ID: 1024344278

View in Genome Browser
Species Human (GRCh38)
Location 7:48297057-48297079
Sequence ATTCACATACAGATGGTATT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 1, 2: 1, 3: 31, 4: 303}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024344278 Original CRISPR ATTCACATACAGATGGTATT GGG Intronic
906038636 1:42768886-42768908 TCTCAAATACAGATTGTATTGGG - Intronic
906308451 1:44736389-44736411 ATTCACATATTGATGGCATTTGG - Intergenic
909320298 1:74277155-74277177 ATTCACATACATTTGTCATTTGG + Intronic
909728822 1:78869945-78869967 TTTCACATCCAGATGATACTTGG + Intergenic
909989826 1:82210144-82210166 ATTCACAAGCAGTTGGGATTAGG + Intergenic
911050866 1:93670053-93670075 ATTGGAATACAGGTGGTATTTGG - Intronic
913152524 1:116059072-116059094 ATTGAGGTACAGGTGGTATTTGG - Intronic
914927652 1:151902616-151902638 ATTCAGGTACAGGTGGTATTTGG - Intronic
915831252 1:159132736-159132758 ATTCACATACATATATTAATAGG - Intronic
916165441 1:161963011-161963033 ATTCACTTCCAAATGTTATTAGG - Exonic
916832281 1:168505336-168505358 ATTCACACAAAGATGCTATTTGG - Intergenic
917285611 1:173418936-173418958 ATTCACATATCGATGACATTTGG + Intergenic
918873962 1:190014065-190014087 ATTGGGATACAGGTGGTATTTGG - Intergenic
920454297 1:206086523-206086545 ATTCAGACACAGATGGTTTGAGG - Intronic
921223277 1:212990458-212990480 ATTGACAAACAGAAGGTATATGG - Exonic
922015958 1:221647195-221647217 ATTCATATGCTGATGGTATTTGG - Intergenic
922196807 1:223365474-223365496 TCTCACATACTGATGGTAGTTGG + Intergenic
922672865 1:227526525-227526547 ATTGGGTTACAGATGGTATTTGG + Intergenic
923171183 1:231419254-231419276 CTTCTCATAGAGATGCTATTAGG - Intronic
923416821 1:233770511-233770533 ATACACATCCAGAAGGTACTAGG + Intergenic
923996821 1:239505029-239505051 ATTGAGGTACAGGTGGTATTTGG - Intronic
924173590 1:241366593-241366615 ATTCCCAAAGTGATGGTATTAGG + Intergenic
1064189349 10:13192203-13192225 ATTCACATTCAGATGGTTTGAGG - Intronic
1064679455 10:17795322-17795344 ATTCAAATGCAGTTAGTATTGGG - Intronic
1064816356 10:19269213-19269235 ATCCCCATTGAGATGGTATTTGG + Intronic
1065714800 10:28555689-28555711 ATTCATATATTGATCGTATTTGG + Intronic
1066081279 10:31933187-31933209 ATGCACATACAGGTGGTCTTTGG - Intergenic
1066175920 10:32905785-32905807 GTGCAGATAAAGATGGTATTGGG - Intronic
1069343209 10:67437438-67437460 ATTGGGGTACAGATGGTATTTGG - Intronic
1069590368 10:69637629-69637651 ATTCACAGAGAAATGGTATTAGG + Intergenic
1074155768 10:110797906-110797928 ATTCACATAGAAAGGGTAATTGG + Intronic
1074947848 10:118298389-118298411 ATTCAGATACACATCGCATTCGG - Exonic
1075204197 10:120432525-120432547 AATCACATACAGAAGGGAATGGG - Intergenic
1075495267 10:122914361-122914383 ATTAACATAGAGAGGTTATTTGG - Intergenic
1078594981 11:12677999-12678021 ATTCACATACAGACAGTAGGTGG + Intronic
1079275352 11:19030510-19030532 ATTCGGATACAGGTGGTATTTGG + Intergenic
1080664140 11:34320813-34320835 AGACAGATACAAATGGTATTGGG - Intronic
1080672025 11:34389032-34389054 ATTGAGGTACAGGTGGTATTTGG + Intergenic
