 18:39043600-39043622 GAGGTGGGAAAGAGGGAGGGAGG + Intergenic
1157300198 18:46473556-46473578 AAGCTGGGAATGGGGTTGGGAGG + Intergenic
1158118583 18:54024183-54024205 GAGGTGGGGACGGGGTTGGGGGG + Intergenic
1158915791 18:62127747-62127769 GTGGTGTGACTGAGGTTCGCTGG + Intronic
1160984167 19:1830035-1830057 TTGGTGGCATTGAGGTTGTGAGG - Intronic
1161001683 19:1914018-1914040 GGGGTGGGACTGAGGTGGGCTGG + Intronic
1161618734 19:5287135-5287157 GAGGTGGGACTGAGCTTGGCTGG - Intronic
1162134636 19:8547919-8547941 GAGGTGGGAACGCGGTGGGGAGG + Intronic
1162237732 19:9321780-9321802 GGGGTGGGGAGGAGGGTGGGGGG - Intergenic
1162340671 19:10089862-10089884 CAGGTGGGGATGAGGTGGGGGGG - Intronic
1162938341 19:13993338-13993360 CTGGTGGGAAGGAGTTTGGGGGG + Intronic
1163020283 19:14477877-14477899 GAGGTGGGGAGGAGGTTGCGGGG + Exonic
1163054175 19:14706025-14706047 GTGGTGGATGGGAGGTTGGGGGG - Intronic
1163342967 19:16721622-16721644 GTTGTGGGAAGGTGGCTGGGGGG + Intronic
1163352217 19:16784558-16784580 GAGAGGGGAATGAGGTTGGCGGG + Intronic
1163518320 19:17778261-17778283 GTGGCCGGAGGGAGGTTGGGTGG + Intronic
1163842213 19:19618454-19618476 GTCGTGGCAGTGAGGTTGGCGGG - Intronic
1164411285 19:28007770-28007792 GTTGTGGGAATGATGTTTGATGG + Intergenic
1164713693 19:30376606-30376628 GTGGTGGGAGTGAGCTGTGGTGG + Intronic
1164757646 19:30702434-30702456 GAGAGGGGAATGAGGTGGGGCGG + Intronic
1165313574 19:35041935-35041957 GAGGTGGGCATTAGGCTGGGTGG - Exonic
1165725523 19:38110121-38110143 GGAGTGGGAATGGGGGTGGGTGG + Intronic
1165745540 19:38228280-38228302 CTGGCGGGAATGGGGGTGGGAGG - Intronic
1165792485 19:38500396-38500418 GGGGTCAGGATGAGGTTGGGGGG + Intronic
1166119087 19:40674262-40674284 GAGGTGGGAAGAAGGCTGGGAGG - Intronic
1166342650 19:42148155-42148177 GGGGTGGAGATGAGGTTGGCAGG - Intronic
1166361234 19:42253797-42253819 GGGGTGGGGATGGGGTGGGGTGG + Intronic
1166522560 19:43490668-43490690 GTGCTGGGAATGTGGCTGGAAGG - Intronic
1166668003 19:44692965-44692987 GTGATGGGTATGTGGTTGCGAGG + Intergenic
1167013680 19:46825565-46825587 GAGGGGGGAATGAGATTGGAGGG - Intergenic
1167907064 19:52670149-52670171 GTGATTGGAATGAGGCAGGGTGG - Intronic
1167978299 19:53251251-53251273 ATGGTGTCAGTGAGGTTGGGTGG - Intronic
1168064996 19:53914331-53914353 GTGTTGGGAAAGCGGGTGGGTGG - Intronic
1168265998 19:55224449-55224471 CTGGTGGGGATGAGGCGGGGTGG - Intergenic
1168317775 19:55491526-55491548 CTGGTGGGAAGGAGGGAGGGAGG + Intronic
1168380414 19:55915762-55915784 GGGGTGGGAGTGAAGTTGGGTGG - Intronic
1168467919 19:56618919-56618941 GGGGTGAGAATGGGGTGGGGAGG + Intronic
925022737 2:584724-584746 GTGGTGGCCATGTGGCTGGGCGG + Intergenic
925886906 2:8401285-8401307 GAGTTGGGAATGAAGATGGGAGG + Intergenic
925978502 2:9157508-9157530 GTGGGGTGAATGAGGTTGTTTGG + Intergenic
926269259 2:11352827-11352849 GTGGTCAGAAAGAGGATGGGGGG + Intergenic
926418664 2:12675699-12675721 GTGGTGGGAAAGAGGCTGGAAGG - Intergenic
926444911 2:12930023-12930045 GTGATGAGAATGTGGTGGGGTGG - Intergenic
927168081 2:20345205-20345227 GAGGTGGGAATGAGGTGGGAAGG - Intronic
927385506 2:22528848-22528870 TTGGTGGGAAGGGGGTTGGGAGG + Intergenic
927516461 2:23674688-23674710 GGGGTGGGGGTGAGGGTGGGTGG - Intronic
927719643 2:25374355-25374377 TTGCTGGGAATGGAGTTGGGAGG - Intergenic
927844286 2:26463423-26463445 GTGGTGGGAAGTGGGTGGGGTGG + Intronic
927889284 2:26738433-26738455 GGGGCAGGGATGAGGTTGGGGGG - Intergenic
928338268 2:30417600-30417622 GAGCTGGGGATGAGGATGGGAGG + Intergenic
928364476 2:30690572-30690594 GAGGGGGGAATGGGGCTGGGAGG + Intergenic
928434641 2:31246720-31246742 GTGGTGTGGGTGAGGTTGGGTGG + Intronic
929594773 2:43169291-43169313 GTGGTGGGAGGGAGGTTTCGGGG + Intergenic
