ID: 1024343370

View in Genome Browser
Species Human (GRCh38)
Location 7:48289122-48289144
Sequence TGCCTTGGTGAAGTGTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024343365_1024343370 7 Left 1024343365 7:48289092-48289114 CCCACAGCATGGCAAGGGTGTCG 0: 1
1: 0
2: 0
3: 4
4: 69
Right 1024343370 7:48289122-48289144 TGCCTTGGTGAAGTGTCAGGAGG No data
1024343366_1024343370 6 Left 1024343366 7:48289093-48289115 CCACAGCATGGCAAGGGTGTCGA 0: 1
1: 0
2: 0
3: 3
4: 104
Right 1024343370 7:48289122-48289144 TGCCTTGGTGAAGTGTCAGGAGG No data
1024343360_1024343370 19 Left 1024343360 7:48289080-48289102 CCATGCCAGACTCCCACAGCATG 0: 1
1: 0
2: 0
3: 21
4: 224
Right 1024343370 7:48289122-48289144 TGCCTTGGTGAAGTGTCAGGAGG No data
1024343362_1024343370 14 Left 1024343362 7:48289085-48289107 CCAGACTCCCACAGCATGGCAAG 0: 1
1: 0
2: 1
3: 11
4: 189
Right 1024343370 7:48289122-48289144 TGCCTTGGTGAAGTGTCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024343370 Original CRISPR TGCCTTGGTGAAGTGTCAGG AGG Intronic
No off target data available for this crispr