1080909301 11:36580027-36580049 ATTCACATACTTATTGTATTAGG + Intronic
1081610709 11:44561587-44561609 ATTCATATGTTGATGGTATTTGG + Intergenic
1081679840 11:44994494-44994516 GATCACATACAGATTGTGTTTGG - Intergenic
1084220998 11:67679141-67679163 ATTGGGATACAGGTGGTATTTGG - Intronic
1085720888 11:78911572-78911594 ATTCATATATTGATGGCATTTGG + Intronic
1085984654 11:81770776-81770798 ATGCACATATAGGTGGTCTTTGG - Intergenic
1087344813 11:96958069-96958091 CTTCACATAAAGATGGTTTTAGG - Intergenic
1087447254 11:98270213-98270235 ATTCATATTCAGCTGCTATTGGG + Intergenic
1088842559 11:113639149-113639171 ATTCACAAACAGAGGGAATTTGG + Intergenic
1088873580 11:113913833-113913855 ATTCATATGTTGATGGTATTTGG + Intronic
1089901372 11:121989412-121989434 ATTCATATAGAATTGGTATTTGG - Intergenic
1089952336 11:122540625-122540647 ATTGGAATACAGGTGGTATTTGG + Intergenic
1090587991 11:128234873-128234895 ATTCCCATCATGATGGTATTGGG - Intergenic
1091485634 12:884998-885020 ATTCAGACACAGGTGGTATGGGG - Exonic
1091812557 12:3411626-3411648 ATTCACATGTAGATGATATTTGG + Intronic
1092436839 12:8454807-8454829 ATTGAGGTACAGGTGGTATTTGG - Intergenic
1093118066 12:15235115-15235137 ATTAAGGTACAGGTGGTATTTGG + Intronic
1093597821 12:20982703-20982725 ATTGGCATACAGGTGGTGTTTGG + Intergenic
1093952127 12:25175078-25175100 ATTGAGGTACAGGTGGTATTTGG - Intronic
1095117757 12:38376137-38376159 ATTGGGATACAGGTGGTATTTGG + Intergenic
1095863378 12:46944541-46944563 ATTCACCTTGAGATGCTATTAGG + Intergenic
1097760975 12:63463660-63463682 ATTGGGGTACAGATGGTATTTGG - Intergenic
1098012572 12:66070752-66070774 ATTCATATGTTGATGGTATTTGG + Intergenic
1099753961 12:86815964-86815986 ATTGGCATACAGGTGGTATTTGG - Intronic
1101576046 12:105997402-105997424 ATTGAGGTACAGGTGGTATTTGG - Intergenic
1104425573 12:128674699-128674721 ATTGGCGTACAGGTGGTATTTGG + Intronic
1106213539 13:27673504-27673526 ATTCACATAAAGGTGTTATATGG - Intergenic
1106352980 13:28952467-28952489 ATTCCCATGCATATGATATTAGG - Intronic
1106842300 13:33696932-33696954 ATTTGCTTACATATGGTATTTGG - Intergenic
1108817411 13:54308427-54308449 ATTGTGTTACAGATGGTATTTGG - Intergenic
1109358087 13:61258537-61258559 TTTCATTTACAGATGCTATTAGG + Intergenic
1109490310 13:63088950-63088972 ATTCACATACAGAAGGTATTTGG + Intergenic
1109555529 13:63970050-63970072 TTTGAAATACAGATGGTTTTTGG - Intergenic
1110887485 13:80657339-80657361 ACACACACACACATGGTATTAGG - Intergenic
1111652848 13:91114441-91114463 ATTCAAATAGAAATGTTATTAGG - Intergenic
1112074467 13:95895650-95895672 ATTCAGATTGAAATGGTATTTGG - Intronic
1112084219 13:96011703-96011725 ATTCACATACAGATTCTTGTAGG - Intronic
1112088465 13:96055270-96055292 CTTCACATTCACATGTTATTTGG + Intergenic
1112160214 13:96859343-96859365 ATTCCCATAGATATGGGATTTGG + Intergenic
1113033280 13:106017830-106017852 ATGCAAATACAGATGGTCTCAGG - Intergenic
1113460841 13:110480723-110480745 ATTCAGATCCAGAGGTTATTTGG + Intronic
1114914185 14:27241217-27241239 ATTCATATATTGATGGAATTTGG - Intergenic
1115656020 14:35444486-35444508 ATTCATATGTTGATGGTATTTGG - Intergenic