929761365 2:44810290-44810312 TTTCTGGGAATGAGGTTGAGAGG + Intergenic
929833125 2:45366333-45366355 TTGGTGGGTGGGAGGTTGGGGGG - Intergenic
929899332 2:45987597-45987619 GTGGTGGGGATGCTGGTGGGGGG - Intronic
930020497 2:46999098-46999120 ATGGTGGGTAGGAGGATGGGCGG - Intronic
930191144 2:48461556-48461578 GTGGGGGAAATGAGGCTTGGTGG + Intronic
931425778 2:62169760-62169782 GTGATTGGAATGAGTTAGGGTGG - Intergenic
931615646 2:64153957-64153979 GTGGGGTGACTCAGGTTGGGAGG - Intergenic
931653888 2:64492322-64492344 GGGGTGGGGATGGGGTTGGGGGG + Intergenic
931801381 2:65761291-65761313 GTAGTGGGGATGAGGGTGTGGGG + Intergenic
932431370 2:71675735-71675757 GTGGTGAGATTAAGGTGGGGAGG - Intronic
932815737 2:74860181-74860203 GTGGGGGGCATGAGGGTAGGAGG + Intronic
933658438 2:84907304-84907326 GTGGTGGGAGGGAGGAAGGGTGG + Intergenic
933975359 2:87504890-87504912 GGGGTGGGCATGGGGTTGGGGGG + Intergenic
934952678 2:98589024-98589046 GGGGTGGGCATCAGGTAGGGTGG + Exonic
936318467 2:111445923-111445945 GGGGTGGGCATGGGGTTGGGGGG - Intergenic
936984181 2:118292251-118292273 GTGGTGGGGAAGAGGGTGGCAGG - Intergenic
937072256 2:119073277-119073299 GTGGGAGGAAGGAGGTGGGGAGG + Intergenic
937303604 2:120857766-120857788 GTGGTGGGGGTGGGGGTGGGGGG - Intronic
938702053 2:133888288-133888310 GTGGGGGGAAGGAGGTGAGGCGG + Intergenic
938774529 2:134529934-134529956 GTGGTAGGAATGCAGTCGGGAGG + Intronic
940020876 2:149154666-149154688 GTGATGGGGATGGGGTGGGGTGG + Intronic
940303659 2:152202595-152202617 GTGATCGGAATGAGTTAGGGTGG - Intergenic
940416844 2:153432716-153432738 GGGGTGGGGAGGTGGTTGGGGGG + Intergenic
942712170 2:178848770-178848792 GTGGTGGGGTGGAGGTGGGGAGG + Intronic
943864739 2:192915305-192915327 GTAATGGGAATGAGTTAGGGTGG + Intergenic
944019374 2:195083428-195083450 GTGGTGGGAATGGGGTTGAAAGG - Intergenic
944871298 2:203914919-203914941 GTGGTGGTAGTGAGGTTTTGTGG - Intergenic
945067966 2:205962867-205962889 TTGGTGGGTATTAGGTGGGGAGG + Intergenic
945173072 2:207017186-207017208 GTGGTGGAAATGTGGATGGCAGG - Intergenic
945519004 2:210799816-210799838 GTGGTGGTGATGGGGTTAGGAGG + Intergenic
945720461 2:213412109-213412131 GTGATCGGAATGAGTTAGGGTGG - Intronic
945722042 2:213429343-213429365 GTGGTGGGGGTCAAGTTGGGTGG - Intronic
945829186 2:214762877-214762899 GTGGTGGGAGGGGGGTGGGGTGG - Intronic
946433912 2:219639853-219639875 GTGCTGGGAAGCAGGTTTGGGGG - Intronic
947435605 2:230069400-230069422 CTGCTGGGAATGAGGTAGGGAGG - Intergenic
947743799 2:232497370-232497392 GTGCTGGGGATGGGGGTGGGAGG - Intergenic
947911252 2:233802398-233802420 GAAGGGGGAATGAGGGTGGGAGG - Intronic
948256814 2:236574385-236574407 CTGGTAGGAATGAGGTGGAGGGG + Intronic
948402474 2:237693649-237693671 AGGGTGGGAATGTGGTTGAGCGG + Intronic
948554979 2:238803081-238803103 GTGCTGGGAGTCAGGTGGGGAGG + Intergenic
949073987 2:242043610-242043632 GAGGTGGCACTGGGGTTGGGAGG - Intergenic
1169680319 20:8204571-8204593 ATGGTGGGAGCAAGGTTGGGTGG - Intronic
1169854672 20:10089902-10089924 GGTGTGGGAGTGAGGGTGGGTGG + Intergenic
1169985609 20:11440641-11440663 GTGATGGAAATGAGGTTGTGCGG - Intergenic
1170328547 20:15183030-15183052 GTGGTGGAAATGAGAATGGGAGG - Intronic
1171154402 20:22859150-22859172 GTGGTGGACATGGGGTTGGTGGG + Intergenic
1171939143 20:31307915-31307937 ATGCTGTGAATGGGGTTGGGTGG - Intronic
1172364760 20:34340555-34340577 GGGTTGGGAAAGAGGTTGGGTGG - Intergenic
1172651035 20:36501556-36501578 GTGGTTGGAGGGGGGTTGGGTGG + Intronic
1172770377 20:37379002-37379024 GTGATGGGGATGGGGGTGGGGGG + Intronic
1172799865 20:37568098-37568120 GATGTGGGAGTGGGGTTGGGGGG + Intergenic
1172973465 20:38889759-38889781 GAGGAGGGAATGAGGGAGGGAGG + Intronic