1115995267 14:39189171-39189193 ATTCCCATACATTTGGGATTTGG - Intergenic
1116201083 14:41797335-41797357 ATTCACAAACAAATGGCATTAGG - Intronic
1117559641 14:56923628-56923650 ATTCACATGTTGGTGGTATTTGG + Intergenic
1119133958 14:72199890-72199912 ATTTATATACAGATGGTCTGTGG + Intronic
1119966517 14:78922511-78922533 ATTTAGATGCAGATGGTATAAGG + Intronic
1120460035 14:84783609-84783631 ATTCCTATATAGATGGTAGTTGG + Intergenic
1120478088 14:85014039-85014061 ATTTGGGTACAGATGGTATTTGG - Intergenic
1121003947 14:90475001-90475023 ATTCGTATAAATATGGTATTGGG + Intergenic
1121703185 14:95971819-95971841 ATTCATATATTGATGGCATTAGG + Intergenic
1202889544 14_KI270722v1_random:143066-143088 ATTTACATCCACATTGTATTTGG + Intergenic
1124560142 15:30765409-30765431 ATTGGCATACAGGTGGTGTTTGG + Intronic
1125164784 15:36690203-36690225 ATTCACTTAAAAATAGTATTGGG - Intronic
1125185794 15:36928566-36928588 ATACACACACAGGTAGTATTTGG - Intronic
1127007657 15:54588524-54588546 ATTGGTATACAGGTGGTATTTGG + Intronic
1130790745 15:87153318-87153340 ATTGGGATACAGGTGGTATTTGG + Intergenic
1130928845 15:88405957-88405979 ATTCATATGTTGATGGTATTTGG - Intergenic
1131210634 15:90492866-90492888 ATACACTTACAAATGGAATTAGG - Intronic
1131676176 15:94672968-94672990 CTTCAAATACTGATAGTATTTGG - Intergenic
1131765873 15:95675300-95675322 ATTGGCGTACAGGTGGTATTTGG + Intergenic
1133080277 16:3313277-3313299 ATTCTCATCTAGATGGTATAGGG + Intronic
1133709067 16:8383631-8383653 ATTCACACACTGATGAAATTTGG - Intergenic
1135210512 16:20522011-20522033 AGTCACATACAGATTTTATAGGG - Intergenic
1137962330 16:52895135-52895157 ATTCATATGTTGATGGTATTTGG - Intergenic
1139661376 16:68423342-68423364 ATTCATATATTGATGGCATTTGG + Intronic
1143958533 17:10695488-10695510 ATTAAATTACAGATTGTATTTGG - Intronic
1149239231 17:54629535-54629557 ATCCACAAAGTGATGGTATTGGG - Intergenic
1149719089 17:58825139-58825161 ATTGAGGTACAGGTGGTATTTGG - Intronic
1150889745 17:69134249-69134271 ATTCCCATTGTGATGGTATTAGG + Intronic
1150968461 17:69999128-69999150 ATTCTCATACAGATGGTCATGGG - Intergenic
1151971867 17:77461657-77461679 ATTCACAAAGTGATTGTATTAGG + Intronic
1154017471 18:10631997-10632019 ATTGACATAAAAATGGTCTTGGG - Intergenic
1154187392 18:12197598-12197620 ATTGACATAAAAATGGTCTTGGG + Intergenic
1155198118 18:23493926-23493948 ATTCATATATTGTTGGTATTTGG - Intergenic
1155614974 18:27711622-27711644 ATGAACATGCATATGGTATTTGG + Intergenic
1155626323 18:27839015-27839037 ATCCATATAGTGATGGTATTTGG + Intergenic
1158206086 18:54994504-54994526 ATTGAGGTACAGGTGGTATTTGG + Intergenic
1159734616 18:72079162-72079184 ATTCACTTGTAGATGGAATTTGG + Intergenic
1163746662 19:19052741-19052763 ATTGACACACAGAAGGTGTTAGG + Intronic
1164455940 19:28406714-28406736 ATACAGATACAGATAGTTTTAGG - Intergenic
1164717355 19:30403050-30403072 TTTCACATACAGAAGGGATGGGG + Intronic
1166791598 19:45402221-45402243 AGTCACTTACAGCTGGCATTAGG - Intronic
1202664949 1_KI270708v1_random:109835-109857 ATTTACATCCACATTGTATTTGG + Intergenic
925654879 2:6135871-6135893 ATTGGGGTACAGATGGTATTTGG - Intergenic
926619403 2:15033577-15033599 ATTCACAATGTGATGGTATTTGG + Intergenic
927252595 2:21011123-21011145 ATGCACATACAAATGGCAATGGG - Exonic
928606998 2:32952393-32952415 ATCCACATACAAATGGTGTCTGG - Intronic
928739612 2:34335035-34335057 ATTCACATATAAATGGATTTAGG + Intergenic
929065649 2:37971941-37971963 ATTCACATATTTATGATATTGGG + Intronic
929396683 2:41531703-41531725 ATTCATATGTTGATGGTATTTGG - Intergenic
929839646 2:45444660-45444682 AATCACATACATATGTTAGTTGG + Intronic
930291624 2:49501128-49501150 ATCGATTTACAGATGGTATTTGG + Intergenic
930521656 2:52474869-52474891 ATTGGGGTACAGATGGTATTTGG - Intergenic
930565476 2:53013941-53013963 ATTCTAAAACTGATGGTATTAGG - Intergenic
931472139 2:62549050-62549072 ATTTACATACAGGTAGTATAGGG - Intergenic
931831291 2:66054184-66054206 ATTTACATACAGCTGGGATTTGG - Intergenic
931952874 2:67384946-67384968 ATTCATATACTGATAGGATTTGG + Intergenic
935172159 2:100618594-100618616 GTTGGGATACAGATGGTATTTGG + Intergenic
935203270 2:100876723-100876745 ATGCCCAAACAGATGGGATTAGG - Intronic
935537175 2:104308223-104308245 ATTCCCAGAACGATGGTATTAGG - Intergenic
935941120 2:108240251-108240273 ATGCATCTTCAGATGGTATTGGG + Intergenic
939579825 2:143935084-143935106 AGTTATAAACAGATGGTATTTGG + Intergenic
940383322 2:153041991-153042013 ATTCATATTTTGATGGTATTTGG + Intergenic
942603558 2:177666360-177666382 ATTCACATACAGTTTTTATGTGG + Intronic
943429724 2:187784160-187784182 ATTGAGGTACAGGTGGTATTTGG + Intergenic
943752681 2:191526053-191526075 ATTGGGGTACAGATGGTATTTGG - Intergenic
943765238 2:191653976-191653998 ATTTATATGCTGATGGTATTTGG - Intergenic
944430933 2:199632997-199633019 ATACAAATACAGCTGGTACTTGG + Intergenic
944469139 2:200034213-200034235 ATTGTCATACAGATGGCATGTGG - Intergenic
944490966 2:200257542-200257564 TTCCACACACAGATGGTGTTGGG - Intergenic
945077780 2:206057779-206057801 ATTGAGGTACAGGTGGTATTTGG - Intronic
945379353 2:209121111-209121133 ATTGGGATACAGGTGGTATTTGG - Intergenic
945412737 2:209531778-209531800 ATTCAGGTACAAATGGTATTGGG + Intronic
945769072 2:214016943-214016965 ATGGACATGCAGATGGTGTTAGG + Intronic
945865289 2:215167763-215167785 ATTAGGGTACAGATGGTATTTGG - Intergenic
946744717 2:222834071-222834093 AACCAAATACAGATGGTCTTTGG + Intergenic
1169572122 20:6917755-6917777 ATTGAAGTACAGGTGGTATTTGG - Intergenic
1169623496 20:7536340-7536362 ATTTGGATACAGTTGGTATTTGG - Intergenic
1169897573 20:10520745-10520767 ATGTTCATACAGATGGTGTTGGG - Intronic
1170299243 20:14864304-14864326 ATACACAAACAGATATTATTTGG - Intronic
1170497237 20:16937724-16937746 ATTCACATATTAATGGTATTTGG - Intergenic
1170862592 20:20121974-20121996 ATTCGGGTACAGGTGGTATTTGG + Intronic
1171160554 20:22918643-22918665 ATTCACACACATGTGGGATTAGG - Intergenic
1173932829 20:46835951-46835973 ATTCACACCCAGATGGACTTGGG - Intergenic
1174918002 20:54673463-54673485 ATTTACATACAAATTATATTTGG - Intergenic
1175553929 20:59834348-59834370 ATTCACACACAGAGGCTGTTGGG + Intronic