1172995769 20:39069450-39069472 GTGGTGGGACTGAGGTGGGGGGG + Intergenic
1173539229 20:43838789-43838811 GTGGTGGTGGTGAGGTGGGGCGG + Intergenic
1173985060 20:47254718-47254740 GTGGTGGGGGTGGGGTGGGGTGG + Intronic
1174031523 20:47632273-47632295 GGGGTGGGGATGAGGTTTGGAGG + Intronic
1174670471 20:52302873-52302895 CTGGCTGGAATGTGGTTGGGTGG + Intergenic
1175427625 20:58878896-58878918 GTGGTGGGGGTGCGGGTGGGGGG + Intronic
1175463774 20:59175224-59175246 GTGGTGGGGGTGGGGGTGGGTGG + Intergenic
1175631629 20:60543867-60543889 GGGGTGGGAGTGGGGTGGGGTGG - Intergenic
1175990696 20:62787153-62787175 AGGGTGGGAATGCGGGTGGGAGG - Intergenic
1177009100 21:15709837-15709859 ATCCTGAGAATGAGGTTGGGTGG - Intergenic
1177112211 21:17042201-17042223 GGGGTGGTAATGAGCATGGGCGG + Intergenic
1177458022 21:21369098-21369120 GTGGTGGTGAGGAGATTGGGGGG - Intronic
1178082415 21:29078774-29078796 GGAGTGGGGATGAGGTTGAGGGG + Intronic
1178261202 21:31101139-31101161 GTGAGGGGAGTGGGGTTGGGGGG + Intergenic
1179171568 21:38976935-38976957 GTGGTGGGTCTGAGTTAGGGTGG + Intergenic
1179512288 21:41881003-41881025 GTGGTGGGAGTGGGGTTGGGCGG - Intergenic
1179647572 21:42784853-42784875 GGGGTGGGGATGGGGTAGGGTGG - Intergenic
1179970967 21:44836393-44836415 GGGGTGGGGATGGGGTGGGGTGG - Intergenic
1180141078 21:45893610-45893632 GGGGTGGGGATGAGGTGGGTGGG + Intronic
1180174483 21:46081055-46081077 GTGGTGGGCAGGAGACTGGGTGG - Intergenic
1180198255 21:46209973-46209995 CCGGTGGGAATGAGGTAGGTGGG - Intronic
1180632167 22:17237211-17237233 GTCCTGGGGCTGAGGTTGGGTGG + Intergenic
1180760510 22:18199062-18199084 CTGGTGGGAATGAGGATGTAGGG - Intergenic
1180770822 22:18383359-18383381 CTGGTGGGAATGAGGATGTAGGG - Intergenic
1180775159 22:18425634-18425656 CTGGTGGGAATGAGGATGTAGGG + Intergenic
1180808234 22:18736689-18736711 CTGGTGGGAATGAGGATGTAGGG + Intergenic
1180828767 22:18886318-18886340 CTGGTGGGAATGAGGATGTGGGG - Intergenic
1181071158 22:20341654-20341676 CTGGTGGGAATGAGGATGTAGGG + Intergenic
1181106240 22:20577407-20577429 CTGGTGGGAAGGAGGGAGGGAGG - Intronic
1181194229 22:21170603-21170625 CTGGTGGGAATGAGGATGTAGGG + Intergenic
1181215212 22:21322175-21322197 CTGGTGGGAATGAGGATGTAGGG - Intergenic
1181525451 22:23482447-23482469 CTGGTGGGAATGAGGATGTGGGG - Intergenic
1181567775 22:23750433-23750455 AGGGTGGGGATGGGGTTGGGGGG - Intronic
1181582826 22:23837413-23837435 CTGATGGGAGTGAGGATGGGAGG - Intronic
1181671442 22:24427339-24427361 GTGGCTGCAATGAGGATGGGAGG - Intronic
1181807562 22:25384305-25384327 GTAGTGGGAATGAGAGTGCGGGG - Intronic
1182282753 22:29226621-29226643 GTGCGGGGAAGGAGGTGGGGAGG - Intronic
1183483657 22:38078060-38078082 GTGGTGGGAGGGAGTCTGGGAGG - Intergenic
1183706978 22:39480272-39480294 GTGGTGGGAAGGAGCTGGAGAGG + Intronic
1183727052 22:39595952-39595974 CTGGGGGTGATGAGGTTGGGTGG + Intronic
1184531106 22:45056279-45056301 GTGTTCGGGAAGAGGTTGGGAGG - Intergenic
1185186751 22:49405671-49405693 GGGGTGGGGATGGGGGTGGGAGG + Intergenic
1185256978 22:49839472-49839494 GTGTGGGGAATGAGGGTAGGCGG + Intergenic
1203232657 22_KI270731v1_random:124531-124553 CTGGTGGGAATGAGGATGTAGGG - Intergenic
1203278858 22_KI270734v1_random:112306-112328 CTGGTGGGAATGAGGATGTGGGG - Intergenic
950009566 3:9713200-9713222 GTTTGGGGCATGAGGTTGGGTGG + Intronic
950527356 3:13532378-13532400 TTGGTGGGGATGAGCTGGGGGGG + Intergenic
950846995 3:16024095-16024117 GTGGTCGGAATGAGTCAGGGTGG + Intergenic
952414320 3:33076522-33076544 GTGGTGACAATGAGGTGGGCAGG + Intronic
952932823 3:38373312-38373334 GGGGTGGGGGTGAGGTTGAGGGG - Intronic
952970629 3:38648654-38648676 GTGGTGGTGATGAGGATGGGGGG - Intronic
953397139 3:42582159-42582181 GAGGTGGGAAGAAAGTTGGGAGG - Intronic