1176886262 21:14258854-14258876 AGTCACATATAGTTGGTAGTTGG - Intergenic
1177021665 21:15867869-15867891 ATGGGCATACATATGGTATTTGG + Intronic
1177578323 21:22986935-22986957 ATTAAGATACAGGTGGTGTTTGG - Intergenic
1180331674 22:11486755-11486777 ATTTACATCCACATTGTATTTGG + Intergenic
1182207379 22:28642629-28642651 ATGCAGATACATATGGAATTAGG + Intronic
1182277763 22:29201241-29201263 CTTCCCATACAGAAGGTCTTAGG + Intergenic
1182557155 22:31135420-31135442 CTTCACATACAGATGAGAATGGG - Exonic
1182964180 22:34505982-34506004 ATTGAGGTACAGGTGGTATTTGG - Intergenic
949321585 3:2816859-2816881 ATTGGGATACAGGTGGTATTTGG - Intronic
950103540 3:10374134-10374156 AATCATATACAGATGCTTTTAGG - Intronic
951173723 3:19574716-19574738 AGCCACATAGAGATGGTCTTAGG - Intergenic
955451388 3:59071066-59071088 ATTCCCAAACAGCTGCTATTTGG + Intergenic
956299257 3:67751991-67752013 ATTGAGGTATAGATGGTATTTGG - Intergenic
957090992 3:75729897-75729919 ATTTACATCCACATTGTATTTGG - Intronic
957291023 3:78278336-78278358 ATTGACAGACTGATAGTATTCGG - Intergenic
958490115 3:94761907-94761929 ACTAGGATACAGATGGTATTTGG + Intergenic
962166321 3:133052886-133052908 ATTCTCAATCAGAGGGTATTTGG - Intronic
962356467 3:134698491-134698513 ATTTCCATAGAGATGGGATTGGG + Intronic
962487086 3:135854291-135854313 ATTAAGATACAGGTGGTATTTGG + Intergenic
962490344 3:135887522-135887544 ACTCACAAACAGATGGGACTAGG + Intergenic
963165639 3:142200133-142200155 ACACACATACATATGGTTTTTGG + Intronic
964190463 3:153994516-153994538 ATTGGGATACAGGTGGTATTTGG - Intergenic
964574747 3:158153120-158153142 ATACAAATACAGAAGGTATAGGG - Intronic
965165581 3:165191971-165191993 TTTCATATACTGATGTTATTAGG - Intronic
965223324 3:165955333-165955355 ATTGGGATACAGGTGGTATTTGG - Intergenic
965225366 3:165981850-165981872 ATTCACTTTCAGATTTTATTAGG + Intergenic
965929033 3:174019248-174019270 ATTCATATGTTGATGGTATTTGG + Intronic
966319150 3:178681344-178681366 ATTCACATTCAGGTGCTTTTGGG + Intronic
967400270 3:189053050-189053072 ATTGGGATACAGGTGGTATTTGG - Intronic
967505439 3:190247829-190247851 ATTGAGGTACAGGTGGTATTTGG + Intergenic
970135410 4:12916942-12916964 AGCCACTTACAGATGTTATTAGG + Intergenic
970682045 4:18520559-18520581 ATTCACAACATGATGGTATTTGG - Intergenic
970801818 4:19981004-19981026 ATTCCCAGACATATCGTATTAGG + Intergenic
971032915 4:22660431-22660453 ATACACATACTGATAGTGTTTGG - Intergenic
971701778 4:29986254-29986276 ATTTACGTACAGATGGCACTAGG + Intergenic
974217898 4:58923277-58923299 ATTGGCATACAGGTGGTACTTGG - Intergenic
974282072 4:59808303-59808325 ATTCAGTTATAGATGGTATAAGG - Intergenic
975770455 4:77715618-77715640 ATTTACATAAAAAAGGTATTTGG + Exonic
975808775 4:78142100-78142122 ATTGAGGTACAGGTGGTATTTGG - Intronic
975867113 4:78735275-78735297 ATTCCCAAAGTGATGGTATTAGG - Intergenic
976016996 4:80567904-80567926 ATTCAAATATACATTGTATTAGG - Intronic
976292861 4:83439033-83439055 ATTCTCATACATATAGTCTTAGG + Intronic
976455093 4:85237212-85237234 ATTGGTGTACAGATGGTATTTGG + Intergenic
977406333 4:96603981-96604003 ATTCAGAAACAAATGATATTTGG + Intergenic
977735102 4:100405239-100405261 ACTCATATTCACATGGTATTGGG - Intronic
977800380 4:101222946-101222968 TTTCACATACAAATGATTTTTGG - Intronic
978104061 4:104880323-104880345 ATTCACATTTTGATGGTATTTGG - Intergenic
978144611 4:105357147-105357169 TTTTACATGCAGATGCTATTTGG - Intergenic
980623521 4:135342402-135342424 ATTTCCATACAGGTGGTAATAGG + Intergenic
980679750 4:136143349-136143371 ATACACATACACAAGATATTAGG + Intergenic
982189252 4:152836813-152836835 ATTGAGGTACAGGTGGTATTTGG + Intronic
983316811 4:166143018-166143040 ATTCACAGTGTGATGGTATTGGG - Intergenic
983643695 4:169968376-169968398 ATTCACATCCAGAATGTATGAGG - Intergenic
985008167 4:185555344-185555366 ATTGAGACACAGGTGGTATTTGG + Intergenic
985065739 4:186119438-186119460 ATTCAGAAGCAGATGGTCTTTGG + Intronic
985214932 4:187641053-187641075 CTTCACCTACAGGTGGTATGAGG - Intergenic
987414682 5:17650353-17650375 GTTCACAGACAGGTGGTTTTTGG - Intergenic
988104998 5:26733481-26733503 ATTCTCAAAGTGATGGTATTGGG + Intergenic
989378944 5:40795356-40795378 ATTGGGGTACAGATGGTATTTGG - Intronic
991956413 5:71999574-71999596 ATTCTCATATACATGGTATGTGG + Intergenic
992914862 5:81438732-81438754 ATTCACAAAAAGATGATATTTGG - Intronic
993498451 5:88635299-88635321 AATCACCTACAGATGATATGAGG + Intergenic
994444172 5:99852142-99852164 ATTCATCTACTGATGGCATTTGG - Intergenic
994988587 5:106969367-106969389 ATTCATTTGCTGATGGTATTTGG - Intergenic
995349687 5:111160689-111160711 ATTGGGGTACAGATGGTATTTGG + Intergenic
995955954 5:117776440-117776462 ATTAAGAAACAGATGGTGTTTGG - Intergenic
996011496 5:118485726-118485748 ATTGGGATACAGGTGGTATTTGG - Intergenic
997000669 5:129756349-129756371 ATTGAGGTACAGGTGGTATTTGG + Intronic
998694443 5:144623472-144623494 ATCAGCATACAGATGGTATTTGG + Intergenic
1000404371 5:160871392-160871414 ATTGCCGTACAGGTGGTATTTGG + Intergenic
1000585743 5:163096425-163096447 AATCACATACATATGGTTTCAGG - Intergenic
1000828218 5:166072589-166072611 ATTTACATATAGATGGTAACAGG - Intergenic
1001453171 5:171841672-171841694 ATTCCCAAAGTGATGGTATTTGG - Intergenic
1003711483 6:8596876-8596898 ATTGGAGTACAGATGGTATTTGG + Intergenic
1003727952 6:8787409-8787431 ATACACATAAAGATGGGAGTAGG + Intergenic
1004522941 6:16379373-16379395 ATTGGGATACAGGTGGTATTTGG - Intronic
1008533550 6:52487990-52488012 ATTCACAGATAGATGGCAATAGG - Intronic
1008926019 6:56893028-56893050 ATTGAGGTACAGGTGGTATTTGG + Intronic
1009383939 6:63066874-63066896 ATTGGGGTACAGATGGTATTTGG + Intergenic
1010378163 6:75198547-75198569 ATTCAGATATAGATGAAATTTGG + Intronic
1011476508 6:87754028-87754050 ATTCCGGTACAGGTGGTATTTGG + Intergenic
1011983396 6:93415526-93415548 ATTCTCATACTGATAGTATCAGG - Intronic
1012119641 6:95349229-95349251 ATTCAGATAAAGATTGAATTAGG + Intergenic
1013721200 6:113030304-113030326 ATTGGGATACAGGTGGTATTTGG - Intergenic
1013852145 6:114528894-114528916 ATTCCAGTACAGGTGGTATTTGG + Intergenic
1013900499 6:115150558-115150580 ATTGGCATACAGGTGGTATTTGG + Intergenic