953677873 3:45017382-45017404 GTTGTGGGAAGGAGGAGGGGTGG - Intronic
953683784 3:45060451-45060473 GGGGTGGGCATGGGGTGGGGTGG + Intergenic
954405868 3:50344807-50344829 GTGGTGGGGAAGGGGTGGGGAGG - Intronic
954675254 3:52311979-52312001 GGGCTGGGAAGCAGGTTGGGGGG - Intergenic
955102033 3:55859680-55859702 GTGGTGGGGATGTGGGTGGGTGG - Intronic
955623257 3:60889068-60889090 GTGATCGGAATGAGTTGGGGTGG - Intronic
955892067 3:63660718-63660740 GAGGTGGGATGGAGGTAGGGAGG + Intronic
957447447 3:80332480-80332502 GGGCTGGGAATGGTGTTGGGGGG - Intergenic
957476858 3:80736769-80736791 GTGCAGGGAGTGAGGTTGGAAGG - Intergenic
958186618 3:90128727-90128749 GTTGTGGGGCTGAGGTGGGGGGG + Intergenic
958999325 3:100943547-100943569 GTGGTGGGAATGAACTGGGAAGG - Intronic
960590899 3:119364227-119364249 GTGGGGGGATGGAGGTGGGGGGG + Intronic
960692668 3:120363191-120363213 GTGGTGGGGAGGAGGGCGGGGGG + Intergenic
961680915 3:128599428-128599450 ATGGTGGGAATGCGGTTTTGTGG + Intergenic
961993580 3:131217662-131217684 GTGGAGGGAAAGAGAGTGGGAGG - Intronic
962463422 3:135635621-135635643 GGGGTGGGAGTGGGGGTGGGTGG - Intergenic
962863952 3:139431101-139431123 GAGGTTGTAATGAGGTAGGGTGG + Intergenic
963308329 3:143679037-143679059 GGGGTGGGAAAGAGGTGAGGGGG + Intronic
963346890 3:144105572-144105594 GAGGTGGGAGTGGGGTTGTGTGG + Intergenic
963505317 3:146177885-146177907 GTGGTGGGAATGACACTGTGTGG - Intergenic
963711590 3:148753564-148753586 GTGATTGGAATGAGTCTGGGTGG + Intergenic
965318537 3:167222419-167222441 GTGGAGGGTAGGAGGTGGGGTGG + Intergenic
965543512 3:169892845-169892867 GGGGTAGGAGTGAGGGTGGGAGG + Intergenic
965863688 3:173178785-173178807 GTAAAGGGAAAGAGGTTGGGGGG - Intergenic
966222689 3:177566315-177566337 TTAGTGGGAATGAGGTTGGAAGG - Intergenic
966315327 3:178638283-178638305 TTGGTTGAAATGAGGTTGTGGGG - Intronic
966854904 3:184187032-184187054 GGGGTGGGGAGGAGGTTGGAGGG + Intronic
967280914 3:187822743-187822765 GTGATGAGAATAAGGTGGGGAGG + Intergenic
967622211 3:191647952-191647974 GTGGTGATAATGAGGATGGGTGG - Intergenic
967877152 3:194275356-194275378 GAGGTGGGAATGAGCTTGCTTGG + Intergenic
967982392 3:195073479-195073501 GTTGTGGGCATGAGGGGGGGAGG - Intronic
968141855 3:196264619-196264641 TTGGTTGAAATGAGATTGGGAGG + Intronic
968331984 3:197878597-197878619 GTGGTGGGGACGTGGGTGGGAGG - Intronic
968949757 4:3684364-3684386 GTGGTGGGATGGAGGGTAGGGGG - Intergenic
969166669 4:5322022-5322044 GTGGTGGGAGTGGGGGTGGGGGG + Intronic
969247138 4:5942510-5942532 GTAGTGGGGATGAGGGAGGGAGG + Intronic
969403501 4:6972990-6973012 TTGTTGGAAATGAGGTTGAGCGG + Intronic
969876052 4:10136310-10136332 GTGATGGGAGTGAGGAGGGGAGG + Intergenic
970196591 4:13557028-13557050 TTGGTGGGAGCGAGGGTGGGAGG + Intergenic
971073366 4:23120446-23120468 GTGGAGGGGATGAGGGTGGGTGG + Intergenic
971406287 4:26322789-26322811 GTTGTGTGAATGGGGGTGGGGGG + Intronic
972778669 4:42266282-42266304 GTGGGGGGAAGGAAGGTGGGGGG - Intergenic
973138342 4:46734235-46734257 GTGGTGGGAGGCAGGTTTGGAGG + Intergenic
973254223 4:48092780-48092802 CTGGAGGGAATGAGGATGAGAGG + Intronic
974716163 4:65670530-65670552 GAGGAGGGAAGGAGGGTGGGAGG - Intergenic
974891554 4:67890271-67890293 GTGGTGGCAGTGAGGATGAGAGG - Intergenic
975437118 4:74365530-74365552 ATGGTGGGACTGGGGTGGGGGGG + Intronic
976556181 4:86453571-86453593 GTGGTGGGGGTGGGGTGGGGGGG - Intronic
977997984 4:103517668-103517690 GAGGAGGGAAGGAGGTTGGGGGG - Intergenic
978007426 4:103634364-103634386 GTTGGGGGAATGAGATTGGGAGG + Intronic
981476937 4:145196667-145196689 GTGGTCAGAATGAGTTAGGGTGG + Intergenic
982756484 4:159224985-159225007 CTGGAGGGAATGAGGTAGGTGGG + Intronic