1014285552 6:119493476-119493498 ATTGGGGTACAGATGGTATTTGG - Intergenic
1015563069 6:134537297-134537319 ATTCACATGCCGATGGTGCTGGG - Intergenic
1016019411 6:139220038-139220060 ACTCTCAAACTGATGGTATTAGG + Intergenic
1016499708 6:144705618-144705640 ACTCCCATAGTGATGGTATTGGG - Intronic
1017038274 6:150286552-150286574 ATGCACATCCAGCTGGTCTTTGG + Intergenic
1017287869 6:152698595-152698617 ATTTAAGTACAGATGTTATTAGG - Intronic
1017932813 6:158974358-158974380 ATTAACATTCAGATGGTTATGGG - Intronic
1018494505 6:164336381-164336403 ATTCCCATAGTGATAGTATTAGG + Intergenic
1021130581 7:16907703-16907725 ATTGGGATACAGGTGGTATTTGG - Intergenic
1021877143 7:25059695-25059717 ATTCACAAAAAGATGCCATTAGG + Intergenic
1022642855 7:32204655-32204677 ATTCCCTTACATGTGGTATTTGG + Intronic
1022781865 7:33593691-33593713 ATTCACCTACATATGGTAGGGGG + Intronic
1024072429 7:45797382-45797404 AGACGCATACAGATGGGATTTGG + Intergenic
1024344278 7:48297057-48297079 ATTCACATACAGATGGTATTGGG + Intronic
1030560589 7:111079783-111079805 ATTCATATACTGATGGCACTTGG + Intronic
1030969434 7:116036490-116036512 ATTCACATGCTGATGGTATTTGG - Intronic
1031184763 7:118462494-118462516 ATTCTCATATAGTTTGTATTAGG + Intergenic
1031660323 7:124416365-124416387 ATTCCCAAAGTGATGGTATTTGG + Intergenic
1032810570 7:135411313-135411335 ATTCATTTACATATTGTATTTGG + Intronic
1033461817 7:141553272-141553294 ATCCCCATTGAGATGGTATTAGG - Intronic
1034082117 7:148288492-148288514 ATTCATATGTTGATGGTATTTGG - Intronic
1034524069 7:151644208-151644230 ATTGGCATACAGGTGGTATTTGG - Intronic
1034763799 7:153698163-153698185 ATTCCCAGAGAGATGGAATTGGG + Intergenic
1034939755 7:155222845-155222867 GCTCACACAGAGATGGTATTAGG + Intergenic
1035821221 8:2594179-2594201 ATTGGGGTACAGATGGTATTTGG + Intergenic
1038463538 8:27738230-27738252 ATTGGGGTACAGATGGTATTTGG - Intronic
1040767105 8:50925535-50925557 ATTCAGATACAGATAGAAATTGG + Intergenic
1040969591 8:53120270-53120292 ATTCTCATAAGGATGGTAATAGG - Intergenic
1041486974 8:58389991-58390013 CTGCACATACAGATGCTCTTTGG + Intergenic
1041593016 8:59612495-59612517 ATTCTCATGCAGATGGTTTGTGG - Intergenic
1041877465 8:62706708-62706730 ATTGGGATACAGGTGGTATTTGG + Intronic
1042131156 8:65587831-65587853 ATTTATATACTGATGGTATTAGG - Intergenic
1042357419 8:67843942-67843964 ATTTAGATACACATGTTATTTGG + Intergenic
1042916578 8:73881074-73881096 AGTGACTTACAGATGGTATGGGG + Intergenic
1043919659 8:85966413-85966435 ATTCAGATGCAGATGGTCTGAGG + Intergenic
1044809400 8:96042460-96042482 ATTAACAAAGAGATAGTATTTGG - Intergenic
1045116286 8:98984946-98984968 ATTTATATACAAATAGTATTTGG - Intergenic
1046794202 8:118353356-118353378 ATTCCCAAAGTGATGGTATTTGG + Intronic
1046880208 8:119299256-119299278 AGTGACTTACAGATGGTGTTGGG - Intergenic
1047012499 8:120687208-120687230 ATTCATAGACAGATGGTCTTTGG - Intronic
1047457332 8:125027734-125027756 ATTGGGATACAGGTGGTATTTGG - Intronic
1047505192 8:125474113-125474135 AGTACCACACAGATGGTATTAGG + Intergenic