983153938 4:164320796-164320818 GTGGGGGGAGTGGGGCTGGGGGG + Intronic
983472801 4:168177129-168177151 GTGGGGAGAAGGAGGTAGGGAGG - Intronic
984279172 4:177647659-177647681 ATGGTGGAAATGAAGTTTGGTGG - Intergenic
985079712 4:186252452-186252474 GTGGTGGGATTGGTGGTGGGTGG - Intronic
985203476 4:187507097-187507119 GTGGCGCGAACGAGGCTGGGCGG - Intergenic
986209394 5:5656418-5656440 GTACTGGGAATGAGGGTGTGTGG - Intergenic
986749811 5:10776821-10776843 CTGGTGGGAATGAGGAAGGAGGG - Intergenic
988798374 5:34673738-34673760 GGGGTGGGAATGGGGTTGAGGGG - Intronic
989081869 5:37630985-37631007 GTGGTGGCAATGGGGGTTGGTGG + Intronic
990154708 5:52862575-52862597 GTGGAGGGAATGTGGTGGGCAGG - Intronic
990326272 5:54678663-54678685 GCAGTGGGAATGAGGATGGGAGG + Intergenic
992679607 5:79140994-79141016 GAGGTAGGAATGAGCTTAGGGGG - Intronic
993762987 5:91819866-91819888 CTGTTTGGAATGTGGTTGGGTGG + Intergenic
994040467 5:95253775-95253797 GTGGTGGGAACGAGTGTGGGAGG + Intronic
994731056 5:103490709-103490731 GTGGTGGGAAGGAAGGAGGGAGG - Intergenic
995181637 5:109235518-109235540 GTTGGGGGAATGGGGTGGGGGGG + Intergenic
996792466 5:127307353-127307375 GTGGTGAGAATGGGGTGGGCAGG + Intronic
996961272 5:129253351-129253373 GTGGTGGGAAGGAGAGTGTGAGG - Intergenic
997254362 5:132417075-132417097 TTTGTGGGAATGGGGTTGGCAGG + Intronic
997739776 5:136243314-136243336 GTGGCAGGAATGGGGTTGGGGGG + Intronic
997925205 5:138024140-138024162 TTGGTGGACATGAGGTTTGGGGG - Intronic
998264014 5:140653581-140653603 GTGGGGGAAAGGGGGTTGGGGGG - Intronic
998376573 5:141694792-141694814 GTGGGGGGCATGGGGATGGGGGG + Intergenic
998471331 5:142386236-142386258 ATGAAGGGAAGGAGGTTGGGAGG + Intergenic
998707728 5:144782944-144782966 GAGGTGGGAATGTGGGCGGGGGG + Intergenic
998935111 5:147226656-147226678 GTGGTGGGCATGGGGGTGGCGGG - Intergenic
998978466 5:147674125-147674147 CTGGGGGGAATAAGGTTTGGGGG - Intronic
999079786 5:148832298-148832320 GTGGTGGGTGGGAGGTTGGAGGG - Intergenic
999819879 5:155216055-155216077 GTGGTAGCAATGAGATTTGGAGG + Intergenic
999861491 5:155651994-155652016 CTGGGGGGAATGAAGTTTGGAGG + Intergenic
1000675737 5:164120312-164120334 GTTGTGTGAATGAGGTAGGGAGG + Intergenic
1000820651 5:165979059-165979081 ATGGTGGCAATGGGGTTGGGAGG - Intergenic
1001269782 5:170302577-170302599 TTGGTGGGAGTGAGGCTGGGTGG - Intergenic
1001313275 5:170626079-170626101 GTGATGGGAAGGAGTTTGGAAGG + Intronic
1001891715 5:175344788-175344810 GTGGGGGGAAGGAGGTGGGAAGG + Intergenic
1001998138 5:176178562-176178584 GTGGTGTGCATCAGGGTGGGAGG - Intergenic
1002073936 5:176697047-176697069 GTGGTGGGAGTGAGCATGGTCGG - Intergenic
1002445531 5:179287907-179287929 GTGGGGGGACTGGCGTTGGGCGG - Intronic
1002470137 5:179430159-179430181 GAGGTGGGAATGAGGCAGAGAGG - Intergenic
1003127437 6:3366763-3366785 CTGCTGGGGATGAGGTCGGGAGG - Intronic
1003991527 6:11491544-11491566 GTGGTGTGTATGTGGTTGTGTGG + Intergenic
1004806714 6:19210895-19210917 GTGGTGGCATGGAGGTTGGGAGG + Intergenic
1005959613 6:30686096-30686118 GGGGTGAGACTGAGGGTGGGAGG + Exonic
1006173888 6:32110264-32110286 GTGGTGGAAAGCAGGGTGGGGGG + Intronic
1006448173 6:34091438-34091460 GTGGTGGGGGTGAGGGTGGAGGG - Intronic
1006881022 6:37339970-37339992 GTGGTCAGAAAGAAGTTGGGAGG - Intergenic
1007239736 6:40416410-40416432 GTGGCGGGAATGAGGGGTGGTGG + Intronic
1007301782 6:40873181-40873203 GTGGGAGGAAGGAGGCTGGGAGG - Intergenic
1007359729 6:41346342-41346364 GTGGTGGGAATGAGATTAAGAGG - Intronic
1007383872 6:41507572-41507594 GTGGGAGGAATGGGGGTGGGGGG - Intergenic
1007496709 6:42264918-42264940 GTGGTGGGTATGAGGTCTTGTGG - Intronic
1007914649 6:45549897-45549919 GTGGTTGGAGTGAGGGTGGAGGG - Exonic
1008394471 6:50990826-50990848 GTTGAGGAAATGAGGTTTGGAGG + Intergenic
1008580139 6:52899137-52899159 GTGATCGGAATGAGTTAGGGTGG + Intronic
1010084540 6:71901579-71901601 GTGGTGGATATGAGATTGGTAGG + Intronic
1010267313 6:73881673-73881695 CGGGTGGGAATGAGGATTGGGGG - Intergenic
1011103893 6:83757861-83757883 CTGGTAGGAATGAGGCTGGTAGG + Intergenic
1011260166 6:85462118-85462140 GCTGTGGGAATGTGGTGGGGAGG - Intronic
1011323981 6:86129222-86129244 GTGGTGGGAATGCGGATTGCTGG - Intergenic
1012841405 6:104333382-104333404 GGGGTGGGCATGGGGTGGGGTGG - Intergenic
1013075418 6:106766537-106766559 GTGGTGGTGATGGGGGTGGGCGG - Intergenic
1013179715 6:107707835-107707857 GTGGTGGGTTTGACCTTGGGGGG - Intronic
1013285772 6:108680080-108680102 GTGCTCTGAATGAGGGTGGGTGG - Exonic
1013350205 6:109298772-109298794 GTGGTGGGAAGGAGGAGAGGTGG - Intergenic
1013594689 6:111649894-111649916 GTGGTGGGCATGGGGGTGGGGGG + Intergenic
1013837003 6:114344386-114344408 GTGGGAGGAAGGAGGTGGGGCGG - Intergenic
1014110287 6:117612923-117612945 GTGATTGGAATGAGTTAGGGTGG + Intergenic
1016271674 6:142297370-142297392 ATGTTAGGAAAGAGGTTGGGTGG + Intergenic
1016308618 6:142710131-142710153 GGGGTGTGAATGAGGTAGGTAGG - Intergenic
1016325911 6:142900843-142900865 GGGCTGGGAGTGAGTTTGGGGGG - Intronic
1016821421 6:148349592-148349614 GGGGTGGCAATGAGGTTGGAGGG + Intronic
1016999101 6:149983308-149983330 GTTGTGGGAAGGAGACTGGGAGG + Intergenic
1018132872 6:160749308-160749330 GTGGTGGTGATGATGTTGGTGGG - Intronic
1018524753 6:164696675-164696697 GTTATGGGGATGAAGTTGGGGGG - Intergenic
1018579421 6:165295912-165295934 GTGGTGGGGGTGTGGTGGGGTGG - Intronic
1019059222 6:169243209-169243231 GTGGTGGGAATGTGGAAAGGTGG - Intronic
1019274396 7:168245-168267 GAGGTGGGAGTGATGTGGGGAGG + Intergenic
1019309362 7:352757-352779 GTGGAGGAAGTGAGGTGGGGAGG - Intergenic
1019330343 7:457787-457809 GGGGTGGCAGTGAGGGTGGGGGG + Intergenic
1019779242 7:2929872-2929894 GTGGTGGGGATGAGCTCTGGAGG + Intronic
1020410940 7:7890798-7890820 GGAGTGGGAAAGAGGTGGGGAGG - Intronic
1020592912 7:10166397-10166419 GTGGTGGGGAGGGGGTAGGGGGG - Intergenic
1020680121 7:11226481-11226503 TTGGTGGGGATGAGGCTGGTGGG + Intergenic
1020706416 7:11549765-11549787 GTTGGGGGAGTGTGGTTGGGGGG + Intronic
1021738733 7:23664192-23664214 GGGGTGGTAATGAGGATGGGGGG - Intergenic
1021954452 7:25810369-25810391 ATGGTGAGAATGGGATTGGGGGG - Intergenic
1022001487 7:26230354-26230376 GAGGTGGGTAGGAGGTTGGAAGG - Intergenic
1022224132 7:28345862-28345884 GTGCTGGTGATGAGGGTGGGTGG + Intronic
1022256220 7:28661072-28661094 GTGGTGGGAATGGGGGTGAGGGG + Intronic
1022911154 7:34900529-34900551 GAGGTCGGAGTGAGGTGGGGAGG + Intergenic
1023348589 7:39296645-39296667 TTGGTGCCAATGAGGTGGGGAGG - Intronic
1023473650 7:40552756-40552778 GTGGTGGGGGTGGGGATGGGGGG - Intronic
1024342476 7:48281603-48281625 GTGGTGGGAATGAGGTTGGGAGG - Intronic
1024509718 7:50194124-50194146 GAGATGGGAAAGAGGTTAGGGGG + Intergenic
1025480609 7:60978329-60978351 GTGGTGGGATTGGGGGTGGGTGG - Intergenic
1026352696 7:69531357-69531379 GTGGTGGAAGAGAGGTTGTGGGG + Intergenic
1026451953 7:70537171-70537193 CTGGTGGGAAGGAGGTGGAGGGG - Intronic
1027189602 7:75989122-75989144 GTGGAGGGGTGGAGGTTGGGGGG + Intronic
1029150131 7:98474381-98474403 GTGGTGGGGGTGGGGTGGGGTGG + Intergenic
1029715342 7:102322415-102322437 GGGGTGGGAATGAGACGGGGTGG - Intergenic
1030434065 7:109492754-109492776 GATGTGGAAGTGAGGTTGGGAGG + Intergenic
1032283916 7:130526937-130526959 GGGGTGGGAATGGGGGTGGGGGG + Intronic
1032325063 7:130920294-130920316 GTGGTGGGAATGGGGCATGGGGG - Intergenic
1032511827 7:132478900-132478922 TTGGTGGCAAGGAGGTTGGAAGG - Intronic
1032610574 7:133408229-133408251 GGGGAGGGAATGATGTTGGTGGG + Intronic