1048619389 8:136114957-136114979 AATCAGATAAATATGGTATTTGG + Intergenic
1050166336 9:2768698-2768720 ATTCCCAAAGTGATGGTATTTGG - Intronic
1050765010 9:9121788-9121810 ATTGGGATACAGGTGGTATTTGG - Intronic
1051355778 9:16238749-16238771 ATTAAAATACAAATGGTTTTTGG + Intronic
1052581402 9:30359748-30359770 ATTGGGATACAGGTGGTATTTGG + Intergenic
1052777526 9:32747700-32747722 ATTGGGATACAGGTGGTATTTGG + Intergenic
1053401043 9:37822760-37822782 ATTGGAATACAGGTGGTATTCGG - Intronic
1053651746 9:40176577-40176599 AGACACATACAGATGATATTTGG - Intergenic
1053902136 9:42805899-42805921 GGACACATACAGATGGTATTTGG - Intergenic
1054849021 9:69827541-69827563 GTACACATACAGATGGTAGTGGG - Intronic
1055668360 9:78574725-78574747 ATTTACTTACACATGGTGTTTGG - Intergenic
1057118812 9:92551546-92551568 ATTGGGGTACAGATGGTATTTGG + Intronic
1058530976 9:105904353-105904375 ATTAACATACAGATTTGATTAGG - Intergenic
1058777374 9:108297614-108297636 ATTCATATGTTGATGGTATTTGG - Intergenic
1059389957 9:113992789-113992811 ATGGACACACAGATGGCATTTGG + Intronic
1060726435 9:126008936-126008958 ATTCACACACATAGGGTTTTAGG - Intergenic
1203486666 Un_GL000224v1:62468-62490 ATTTACATCCACATTGTATTTGG + Intergenic
1203499288 Un_KI270741v1:4368-4390 ATTTACATCCACATTGTATTTGG + Intergenic
1188130961 X:26432327-26432349 ATTCACATTTGGATGGTAGTGGG - Intergenic
1188433146 X:30129683-30129705 ATTGGCATACAGGTGGTATTTGG - Intergenic
1189218666 X:39350759-39350781 ATTGGGATACAGGTGGTATTTGG - Intergenic
1189705368 X:43754267-43754289 ATTCGGGTACAGGTGGTATTTGG + Intergenic
1190363912 X:49673995-49674017 CTTTACATAGAGGTGGTATTAGG + Intergenic
1190707907 X:53046039-53046061 ATTCTCCTATTGATGGTATTTGG + Intergenic
1190757589 X:53414243-53414265 AAGAACATGCAGATGGTATTTGG + Intronic
1191679702 X:63828607-63828629 ATTGGGATACAGTTGGTATTTGG - Intergenic
1191954656 X:66631326-66631348 ATTGGGATACAGGTGGTATTTGG - Intronic
1193578982 X:83238520-83238542 ATTGGGATACAGGTGGTATTTGG - Intergenic
1193825997 X:86227991-86228013 ATTGAGGTACAGGTGGTATTTGG + Intronic
1194619759 X:96156511-96156533 AAACACTTACAGATGGTATATGG + Intergenic
1197270952 X:124424256-124424278 ATTCATATGCTGATGGCATTTGG + Intronic
1197688564 X:129472204-129472226 ATGCACATAGCGATGGTATCAGG - Intronic
1197707096 X:129641832-129641854 ATTCATATGTTGATGGTATTTGG - Intergenic
1197954154 X:131928987-131929009 ATTGGGATACAGGTGGTATTTGG + Intergenic
1198251834 X:134886634-134886656 ATTCACATACAGAGAGGAATTGG - Intergenic
1198315607 X:135463098-135463120 ATTGCGGTACAGATGGTATTTGG - Intergenic
1198583384 X:138092313-138092335 ATTGAGGAACAGATGGTATTTGG - Intergenic
1198764984 X:140071361-140071383 ATTCATATGCTGATGGCATTTGG - Intergenic
1198812506 X:140549841-140549863 ATTCACATACAGAGTGTAGTTGG - Intergenic
1199150074 X:144421497-144421519 ATTGGGATACAGGTGGTATTTGG + Intergenic
1199704196 X:150409941-150409963 ATTGACATAGAAATGGTATGTGG + Intronic
1200837233 Y:7744485-7744507 ATTCACAAAATGATGGTATATGG + Intergenic
1201733672 Y:17233820-17233842 CTTCAAATACAAATGGTAATTGG + Intergenic