1034035942 7:147822194-147822216 GTGTTGGGAGTGAGGTGGGGAGG - Intronic
1034200452 7:149280417-149280439 GGGGTGGGGTTGGGGTTGGGTGG + Intronic
1034270376 7:149800807-149800829 GGGGTGGGAGTGTGGGTGGGTGG - Intergenic
1034390350 7:150782204-150782226 GTTGTGGAGATGAGGATGGGAGG - Intergenic
1034402804 7:150876975-150876997 GTGGTGGGGAGGAGGCGGGGGGG - Intergenic
1034454340 7:151158211-151158233 GTTGTGGGAGTGAGGTGGAGAGG - Intronic
1034780905 7:153881697-153881719 GTGATGGAAATGAGGGTGGAAGG - Intergenic
1034849605 7:154481438-154481460 GTGCTGGGCATGAGGATGTGAGG - Intronic
1035230733 7:157464045-157464067 GGGGTGGGGAAGAGGATGGGAGG - Intergenic
1035483965 7:159208020-159208042 GTGCTGGCAATGAGGATGGCAGG + Intergenic
1035484213 7:159209811-159209833 GTGGTGGCAACGAGGATGGCAGG + Intergenic
1036072468 8:5456481-5456503 GTGGTGGTAATGTGGGTGGGTGG + Intergenic
1036167681 8:6452458-6452480 GTGTGTGTAATGAGGTTGGGAGG + Intronic
1036237848 8:7056811-7056833 GAGGTGGGCATGTGATTGGGAGG + Intergenic
1036389315 8:8310782-8310804 GTTGGGGGAATGAGGTGGGGTGG - Intergenic
1037261963 8:17019631-17019653 GTGGTGGGCGTGGGGTGGGGAGG - Intergenic
1037316456 8:17604001-17604023 GGAGTGGGAAGGAGGTTAGGAGG + Intronic
1037447291 8:18978861-18978883 GGGGTGGGAATGAGGGTAGAGGG - Intronic
1038994199 8:32903332-32903354 GAGGTGGGAGTGGGGTTGAGGGG - Intergenic
1039071764 8:33655405-33655427 GTGGAGGGAATGGGGGTAGGTGG - Intergenic
1042719282 8:71809501-71809523 GGGGTGGGAATGAGGGTTTGAGG - Intergenic
1043638454 8:82416764-82416786 GTGTTGGGAATGAGGCTGAAAGG + Intergenic
1044760065 8:95508562-95508584 GTGGTGGGGAGGAGGCAGGGAGG - Intergenic
1044925858 8:97208265-97208287 GAGGTGGGAAGGAAGTTGGCAGG - Intergenic
1045365459 8:101471603-101471625 GTGGTGGCAGTGAGGTGGGGGGG + Intergenic
1045427705 8:102083625-102083647 TTGGAGGGAATGAGACTGGGAGG - Intronic
1045810430 8:106214874-106214896 CTGCTGGGAATGAGGTAGGGAGG + Intergenic
1046101259 8:109616598-109616620 GTTTTGGGAATGAGGTGGTGGGG + Intronic
1046284118 8:112073544-112073566 ATGGTAGGAATGTGGTTGGCTGG - Intergenic
1047605050 8:126466409-126466431 GTGGCAGGAGTGAGGGTGGGGGG + Intergenic
1047724259 8:127670532-127670554 GAGGTGGGAATGCTTTTGGGTGG - Intergenic
1047927257 8:129693753-129693775 GTTGGGGGAATGGGGGTGGGTGG - Intergenic
1048029897 8:130621342-130621364 GTGGTGGCTCTGGGGTTGGGTGG - Intergenic
1048958442 8:139555991-139556013 GTGGTGGGATAGAGGTGGGGTGG - Intergenic
1048980238 8:139699411-139699433 GTGGTGGGGCGGGGGTTGGGGGG + Intronic
1049249545 8:141580842-141580864 GTGATGGGACTGAGATGGGGCGG + Intergenic
1049494978 8:142925684-142925706 GTGGTGGGGCTTGGGTTGGGTGG + Intergenic
1049604244 8:143521660-143521682 GTGGTGAGAATGAAGTAAGGCGG - Intronic
1049614768 8:143571358-143571380 GTGGGGTGAATGAGGCTGGGGGG - Intronic
1049685111 8:143936262-143936284 GTGGTGGCAGTGAGGGTTGGGGG - Intronic
1050733505 9:8736171-8736193 CTGGTGGGAATTAGGAAGGGAGG + Intronic
1050877755 9:10661331-10661353 GTGATGTGAAGGAGGTTGTGAGG + Intergenic
1053323226 9:37118974-37118996 GTGGTGGGGGTGGGGGTGGGGGG + Intergenic
1053727678 9:41020921-41020943 GCAGTGGGAATGATTTTGGGTGG - Intergenic
1055469313 9:76595404-76595426 GGGGTGGGGCTGAGGGTGGGCGG + Intergenic
1056656115 9:88510702-88510724 GTGATTGGAATGAGTTAGGGTGG - Intergenic
1057560115 9:96121098-96121120 GGAGTGGGAATGAGGGTGAGTGG + Intergenic
1058165277 9:101611977-101611999 GTGGCTGGGATGAGGCTGGGAGG + Intronic
1058789546 9:108428956-108428978 TTGGGGGGAATGAGGTTCTGAGG - Intergenic
1059163477 9:112057129-112057151 GTGGTGGGGATGGAGTGGGGAGG - Intronic
1059522939 9:114960998-114961020 GGGGTTGGAATGAGGATGGAAGG - Intergenic
1059921178 9:119161542-119161564 ATGGTGGGCATGAGGTTTGAAGG - Intronic
1060809777 9:126604970-126604992 TTGTATGGAATGAGGTTGGGCGG - Intergenic
1061012020 9:127961380-127961402 GAGGTGGGAATGAGGATGCCAGG + Intronic
1061215355 9:129218543-129218565 GTGGGTGGAATGAGGATGGCAGG - Intergenic
1061226479 9:129283681-129283703 GTGATGGGAGTGAGGGTAGGGGG + Intergenic
1061248177 9:129412131-129412153 GGGGTGGGAGTGGGGTGGGGTGG + Intergenic
1061253621 9:129440874-129440896 GTGGTGCGGACGGGGTTGGGGGG - Intergenic
1061392067 9:130322589-130322611 GTGTGGGGGATGCGGTTGGGCGG - Intronic
1061407867 9:130402763-130402785 TTGGTGGGAATCAGGGTGAGGGG - Intronic
1062046130 9:134425420-134425442 CAGGTGGGAAGGAGGTTGGACGG - Intronic
1062166570 9:135110752-135110774 GTGGTGGGAAAGAGGTGGGGGGG - Intronic
1062202141 9:135309211-135309233 GTGGTGGGAATGAGTGAGTGAGG - Intergenic
1062303654 9:135889820-135889842 GAGGTGTGAATGAGGGTGGCCGG - Intronic
1062384125 9:136302372-136302394 GGGGTGGGAGTGTGGTGGGGGGG - Intronic
1062640516 9:137515941-137515963 GAGGGGGGATTGAGGTGGGGAGG - Intronic
1186383829 X:9089359-9089381 GGGGTGGGTAGGGGGTTGGGAGG - Intronic
1186385845 X:9109713-9109735 GTGGTTTCAATGAGGGTGGGAGG - Intronic
1186630302 X:11341057-11341079 GTGGTGGGGGTGGGGGTGGGGGG + Intronic
1187889954 X:23924660-23924682 GTTGTGGGGATGAGGGAGGGGGG + Intronic
1189008024 X:37015097-37015119 GTGGTGGGGTTGGGGGTGGGGGG - Intergenic
1189035903 X:37493082-37493104 GGGAAGGGAATGAGATTGGGCGG + Intronic
1189055349 X:37693900-37693922 GTGGAGGGAATGTGCTGGGGTGG + Intronic
1189180937 X:39004004-39004026 GAGGTGGGACTGAGGAGGGGTGG + Intergenic
1190332274 X:49243182-49243204 GTGGTGAGCATGAGGCTGTGGGG + Exonic
1190643798 X:52506102-52506124 GAGGTCATAATGAGGTTGGGTGG + Intergenic
1190735219 X:53251244-53251266 AAGGTGGGAATGAGGGAGGGAGG + Intronic
1191120618 X:56899906-56899928 GTGGTGGGGTTGGGGGTGGGGGG + Intergenic
1191641633 X:63433591-63433613 GTGGTGGGAGTGGGGCTGGGGGG + Intergenic
1191980949 X:66924995-66925017 GTGGTGGGGATGGGGGAGGGGGG - Intergenic
1192210820 X:69126696-69126718 GAGGTGGGAATGAGGAAAGGAGG - Intergenic
1192848096 X:74925892-74925914 GGGGTGGGAATGGGGAAGGGGGG - Intergenic
1193473830 X:81939841-81939863 GTCTTGGGAATGAAGTAGGGTGG + Intergenic
1193652458 X:84154645-84154667 GTGGTGGTGATGAAGTTGGTGGG - Intronic
1195068469 X:101258182-101258204 GGGGTGGGGGTGAGGTAGGGTGG + Intronic
1195365031 X:104116891-104116913 GTGATAGGAATGAGATTGTGGGG - Intronic
1196456338 X:115893989-115894011 GTGTTGGGAATGAGTCCGGGAGG - Intergenic
1196824648 X:119731559-119731581 GGGGTGGGGATGAAGTTGGTAGG + Intergenic
1197282407 X:124552723-124552745 GGAGTGGGAAGGAGATTGGGTGG - Intronic
1198421422 X:136473256-136473278 TAGGTGGGAAGGAGGGTGGGAGG + Intergenic
1198487410 X:137101987-137102009 CTGGTGGGAAAGAGGCAGGGTGG + Intergenic
1198518584 X:137430617-137430639 GAGGTGGGAATGGGGTTGGGCGG - Intergenic
1198742655 X:139857474-139857496 GTGATCGGAATGAGTTAGGGTGG - Intronic
1199567968 X:149235875-149235897 GGGGTGGGGATGCAGTTGGGGGG + Intergenic
1199894971 X:152119396-152119418 GGGATGGGAATGGGGGTGGGGGG + Intergenic
1199952085 X:152715033-152715055 GAGATGGGAATGGGGTTTGGGGG - Intronic
1199957598 X:152753415-152753437 GAGATGGGAATGGGGTTTGGGGG + Intronic
1200034165 X:153317618-153317640 TTGCTGGGCATGGGGTTGGGTGG - Intergenic
1200951401 Y:8902876-8902898 GTCCTGGGAGTGGGGTTGGGAGG - Intergenic
1201584197 Y:15542946-15542968 GTGGTGGGACTCAGTCTGGGTGG + Intergenic
1201691802 Y:16775153-16775175 GTTGAGGGAAGGAGGTGGGGAGG - Intergenic
1201712463 Y:17007746-17007768 GTGGTGGGATGGAGGTGGGGGGG - Intergenic
1201900810 Y:19044946-19044968 GTAATGGGAATGAGGCAGGGTGG - Intergenic